WO2015091653A2

WO2015091653A2 - Means and methods for treating a pruritus-like skin-disease

Info

Publication number: WO2015091653A2
Application number: PCT/EP2014/078230
Authority: WO
Inventors: Karin Loser; Verena KUPAS
Original assignee: Westfaelische Wilhelms-Universitaet Muenster
Priority date: 2013-12-17
Filing date: 2014-12-17
Publication date: 2015-06-25
Also published as: WO2015091653A3; EP3083670A2

Abstract

The present application relates to a non-human transgenic animal developing a pruritus-like skin disease and/or a pathological eye phenotype, characterized by epidermal overexpression of 4-1BB. The animal model allows for screening for agents useful for treating pruritus-like skin disease. Accordingly, the present application provides means and methods for treating pruritus-like skin disease.

Description

MEANS AND METHODS FOR TREATING A PRURITUS-LIKE SKIN-DISEASE

FIELD OF THE INVENTION

[0001] The present invention relates to a non-human transgenic animal developing a prurituslike skin disease and a pathological eye phenotype, characterized by epidermal overexpression of 4-1 BB, the transgenic animal comprising additionally to the two natural genomic copies at least two more transgenic 4-1 BB copies. The present invention further relates to a method of making a non-human transgenic animal developing a pruritus-like skin disease and a pathological eye phenotype, characterized by epidermal overexpression of 4-1 BB, the method comprising microinjecting a K14-4-1 -BB DNA constructs into the pro-nucleus of said animals' fertilized ovum, and screening the animals' offspring for 4-1 BB transgenic animals by phenotype analysis. Provided is also a cell line derived from the non-human transgenic animal overexpressing 4-1 BB. In a further aspect, the present invention provides a method for the treatment of a human subject suffering from a pruritus-like skin disease, said method comprising administering a therapeutically effective amount of an inhibitor of 4-1 BB/4-1 BBL signaling to a human subject in need thereof. The present invention is further directed to a 4- 1 BB/4-1 BBL antagonist for use in the treatment of said human subject suffering from a prurituslike skin disease. A method for screening a 4-1 BB/4-1 BBL antagonist useful for treating a pruritus-like skin-disease, the method including assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling, is also envisaged. The present invention also relates to a method for evaluating the progression of a pruritus-like skin-disease in a patient. A method for evaluating whether a subject may be of a risk to develop a pruritus-like skin-disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, is further comprised by the present invention.

BACKGROUND OF THE INVENTION

[0002] The activation of naive T cells requires besides the ligation of the T-cell receptor with the major histocompatibility complex (MHC) on antigen presenting cells (APCs) another co- stimulatory signal, provided in many cases by activation of CD28 in resting T cells. 4-1 BB (CD137), a membrane glycoprotein and member of the tumor necrosis factor (TNF) receptor gene family, provides another T cell co-stimulatory signal. Signaling via 4-1 BB up-regulates survival genes, enhances cell division, induces cytokine production, and prevents activation- induced cell death in T cells. 4-1 BB has been reported to be expressed by activation on CD4⁺ cells, CD8⁺ cells, myeloid cells, such as monocytes, neutrophils, mast cells, and eosinophils, NK cells and NKT cells. 4-1 BB is further expressed in a constitutive manner on CD1 1 c⁺ dendritic cells (DC) and CD4⁺CD25⁺ regulatory T cells (Vinay et al., Semin Immunol (1998) 10:481 -9; Croft et al., Nat Rev Immunol (2003) 3:609-20; Watts, Annu Rev Immunol (2005) 23:23-68, Vinay et al., Cell Mol Immunol (201 1 ) 8:281 -4).

[0003] 4-1 BB is stably up-regulated when T cells are activated by a variety of agonists, such as plate-bound anti-CD3, ConA, phytohemagglutinin, interleukin (IL)-2, IL-4, CD28, phorbol myristoyl acetat, or ionomycin (alone or in combination) in the presence of antigen-presenting cells (Vinay et al., Mol Cancer Ther (2012) 1 1 (5):1 -9). Once expressed, 4-1 BB binds to a high- affinity 4-1 BB ligand (4-1 BBL), a type II transmembrane protein that is present on a variety of APCs, including mature DCs, activated B cells, and macrophages.

[0004] 4-1 BB/4-1 BBL interaction has a widespread function, effecting immune cells including T cell activation and proliferation, as well as regulation of cell viability. Interaction of 4-1 BB with 4- 1 BBL is reported to deliver a costimulatory signal important in the T cell-APC interaction and increases the activity of both APCs and T-cells. Consequently, APCs proliferate, and adhesion and/or secretion of various cytokines are elicited (Cannons et al. J Immunol. (2000) 165(1 1 ):6193-6204; Schwarz et al. Biochem Biophys Res Commun. (1997) 235(3):699-703). Mice lacking 4-1 BB survive, but have an altered though functional immune response and a reduced cytokine secretion. The costimulatory signal provided by 4-1 BB may act in combination with CD28 activation to prolong the T cell response, and may also act independently of CD28.

[0005] The importance of the 4-1 BB/4-1 BBL signaling pathway has been underscored in a number of diseases, including cancer. Because tumor cells, among others, are killed by cytotoxic T lymphocytes (CTL) in an antigen specific manner, agents that promote CD8⁺ T cell activation and impart strong cytolytic and inflammatory properties, as well as antigen specificity, are ideal candidates for enhancing tumor-antigen-specific immunity. Stimulation of 4-1 BB, through either its natural ligand or agonistic antibodies induces potent anti-tumor immunity. Thus, immunotherapy targeting CD8+ T cells with agonistic anti-4-1 BB monoclonal antibodies (mAB) or variants of the 4-1 BB ligand seem to fulfill these requirements, because 4-1 BB- mediated signals biased toward CD8+ T cells, promoting their survival, differentiation, and acquisition of potent cytolytic properties (Vinay et al., J Mol Med (2006) 84:726-36). Growing evidence indicates that agonistic anti-4-1 BB monoclonal antibodies possess strong antitumor properties, which are the results of their powerful CD8⁺ T cell activating, IFN-γ producing, and cytolytic marker-inducing capabilities (Vinay et al., Mol Cancer Ther (2012) 1 1 (5): 1 -9). Currently, a humanized anti-4-1 BB mAB having a favorable toxicity profiles is in clinical trials in patients with solid tumors. In addition, combination therapy of anti-4-1 BB with other anticancer agents, such as radiation, has robust tumor-regression abilities against nonimmunogenic or poorly immunogenic tumors (Vinay et al., Mol Cancer Ther (2012) 1 1 (5): 1 -9).

[0006] Even though 4-1 BB interaction with agonistic ABs or the 4-1 BB ligand enhances lymphocyte activation, which seems to be usable in cancer treatment, recent studies have shown, that 4-1 BB and its ligand 4-1 BBL constitute a pathogenic pair in atherogenesis. 4-1 BB has been found to promote a pro-inflammatory phenotype of atherosclerotic lesions, and inflammatory conditions including atherosclerosis, graft vs. host disease and sepsis, which can be treated by antagonistic aglycosylated antibodies against the 4-1 BB receptor (US 201 1/0229460). Moreover, 4-1 BB/4-1 BBL interaction seems to promote obesity-induces adipose inflammation by triggering bidirectional inflammatory signalling in adipocytes and macrophages (Tu et al., Hindawi Publishing Corporation, Mediators of Inflammation (2012), article ID 972629). Accordingly, antagonistic 4-1 BB/4-1 BBL compounds inhibiting the interaction of 4-1 BB with 4-1 BBL, appear to be useful in the treatment of disease associated with 4-1 BB expression.

[0007] WO 2004/055513 reports the use of a 4-1 BB antagonist in treatment of tumor patients in order to neutralize 4-1 BB expression by tumors, which enables the immune system of a patient to eliminate or at least reduce the tumor mass. In this connection it was observed that tumor cells exhibit a defence mechanism against the host immune system, expressing CD137 (4-1 BB) as a neo-antigen which provides protection from the host immune response. Specifically, 4-1 BB induces apoptosis in cytotoxic immune cells and 4-1 BB expression leads to TGFp secretion by the tumor cells which further inhibit anti-tumor immune response. Thus, neutralization of 4-1 BB expressed by tumors and/or inhibition of 4-1 BB expression by tumors, seem to enable a patient to eliminate or at least reduce the tumor mass. Therefore, 4-1 BB antagonists (comprising 4-1 BB specific antibodies, peptides, organic small molecules, antisense oligonucleotides, siRNA, antisense expression vectors or recombinant viruses) are promising compounds in cancer immunotherapy, reducing or eliminating at least the function of 4-1 BB, down-regulating the 4- 1 BB expression, neutralizing or inhibiting the 4-1 BB ligand, and/or inhibiting 4-1 BB ligand expression.

[0008] Although few patients treated with a humanized agonistic mAB against 4-1 BB developed as a side effect pruritus during cancer therapy (Sznol et al., J Clin Oncol (2008) 26:abstract

3007), so far 4-1 BB/4-1 BBL signaling was never connected with the development of pruritus and pruritus-like skin diseases in animals or humans. Pruritus (or itch) is the predominant symptom of skin diseases and can best be defined as an unpleasant sensation that leads to a desire to scratch. Since all human species experience pruritus in the course of their life time, distinction between acute itch, which is of a limited time period ranging from seconds to weeks such as itch related to acute insect bite reactions, and chronic pruritus, which lasts for greater than 6 weeks and of which the present disclosure will be focused. Diseases associated with pruritus are e.g. prurigo nodularis, allergies, atopic dermatitis, psoriasis, urticaria, uremic pruritus of dialysis patients, diabetes mellitus or leukemia.

[0009] Generalized pruritus may be classified in different categories on the basis of the underlying causative disease. However, due to the poorly understood pathophysiology, the development of effective treatment modalities for pruritus has proven to be particularly difficult. The therapy of pruritus is challenging and currently takes on an individualistic approach. At present, there is no universally accepted, well established therapy regime for pruritus-like skin disease and pruritus therapy varies depending on the underlying etiology (Patel et al., Expert Opin Pharmacother (2010) 1 1 (10):1673-1682). New therapies are based on advances in the understanding of the mechanisms that cause pruritus. However, without eradication of the underlying systemic disease, treatment is often palliative. Certain therapies, such as antihistamines and emollients, offer marginal benefit, but are tried because of their low cost and potential for providing relief.

[0010] Because of the lack of an appropriated animal model, pruritus research is often practiced with cell culture systems. However, since development and forwarding of pruritus depend on many different types of cells as e.g. neurons, mast cells or lymphocytes, cell cultures are only partly suitable to disclose processes and signaling involved in pruritus-like skin disease. With regard to the state of the art, there exists a need for a new model to study development and treatment of pruritus-like skin diseases for analysing the molecular and cellular mechanisms underlying the development of itch. Such a model should be useful to design new medicaments for treatment of patients suffering from pruritus and to test the efficacy of such therapeutics in order to improve healthy situation of patients with itchy diseases. This model should be applicable for a simple evaluation in order to predict the responsiveness of a human patient to said medicament and to adjust the treatment regimen.

[0011] In sum, there is a need in the art to provide new means and methods that help to diagnose and/or treat patients suffering from pruritus. The technical problem underlying the present application is thus to comply with this need. The technical problem is solved by providing the embodiments reflected in the claims, described in the description and illustrated in the examples and figures that follow. SUMMARY OF THE INVENTION

[0012] The present invention is, at least partly, based on the surprising finding that the 4-1 BB/4- 1 BBL signaling is involved in induction of a pruritus-like skin disease and/or a pathological eye phenotype, the non-human transgenic animal characterized by overexpression of 4-1 BB in basal keratinocytes. Additionally, the present invention provides the first evidence that human pruritus patients (e.g. patients with prurigo nodularis or diabetic prurigo) exhibit an increased expression of 4-1 BB and 4-1 BB ligand in the lesional skin in comparison to a healthy human subject, and 4-1 BB/4-1 BBL signaling seems to be involved in manifestation of pruritus-like skin diseases in humans. This was unforeseeable, as 4-1 BB/4-1 BBL signaling was not reported so far as to be involved in the development of pruritus and/or a pathological eye phenotype.

[0013] To analyze the effects of 4-1 BB/4-1 BBL signaling on cutaneous immunity in vivo, transgenic (tg) mice comprising additionally to the endogenous gene locus/loci at least two and not more than fourteen additional 4-1 BB copies were bred by introducing a K14-4-1 BB DNA construct into the genome of said animal. As disclosed by the present invention, 4-1 BB transgenic mice show a uniform transgenic overexpression of 4-1 BB in basal keratinocytes under control of a keratin 14 (K14) promoter.

[0014] Surprisingly, 4-1 BB transgenic mice exhibit a pathological eye phenotype characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes, wherein some animals additionally exhibit a restricted mobility of the eyelid. Immunohistology of the diseased eyes revealed additional cell layers on the anterior side of the lens, said cells sticking together with the iris. Interestingly, although pathological data suggest that the pathological eye phenotype develops several weeks before first symptoms of the pruritus-like skin disease, at first sight, the pathological eye phenotype is not apparent, while it is at second sight.

[0015] Beginning at the age of three months, 4-1 BB tg mice exhibit hallmarks of human pruritus and develop a pruritus-like skin disease characterized by inflammatory skin lesions at the ears, snout, and neck, and an increased scratch behavior. Immunohistology of the lesional skin revealed characteristic hallmarks of human pruritus such as epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis, and the infiltration of lymphocytes like T cells, mast cells, and eosinophils into the dermis.

[0016] Notably, in particular mast cell numbers were significantly up-regulated in lesional skin from tg mice as evidenced by immunofluorescence staining using antibodies against CD1 17 (c- kit) and FcERI. As mast cells, by releasing IL-31 , a cytokine that has been implicated in itch, can contribute to pruritus development, IL-31 expression was quantified, and an elevated IL-31 mRNA levels in lesional skin from K14-4-1 BB tg mice as compared to controls could be observed. Immunophenotyping of inflammatory cells in human prurigo revealed that in particular CD8+ T cells infiltrate cutaneous lesions.

[0017] Moreover, in inflammatory skin mast cells have been shown to regulate CD8+ effector T cell functions via 4-1 BB/4-1 BBL signaling. Hence, the numbers and phenotype of CD8+ T cells in skin lesions and regional lymph nodes from K14-4-1 BB tg mice were quantified. Interestingly, although the numbers of total CD8+ T cells were similar in draining lymph nodes, up-regulated levels of proliferating CD8+ T cells expressing activation- and cytotoxic markers as well as proinflammatory cytokines in lesional skin from K14-4-1 BB tg mice as compared to controls were detected. Accordingly, cutaneous antigen-presenting cells express 4-1 BBL and 4-1 BB is detectable in the skin upon inflammation.

[0018] Together the data of the present invention suggest for the first time a role of 4-1 BB/4- 1 BBL signaling in the development of itch and pruritus-like skin diseases and/or a pathological eye phenotype. The pruritus-like skin disease is possibly caused via recruitment of mast cells to lesional skin and activation of CD8+ effector cells. The involvement of 4-1 BB/4-1 BBL signaling in development of pruritus-like skin diseases could be confirmed in human patients, as it could be proven that patients suffering from prurigo or diabetic prurigo exhibit an increased expression level of 4-1 BB and 4-1 BBL in the lesional skin as compared to a healthy human subject. This was unforeseeable, as it is known that the 4-1 BB/4-1 BBL signaling has various effects on immune cells including T cell activation and proliferation, but no association between 4-1 BB/4-1 BBL interaction and the development of a pruritus-like skin disease has been reported so far in humans.

[0019] The data of the present invention further disclose that 4-1 BB seems to influence substance P/neurokinin-receptor-mediated pruritus, since K14-4-1 BB tg mice treated with a neurokinin-signaling pathway antagonist, such as Ivemend or Aprepitant (tradename Emend) did not exhibit inflammatory skin lesions or increased scratch behavior, while antagonists of the opioid or histamine signaling pathways such as Naloxon or Tavegil were less effective.) Accordingly, blocking of substance P/neurokinin-receptor signaling pathway seems to be well suited to prevent a subject from developing 4-1 BB/4-1 BBL-mediated pruritus-like skin disease or to treat a subject suffering from a 4-1 BB/4-1 BBL-mediated pruritus-like skin disease.

[0020] Moreover, the present disclosure prompts that blocking of 4-1 BB/4-1 BBL signaling (e.g. by specific inhibitors, such as 4-1 BBL-Fc or 4-1 BB-Fc) might be suitable for the treatment of itch in association with different disorders like leukemia, cutaneous T cell lymphoma, kidney diseases, diabetes, or inflammatory skin diseases. Since specific antagonists of 4-1 BB/4-1 BBL signaling are known from cancer therapy, such compounds could also be applied in treatment of lesional skin of patients suffering from pruritus (e.g. patients with prurigo nodularis, atopic dermatitis, or allergies). Alternatively, new specific 4-1 BB/4-1 BBL antagonist useful in the treatment of pruritus might be developed. Accordingly, the present invention provides 4-1 BB/4- 1 BBL antagonists blocking the 4-1 BB/4-1 BBL signaling for use in treatment of human subjects suffering from a pruritus-like skin disease. Moreover, such antagonists might be used to prevent a human subject from developing of pruritus-like skin diseases.

[0021] Thus, the transgenic animal model overexpressing 4-1 BB in basal keratinocytes as provided by the present inventors seems to be well suited for analyzing the molecular and cellular mechanisms underlying the development of pruritus and for evaluating the efficacy of novel therapeutics in treatment of pruritus-like skin diseases. Since at present no universally accepted, well established therapy regime for pruritus-like skin disease is available and treatment of pruritus-like disease is rather unspecific, there exists a need to overcome the uncertainties in the valuation of relevant therapeutic decisions. Thus, a reliable model to study new therapeutic approaches in treatment of pruritus-like skin diseases is urgently required and addresses the need set out in the state of the art.

[0022] The present invention is at least partly based on the fact, that overexpression of 4-1 BB in basal keratinocytes of a non-human transgenic animal is indicative for the development of a pruritus-like skin-disease and/or a pathological eye phenotype characterized by blindness, cataracts, heavy scarring, and deformation of the lens in both of the transgenic animals' eyes. Thus, in a first aspect, the present invention relates to a non-human transgenic animal characterized by overexpression of 4-1 BB in basal keratinocytes, wherein the transgenic animal comprises additionally to the copy in the endogenous gene locus at least two further 4-1 BB copies and develops a pruritus-like skin disease and/or a pathological eye phenotype. The additional copies can be present in the endogenous 4-1 BB locus and/or in a locus other than the endogenous 4-1 BB locus, i.e., the additional copies can be randomly integrated in the genome of a non-human transgenic animal. However, a targeted knock-in of additional copies into the endogenous locus/loci is also possible. The non-human transgenic animal may be heterozygous or homozygous for the additional 4-1 BB copies. Further, the non-human transgenic animal preferably comprises additionally to the copies in the endogenous gene locus at least two further transgenic 4-1 BB copies and not more than fourteen further 4-1 BB copies. In one embodiment the non-human transgenic animal comprises 2, 3, 4, 5, 6, 7, 8, 9, 10,1 1 , or 12 additional 4-1 BB copies, with 12 additional 4-1 BB copies being preferred. [0023] In some embodiments, the additional 4-1 BB copies are transfected into the animals' genome as a K14-4-1 -BB DNA construct. The K14-4-1 -BB DNA construct comprises in the following order (5' to 3') a keratin 14 promoter, an intron, preferably a β-globulin intron, 4-1 BB cDNA, and a poly A sequence, preferably a K14 poly A sequence. In some embodiments the 4- 1 BB cDNA is non-human. In one embodiment the 4-1 BB cDNA is murine. In one embodiment the 4-1 BB cDNA is human.

[0024] The non-human transgenic animal is preferably a rodent. In some embodiments the non- human transgenic animal is a mouse. In some embodiments the non-human transgenic animal is a rat. In some embodiments the non-human transgenic animal is a guinea pig. In some embodiments the non-human transgenic animal is a rabbit. In some embodiments the non- human transgenic animal is a zebrafish. In some embodiments the non-human transgenic animal is a mouse of the C57BL/6 species.

[0025] The non-human transgenic animal may essentially be characterized by overexpression of 4-1 BB in the skin of said animal as compared to a wild type animal. In some embodiments the non-human transgenic animal may essentially be characterized by overexpression of 4-1 BB in the epidermis of said animal as compared to a wild type animal. In some embodiments the non-human transgenic animal may essentially be characterized by overexpression of 4-1 BB in basal keratinocytes of said animal as compared to a wild type animal.

[0026] In some embodiments the non-human transgenic animal exhibits inflammatory skin lesions at the ears. In some embodiments the non-human transgenic animal exhibits inflammatory skin lesions at the snout. In some embodiments the non-human transgenic animal exhibits inflammatory skin lesions at the neck. In some embodiments the non-human transgenic animal exhibits an increased scratch behavior.

[0027] In some embodiments the pruritus like skin disease is itch. In some embodiments the pruritus like skin disease is prurigo nodularis. In some embodiments the pruritus like skin disease is atopic dermatitis. In some embodiments the pruritus like skin disease is neurodermatitis. In some embodiments the pruritus like skin disease is urticaria. In some embodiments the pruritus like skin disease is an allergy. In some embodiments the pruritus like skin disease is psoriasis. In some embodiments the pruritus like skin disease is uremic pruritus. In some embodiments the pruritus like skin disease is diabetes mellitus. In some embodiments the pruritus like skin disease is leukemia. [0028] In some embodiments the non-human transgenic animal exhibits characteristic hallmarks of human pruritus. In one embodiment a hallmark of human pruritus is epidermal hyperplasia. In one embodiment a hallmark of human pruritus is irregular acanthosis. In one embodiment a hallmark of human pruritus is fibrosis. In one embodiment a hallmark of human pruritus is collagenosis. In one embodiment a hallmark of human pruritus is infiltration of lymphocyte like T cells into the dermis. In one embodiment a hallmark of human pruritus is infiltration of mast cells into the dermis. In one embodiment a hallmark of human pruritus is infiltration of eosinophils into the dermis.

[0029] In some embodiment the pathological eye phenotype is characterized by additional cell layers on the anterior side of the lens, said cells sticking together with the iris. In some embodiments the pathological eye phenotype of the non-human transgenic animal is characterized by blindness in both of said animals' eyes. In some embodiments the pathological eye phenotype of the non-human transgenic animal is characterized by cataracts in both of said animals' eyes. In some embodiments the pathological eye phenotype of the non-human transgenic animal is characterized by heavy scarring in both of said animals' eyes. In some embodiments the pathological eye phenotype of the non-human transgenic animal is characterized by deformation of the lens in both of said animals' eyes.

[0030] The pathological eye phenotype is essentially not caused by an increased scratch behavior of the non-human transgenic animal. The non-human transgenic animal exhibits an unimpaired cornea. In some embodiments the non-human transgenic animal may be further characterized by a restricted mobility of the eyelid.

[0031] In some embodiments the non-human transgenic animal exhibits an increased infiltration of activated mast cells into the lesional skin compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased IL-31 mRNA levels in the lesional skin as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased IFNy mRNA levels in the lesional skin as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased IL- 4 mRNA levels as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased IL-10 mRNA levels in the lesional skin as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased IL- 17 mRNA levels in lesional skin as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased histamine release in the lesional skin as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased numbers of proliferating and activated CD8+ T-cells in the lesional skin as compared to a wild type animal. In some embodiments the non-human transgenic animal exhibits increased numbers of proliferating and activated CD8+ T-cells in the regional lymph nodes as compared to a wild type animal.

[0032] In some embodiments the non-human transgenic animal of the first aspect is a model suitable for analyzing molecular and cellular mechanisms underlying the development of pruritus-like skin diseases. In some embodiments the non-human transgenic animal of the first aspect is a model suitable for analyzing molecular and cellular mechanisms underlying the development of eye diseases characterized by blindness, cataracts, heavy scarring and/or deformation of the lens. In some embodiments the non-human transgenic animal of the first aspect is a model suitable for analyzing molecular and cellular mechanisms underlying the development of uveitis.

[0033] In some embodiments the non-human transgenic animal of the first aspect is a model suitable for investigating the efficacy of therapeutic compounds in treatment of a pruritus-like skin disease. In some embodiments the non-human transgenic animal of the first aspect is a model suitable for investigating the efficacy of therapeutic compounds in treatment of an eye diseases characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens.

[0034] In a second aspect, the present invention relates to a cell line derived from the non- human transgenic animal of the first aspect, said cell line overexpressing 4-1 BB. Overexpression is in relation to the wild-type expression of 4-1 BB as explained in more detail herein below. Preferably, the cells of said cell line comprise additionally to the copies in the endogenous gene locus at least two further 4-1 BB copies and not more than fourteen further 4- 1 BB copies. Likewise with the non-human transgenic animals described herein, the cell line can contain the additional 4-1 BB copies in the endogenous 4-1 BB locus or in one or more loci different from the endogenous 4-1 BB locus, i.e., as random integration in the genome of a non- human transgenic animal. However. A targeted knock-in into the endogenous locus/loci is also possible. In one embodiment the cells of said cell line comprise additionally to the copies in the endogenous gene locus 12 additional 4-1 BB copies. In one embodiment, the cell line derived from the transgenic animal of the first aspect is a keratinocyte cell line.

[0035] In a third aspect, the present invention relates to a method of making a non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes, said method comprising introducing into said animal 4-1 BB cDNA. [0036] The transgenic animal according to the third aspect is preferably a rodent. In some embodiments the non-human transgenic animal is a mouse. In some embodiments the non- human transgenic animal is a rat. In some embodiments the non-human transgenic animal is a guinea pig. In some embodiments the non-human transgenic animal is a rabbit. In some embodiments the non-human transgenic animal is a zebrafish. In some embodiments the non- human transgenic animal is a mouse of the C57BL/6 species.

[0037] The method of the third aspect comprises microinjecting into said animal a K14-4-1 -BB DNA construct and screening the animals' offspring for 4-1 BB transgenic animals by phenotype analysis. The K14-4-1 -BB DNA construct preferably comprises in the following order (5' to 3') a keratin 14 promoter, an intron, preferably a β-globulin intron, 4-1 BB cDNA, and poly A sequence, preferably a K14 poly A sequence. The K14-1 -1 -BB DNA construct is preferably microinjected into the pro-nucleus of said animals' fertilized ovum. In some embodiments the 4- 1 BB cDNA is non-human. In one embodiment the 4-1 BB cDNA is murine. In one embodiment the 4-1 BB cDNA is human.

[0038] In some embodiments the phenotype screened by the method according to the third aspect comprises a pruritus-like skin disease. According to the method of the third aspect, in some embodiments phenotypic hallmarks of pruritus are inflammatory skin lesions at the ears, snout, and neck of the transgenic animal. In some embodiments a phenotypic hallmarks of pruritus is an increased scratch behavior of the transgenic animal. In some embodiments a phenotypic hallmark of pruritus is one of epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis, and infiltration of lymphocyte like T-cells, mast cells, and eosinophils into the dermis.

[0039] In some embodiments the phenotype screened by the method according to the third aspect comprises a pathological eye phenotype. In some embodiments the pathological eye phenotype is characterized by additional cell layers on the anterior side of the lens, said cells sticking together with the iris. In some embodiments the pathological eye phenotype is characterized by blindness. In some embodiments the pathological eye phenotype is characterized by cataracts. In some embodiments the pathological eye phenotype is characterized by heavy scarring. In some embodiments the pathological eye phenotype is characterized by a deformation of the lens in both of the transgenic animals' eye. The pathological eye phenotype is essentially not caused by an increased scratch behavior of the transgenic animal. Both eyes of the transgenic animal typically exhibit an unimpaired cornea. In some embodiments the pathological eye phenotype is further characterized by a restricted mobility of the eyelid. [0040] In one embodiment the method of the third aspect is a method of making a transgenic mouse of the C57BL/6 species, said transgenic mouse overexpressing 4-1 BB in basal keratinocytes. However, any other mouse species such as BALB/c or nude mice can also be sued for making a transgenic mouse.

[0041] In a fourth aspect, the present invention relates to the use of 4-1 BB cDNA for making a transgenic non-human animal, wherein said animal is characterized by a pathological eye phenotype that preferably comprises blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes. As mentioned above, it was much to the surprise of the present inventors that transgenic mice also developed the onset of symptoms of a pruritus-like disease a pathological eye phenotype. This phenotype was not visible at first sight, but only at second sight after a histological analysis of eye tissue. However, such animals also develop a pruritus-like disease. Hence, said animal having a pathological eye phenotype is preferably further characterized by a pruritus-like skin disease comprising inflammatory skin lesions at the ears, snout and neck of said animal, and increased scratch behavior. In some embodiments the cDNA used according to the fourth aspect is non-human. In some embodiments the 4-1 BB cDNA is murine. In some embodiments the 4-1 BB cDNA is human. The transgenic non-human animal according to the fourth aspect is preferably a rodent. In some embodiments the non-human transgenic animal is a mouse. In some embodiments the non- human transgenic animal is a rat. In some embodiments the non-human transgenic animal is a guinea pig. In some embodiments the non-human transgenic animal is a rabbit. In some embodiments the non-human transgenic animal is a zebrafish. In some embodiments the non- human transgenic animal is a mouse of the C57BL/6 species.

[0042] The present invention further discloses a higher expression of 4-1 BB and 4-1 BBL in the lesional skin of patients with prurigo or diabetic prurigo as compared to a healthy human skin. Thus, in a fifth aspect, the present invention relates to a method for treatment of a human subject suffering from a pruritus-like skin disease, said method comprising administering a therapeutically effective amount of an inhibitor of 4-1 BB/4-1 BBL signaling to a human subject in need thereof. In some embodiments the human subject in need of treatment with an inhibitor of 4-1 BB/4-1 BBL signaling exhibits characteristic hallmarks of human pruritus. In some embodiments the characteristic hallmark of human pruritus is epidermal hyperplasia. In some embodiments the characteristic hallmark of human pruritus is irregular acanthosis. In some embodiments the characteristic hallmark of human pruritus is fibrosis. In some embodiments the characteristic hallmark of human pruritus is collagenosis. In some embodiments the characteristic hallmark of human pruritus is an infiltration of lymphocyte like T-cells, mast cells, or eosinophils into the dermis. [0043] In some embodiments according to the method of the fifth aspect, the 4-1 BB/4-1 BBL antagonist is orally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is parenterally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is subcutaneously administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intravenously administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intramuscularly administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intraperitoneally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by intranasal instillation. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by implantation. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by intracavitary instillation. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by intravesical instillation. In some embodiments the 4-1 BB/4-1 BBL antagonist is intraocularly administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intraarterially administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intralesionally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is transdermal^ administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intradermally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by application to mucous membranes.

[0044] In a sixth aspect, the present invention relates to a 4-1 BB/4-1 BBL antagonist for use in the treatment of a human subject suffering from a pruritus-like skin disease.

[0045] In a seventh aspect, the present invention relates to a 4-1 BB/4-1 BBL antagonist used to prevent a human subject from developing of pruritus-like skin diseases.

[0046] The 4-1 BB/4-1 BBL antagonist according to the sixth or the seventh aspect of the present invention is preferably a specific inhibitor of the 4-1 BB/4-1 BBL interaction. The 4-1 BB/4-1 BBL antagonist typically blocks the 4-1 BB/4-1 BBL signaling. Accordingly, "a 4-1 BB/4-1 BBL antagonist" when used herein includes an antagonist against 4-1 BB, an antagonist against 4-

1 BBL and an antagonist that blocks, interferes, abolishes or diminishes the interaction between

4-1 BB and 4-1 BBL. The term "4-1 BB/4-1 BBL" antagonist as used also encompasses an entity including a chemical or biological entity being capable of reducing or eliminating at least the function of 4-1 BB and/or its 4-1 BB ligand or functional analogues or equivalents thereof. The interference with 4-1 BB function can be exerted by any direct or indirect mechanism, including inhibition or neutralization by binding molecules, down regulation of 4-1 BB expression, expression of non-functional 4-1 BB and/or 4-1 BBL derivatives, neutralization or inhibition of 4-

1 BB ligands, in particular the natural 4-1 BB ligand, as well as inhibition of 4-1 BB ligand expression. In some embodiments the 4-1 BB/4-1 BBL antagonist is a peptide. In some embodiments the 4-1 BB/4-1 BBL antagonist is an organic small molecule. In some embodiments the 4-1 BB/4-1 BBL antagonist is an antisense oligonucleotide. In some embodiments the 4- 1 BB/4-1 BBL antagonist is a siRNA. In some embodiments the 4-1 BB/4-1 BBL antagonist is an antisense expression vector. In some embodiments the 4-1 BB/4-1 BBL antagonist is a recombinant virus. In some embodiments the 4-1 BB/4-1 BBL antagonist is a soluble portion of 4- 1 BB or 4-1 BBL, such as an extracellular portion of 4-1 BB or 4-1 BBL, respectively. In some embodiments the 4-1 BB/4-1 BBL antagonist is a fusion protein consisting of the extracellular portion of 4-1 BB or 4-1 BBL coupled to a stabilizing entity. In some embodiments the stabilizing entity is the Fc region of human immunoglobulin G. In some embodiments the extracellular portion of human 4-1 BB is coupled to the FC region of a human immunoglobulin, such as lgG1 , lgG2, lgG3 or lgG4. The Fc region of the human immunoglobulin G preferably extends the half- life of said 4-1 BB/4-1 BBL antagonist. In one embodiment the 4-1 BB/4-1 BBL antagonist is an antibody, e.g. an antibody against 4-1 BB, such as a glycosylated or non-glycosylated 4-1 BB antibody or an antibody against 4-1 BBL, such as a glycosylated or non-glycosylated 4-1 BBL antibody. In one embodiment the 4-1 BB/4-1 BBL antagonist is a lipocalin mutein. The 4-1 BB/4- 1 BBL antagonist preferably decreases the expression level of IL-2, IL-4, IL-10, IL-17, IL-31 , and/or IFNy. These cytokines are known to be up-regulated by the interaction of 4-1 BB and 4- 1 BBL.

[0047] In an eighth aspect, the present invention relates to the use of a 4-1 BB/4-1 BBL antagonist for the preparation of a medicament for treatment of a patient suffering from a pruritus-like skin disease.

[0048] In a ninth aspect, the present invention relates to a method for screening a 4-1 BB/4- 1 BBL antagonist useful for treating a pruritus-like skin disease, the method including assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling.

[0049] In a tenth aspect, the present invention relates to a method for screening a 4-1 BB/4- 1 BBL antagonist useful for preventing a pruritus-like skin disease, the method including assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling.

[0050] In some embodiments the method for screening a 4-1 BB/4-1 BBL antagonist according to the ninth or the tenth aspect comprises administering a 4-1 BB/4-1 BBL antagonist to a cell line overexpressing 4-1 BB, measuring the change of the expression level of a biomarker, wherein said biomarker is one of IL-2, IL-4, IL-10, IL-17, IL-31 , and IFNy, and comparing the expression level of one or more of said biomarkers by said cell line to a reference expression level of said biomarker. The expression level of one or more biomarkers is measured in a sample obtained from the cell line overexpressing 4-1 BB. Measuring the expression level of one or more biomarkers includes measuring the level of biomarker mRNA in the sample.

[0051] In some embodiments the method for screening a 4-1 BB/4-1 BBL antagonist according to the ninth or tenth aspect comprises administering a 4-1 BB/4-1 BBL antagonist to a transgenic animal overexpressing 4-1 BB in basal keratinocytes, measuring the change of the expression level of a biomarker, wherein said biomarker is one of IL-2, IL-4, IL-10, IL-17, IL-31 , and IFNy, and comparing the expression level of one or more of said biomarkers by said transgenic animal to a reference expression level of said biomarker. The expression level of the biomarker is measured in a sample obtained from the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes. The sample is preferably a tissue sample. Measuring the expression level of one or more biomarkers includes measuring the level of biomarker mRNA in the sample.

[0052] The 4-1 BB/4-1 BBL antagonist is useful for treating a pruritus-like skin disease, or preventing a pruritus-like skin disease, if the expression of said biomarker under administration of a 4-1 BB/4-1 BBL antagonist is significant lower than the reference expression level for said biomarker. The 4-1 BB/4-1 BBL antagonist is not useful for treating a pruritus-like skin disease, or preventing a pruritus-like skin disease, if the expression of said biomarker under administration of a 4-1 BB/4-1 BBL antagonist is approximate or higher than the reference expression level of said biomarker.

[0053] In an eleventh aspect, the present invention relates to a method for evaluating whether a subject may be of a risk to develop a pruritus-like skin-disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, comprising determining in a sample, preferably a skin sample whether the 4-1 BB and/or 4-1 BB expression level in basal keratinocytes of said subject is increased in comparison to a reference values. An increased 4-1 BB and/or 4-1 BBL expression level in in basal keratinocytes indicates a higher risk to develop a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens. A 4-1 BB and/or 4-1 BBL expression at normal level in basal keratinocytes indicates a lower risk to develop a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens.

[0054] In a twelfth aspect, the present invention relates to a method for evaluating the progression of a pruritus-like skin disease in a patient. The method comprises determining the amount of 4-1 BB and/or 4-1 BBL present in the biological sample of a patient, and comparing the determined amount of 4-1 BB and/or 4-1 BBL to a control value obtained from a biological sample of said patient at a date earlier than that date. The result of the comparison provides an evaluation of the progression of the pruritus-like skin-disease in the patient, wherein said pruritus-like skin disease is associated with 4-1 BB overexpression in basal keratinocytes.

[0055] According to a thirteens aspect, the present invention relates to the use of a neurokinin- signaling pathway antagonist for preventing a human subject from developing a 4-1 BB/4-1 BBL- mediated pruritus-like skin diseases.

[0056] In a fourteenth aspect, the present invention relates to a method for the treatment of a human subject suffering from a 4-1 BB/4-1 BBL-mediated pruritus-like skin disease, said method comprising administering a therapeutically effective amount of a neurokinin-signaling pathway antagonist to a human subject in need thereof.

[0057] A fifteenth aspect of the present invention relates to a neurokinin-signaling pathway antagonist for use in the treatment of a 4-1 BB/4-1 BBL-mediated pruritus-like skin diseases.

[0058] A sixteenth aspect of the present invention relates to a neurokinin-signaling pathway antagonist used to prevent a human subject from developing of pruritus-like skin diseases. In some embodiments the neurokinin-signaling pathway antagonist of the present invention is Ivemend. In some embodiments the neurokinin-signaling pathway antagonist of the present invention is Emend® (aprepitant).

DETAILED DESCRIPTION OF THE INVENTION

[0059] Unless otherwise stated, the following terms used in this document, including the description and claims, have the definitions given below.

[0060] It is to be noted that as used herein, the singular forms "a", "an", and "the", include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a reagent" includes one or more of such different reagents and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.

[0061] Those skilled in the art will recognize, or be able to ascertain, using not more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0062] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the methods and uses described herein. Such equivalents are intended to be encompassed by the present invention.

[0063] Several documents are cited throughout the text of this disclosure. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0064] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or sometimes when used herein with the term "having".

[0065] When used herein "consisting of excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. In each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms.

[0066] As used herein, the conjunctive term "and/or" between multiple recited elements is understood as encompassing both individual and combined options. For instance, where two elements are conjoined by "and/or", a first option refers to the applicability of the first element without the second. A second option refers to the applicability of the second element without the first. A third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or" as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or" as used herein.

[0067] The word "about" as used herein refers to a value being within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the art. The term "about" is also used to indicate that the amount or value in question may be the value designated or some other value that is approximately the same. The phrase is intended to convey that similar values promote equivalent results or effects according to the invention. In this context "about" may refer to a range above and/or below of up to 10%. The word "about" refers in some embodiments to a range above and below a certain value that is up to 5%, such as up to up to 2%, up to 1 %, or up to 0.5 % above or below that value. In one embodiment "about" refers to a range up to 0.1 % above and below a given value.

[0068] The present invention discloses for the first time that 4-1 BB/4-1 BBL signaling is involved in induction of a pruritus-like skin disease and/or a pathological eye phenotype, characterized by overexpression of 4-1 BB in basal keratinocytes in a subject. Additionally, the present invention provides the first evidence that human pruritus patients (e.g. patients with prurigo nodularis or diabetic prurigo) exhibit an increased expression of 4-1 BB and 4-1 BB ligand in the lesional skin in comparison to a healthy human subject. This disclosure was unexpected as 4- 1 BB/4-1 BBL signaling was reported to be involved in activating several signaling pathways in immune cells, including T cell activation, but has not been reported so far as to be involved in the development of pruritus or pathological eye phenotypes. Accordingly, this finding allows to diagnose and/or treat pruritus-like diseases, since prior to the present invention overexpression of 4-1 BB was not linked or associated with pruritus-like diseases. [0069] According to the present invention, use of 4-1 BB/4-1 BBL antagonists blocking the 4- 1 BB/4-1 BBL signaling should prompt serious consideration in therapy of pruritus-like skin diseases. Moreover, these findings disclosed herein suggest new therapeutic approaches in treatment of human pruritus by using said 4-1/4-1 BBL antagonist in therapy of pruritus-like skin diseases as prurigo nodularis, atopic dermatitis, neurodermatitis, urticarial, allergies, psoriasis, uremic pruritus, diabetes mellitus, or leukemia.

[0070] The present invention provides, amongst others, a non-human transgenic animal and a method of making such non-human transgenic animal, said animal characterized by overexpression of 4-1 BB in basal keratinocytes, wherein the overexpression of 4-1 BB in said transgenic animal is indicative for the development of a pruritus-like skin-disease and/or a pathological eye phenotype characterized by blindness, cataracts, heavy scarring, and deformation of the lens in both of the transgenic animals' eyes. The non-human transgenic animal of the present disclosure seems to be a model very suitable to study cellular and molecular processes underlying the development of itch-disease and for investigating the efficacy of novel therapeutics as 4-1 BB/4-1 BBL antagonists for treatment of human patients suffering from pruritus-like skin diseases. Accordingly, in some embodiments the present disclosure provides 4-1 BB/4-1 BBL antagonists for the preparation of a medicament which can be used in the treatment of said patients suffering from a pruritus-like skin disease. In this regard the 4-1 BB/4-1 BBL antagonist will significantly reduce hallmarks of human pruritus and decreases the expression level of biomarkers involved in the development of pruritus, such as IL-2, IL-4, IL-10, IL-17, IL-31 , and/or IFNy. Said 4-1 BB/4-1 BBL antagonist might further be used in the treatment of a subject in order to prevent said subject to develop a pruritus-like skin disease characterized by blindness, cataracts, heavy scarring and/or deformation of the lens.

[0071] A method for screening a 4-1 BB/4-1 BBL antagonist useful for therapy according to the present invention is also comprised herein. Moreover, the methods of the present invention allow evaluating whether a subject may be of a risk to develop a pruritus-like skin disease or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, and can be used to evaluate the progression of said diseases. Such methods can be taken to define the risk level of a subject with regard to pruritus or eye diseases and will be applicable to monitor the course of the disease of a patient suffering from a pruritus-like skin disease or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens.

[0072] A method for evaluating whether a subject may be of a risk to develop a pruritus-like skin-disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, comprising determining whether the 4-1 BB expression level in a sample, preferably skin sample of said subject is increased in comparison to a reference value.

The transgenic animal overexpressing 4-1 BB

[0073] As mentioned above, the present inventors surprisingly found that a non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes develops a pruritus-like skin disease and/or a pathological eye phenotype characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes. Pruritus-like skin diseases in the scope of the present invention preferably comprise itch, prurigo nodularis, atopic dermatitis, neurodermatitis, urticaria, allergy, psoriasis, uremic pruritus, diabetes mellitus, cutaneous T cell lymphoma and leukemia.

[0074] The term "4-1 BB" when used herein refers to both nucleotide and amino acid sequences for a molecule that belongs to the tumor necrosis factor receptor superfamily, a group of cysteine-rich cell-surface molecules. It is also known as CD137. Said term includes fragments, derivatives, homologs or paralogs of the nucleotide sequences shown in Figure 16 or of the amino acid sequences shown in Figure 17 that have at least 50% or more identity to said nucleotide or amino acid sequences, respectively, and encode or have a biological function of a mammal, preferably mouse or human 4-1 BB protein. Preferably, a polypeptide (or nucleic acid) sequence is substantially identical to a 4-1 BB reference sequence as shown in Figure 16 and 17, respectively, if it exhibits about 50 % identity, e.g. 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 % or more than 95 % identity to the reference sequence.

[0075] With regard to the respective biological process itself, the terms "expression", "gene expression" or "expressing" refer to the entirety of regulatory pathways converting the information encoded in the nucleic acid sequence of a gene first into messenger RNA (mRNA) and then to a protein. In this context, it is also noted that the term "gene product" refers not only to a protein, including e.g. a final protein (including a splice variant thereof) encoded by that gene and a respective precursor protein where applicable, but also to the respective mRNA, which may be regarded as the "first gene product" during the course of gene expression.

[0076] The term "overexpressing" when used herein means that the 4-1 BB gene is expressed above the level of wild-type expression. Expression can be measured on nucleotide level, e.g. by a nucleic acid amplification technique such as PCR, e.g. qPCR and/or on amino acid level, e.g., by an immunoassay, such as ELISA. Wild-type expression means the expression level of

4-1 BB of a non-human animal or cell line derived thereof that does not contain additional 4-1 BB copies. However, wild-type expression in the context of diagnosis as described herein means that a subject, preferably a human, does not express 4-1 BB to such an extent that a pruritus-like skin disease and/or a pathological eye phenotype is observed, i.e., that the subject is healthy as regards a pruritus-like skin disease and/or a pathological eye phenotype.

[0077] The term "subject" as used herein, also addressed as an individual, refers to an organism including a bird, fish, or mammal including a human or a non-human animal. The non- human animal is preferably a rodent selected from the group consisting of a mouse, rat, guinea pig, and rabbit. A fish includes a zebrafish. Thus, the methods, uses and compositions described in this document are generally applicable to both human and animals. As explained in more detail below, a sample may be analyzed that has been obtained from said subject, which is typically a living organism. Where the subject is a living human who may receive treatment or diagnosis for a disease or condition as described herein, it is also addressed as a "patient".

[0078] The term "transgenic" (abbreviated tg herein) when used herein refers to an organism, such as an animal or cell, to whom a so called transgene has been introduced. A transgene is a gene or genetic material that has been transferred naturally, or by any of a number of genetic engineering techniques from one organism to another. The introduction of a transgene has the potential to change the phenotype of an organism. Thus, the term transgene encompasses a segment of DNA containing a gene sequence that has been isolated from one organism and is introduced into a different organism. This non-native segment of DNA may retain the ability to produce RNA or protein in the transgenic organism, or it may alter the normal function of the transgenic organism's genetic code. As used in the present disclosure, a non-human 4-1 BB transgenic animal is an animal that comprises additionally to the 2 natural copies of the 4-1 BB gene in the endogenous gene locus at least two further 4-1 BB gene copies. Preferably, the non- human transgenic animal comprises not more than fourteen further 4-1 BB gene copies. The non-human 4-1 BB transgenic animal is characterized in that said animal is preferably heterozygous or homozygous for the additional 4-1 BB gene copies.

[0079] The term wild-type (abbreviated wt herein) when used herein refers to an organism including, e.g. a subject, such as a human, an animal such as a non-human animal or cells which does not have additional 4-1 BB copies in its genome and/or which overexpresses 4-1 BB. As used in the present disclosure, the term wild-type organism, animal or cell refers to an organism, animal or cell having exclusively the two natural occurring endogenous copies of the 4-1 BB gene, without any additional transgenic 4-1 BB gene copies.

[0080] The non-human transgenic animal of the present invention comprises additionally to the copies in the endogenous gene locus at least two further 4-1 BB copies and not more than fourteen further 4-1 BB copies. Said animal is usually heterozygous for the additional 4-1 BB copies, wherein said additional 4-1 BB copies are transfected into the animals' genome as a K14-4-1 -BB DNA construct, comprising in the following order (5' to 3') a keratin 14 promoter, an intron, preferably a β-globulin intron, 4-1 BB cDNA, and a poly A sequence, preferably a K14 poly A sequence. The non-human transgenic animal disclosed herein overexpresses 4-1 BB in the skin of said animal as compared to a wild type animal. In particular the non-human transgenic animal disclosed herein overexpresses 4-1 BB in basal keratinocytes, as compared to a wild type animal. Staining with antibodies against 4-1 BB demonstrated overexpression of 4- 1 BB in transgenic mice ear skin (Figure 1 A) and 4-1 BB was quantified in comparison to a naive wild type mouse (Figure 1 B).

[0081] In the present invention, the non-human transgenic animal overexpressing 4-1 BB is preferably a rodent selected from the group consisting of mouse, rat, guinea pig, rabbit, or it may be a zebrafish. In one embodiment of the present invention, said animal is a mouse of the C57BL/6 species.

[0082] Interestingly, beginning at the age of three months, K14-4-1 BB tg mice developed inflammatory skin lesions at the ears, snouts and neck in comparison to a naive wild type mouse (Figure 2A). Since neither anti-nuclear antibodies nor immunoglobulin deposition at the kidney tissue could be detected, skin lesion development in tg mice was most likely not attributable to systemic autoimmunity. However, immunohistology of lesional mouse skin revealed characteristic hallmarks of human pruritus such as epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis. Additionally, infiltration of lymphocytes like T cells, mast cells, and eosinophils into the dermis could be observed. Lesional ear skin from K14-4-1 BB transgenic mice and ear skin from a wild type mouse are contrasted in Figure 2B. Moreover, increased frequencies of scratching in C57BL/6 mice containing the K-14-4-1 BB DNA construct could be perceived as compared to wild type mice when the animals were video monitored over 24 h (Figure 2C).

[0083] Notably, said K-14-4-1 BB tg mice overexpressing 4-1 BB in basal keratinocytes exhibit an increased infiltration of activated mast cells into the lesional skin, and significant mast cell up-regulation in lesional skin has been evidenced by immunofluorescence staining using antibodies against CD1 17 (c-kit) and FcERI (Figure 3a). Histamine concentration in lesional skin from K14-4-1 BB tg mice and corresponding skin areas from wt controls were quantified by ELISA, demonstrating an increased histamine release in lesional skin of K14-4-1 BB tag mice (Figure 3B). In this regard it has been speculated that CD8⁺ T cells secrete IL-31 in lesional skin, since IL-31 is a cytokine known to promote itch and to recruit mast cells. Hence, numbers of CD8⁺ T cells as well as the IL-31 expression in cutaneous lesions from K14-4-1 BB tg mice and corresponding skin areas from wt controls were quantified. Immunophenotyping of inflammatory cells revealed markedly up-regulated levels of CD8⁺ T cells (Fig. 3C) as well as an increased IL-31 mRNA concentration (Figure 3D) in lesional skin from K14-4-1 BB tg mice as compared to wt controls, confirming that besides mast cells in particular CD8+ T cells infiltrate cutaneous lesions.

[0084] To assess whether indeed activated CD8⁺ T cells were responsible for the IL-31 secretion, CD8⁺ as well as CD4⁺ T cells from K14-4-1 BB tg mice and wt controls were purified. Subsequently, the proliferation of both cell subsets was quantified by BrdU incorporation (Figure 4A) and the cytokine expression was determined by quantitative PCR (Figure 4B). As depicted therein, CD8⁺ T cells from K14-4-1 BB tg mice showed an increased proliferation compared to wt controls whereas the proliferation of CD4⁺ T cells was similar in both groups. In addition, a significantly increased expression of IL-31 , I FN-y, IL-4, IL-1 0 or IL- 17 in CD8⁺ T cells from tg versus wt mice could be observed, which was not detectable in CD4⁺ T cells.

[0085] Moreover, in inflammatory skin, mast cells have been shown to regulate CD8+ effector T cell functions via 4-1 BB/4-1 BBL signaling. Furthermore, CD8+ T cells can recruit mast cells by release of IL-9. Hence, the numbers and phenotype of CD8+ T cells in skin lesions and regional lymph nodes from K14-4-1 BB tg mice were quantified (draining lymph node: 29,7 % of total T cells ± 6,1 % in tg mice versus 19.6 % of total T cells ± 5.7 % in wt mice; back skin: 32 ± 8 cells per 0.1 mm² in tg mice versus 9 ± 4 cells per 0.1 mm2 in wt mice). Interestingly, numbers of total CD8+ T cells were similar in draining lymph nodes, but up-regulated levels of proliferating CD8+ T cells expressing activation- and cytotoxic markers (Figure 4C) as well as proinflammatory cytokines (Figure 4B) in lesional skin from K14-4-1 BB tg mice as compared to controls were detected. Accordingly, cutaneous antigen-presenting cells expressing 4-1 BBL and 4-1 BB are detectable in the skin upon inflammation.

[0086] As confirmed by the data disclosed herein, in some embodiments of the present invention, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes exhibits increased infiltration of activated mast cells into the lesional skin as compared to a wild type animal. Additionally, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes exhibits increased IL-31 mRNA levels and an increased histamine release in the lesional skin as compared to a wild type animal. Moreover, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes exhibits increased numbers of proliferating and activated CD8⁺ T cells in the lesional skin and regional lymph nodes as compared to a wild type animal. [0087] Surprisingly, K14-4-1 BB tg mice overexpressing 4-1 BB in basal keratinocytes exhibit an pathological eye phenotype characterized by blindness, cataracts, heavy scarring and deformation of the lens in both of the transgenic animals' eyes. Histological data disclose additional cell layers on the anterior side of the lens in the eyes of K14-4-1 BB tag mice, wherein said cells stick together with the iris (Figure 5). On the contrary, wild type animals feature a homogenous monolayer on the lens. Interestingly, the pathological phenotype in K14-4-1 BB tag mice is visible before said animal exhibits inflammatory skin lesions and increased scratch behavior, and before any hallmarks of human pruritus can be perceived. Consequently, the pathological eye phenotype is not cause by an increased scratch behavior of the transgenic animal, since said animals exhibit an unimpaired cornea. In some embodiments the pathological eye phenotype is further characterized by a restricted mobility of the eyelid. In some embodiments the transgenic animal moves the eyelid normally.

[0088] Taken together, these data suggest a role of 4-1 BB/4-1 BBL signaling in the development of pruritus-like skin disease and/or a pathological eye phenotype, possibly via recruitment of mast cells to lesional skin and activation of CD8+ effector T cells. This presumption could be confirmed for the first time also in human patients suffering from prurigo nodularis or diabetic prurigo. As depicted in Figure 6, said patients exhibit an increased expression of 4-1 BB and 4-1 BB ligand in the lesional skin in comparison to a healthy human subject. This was unforeseeable, as up to now 4-1 BB/4-1 BBL signaling has never been reported as to be involved in the development of a pruritus-like skin disease and/or a pathological eye phenotype, neither in animals, nor in human species. Although members of the TNF-TNF receptor family superfamily has been shown to play critical roles in regulating cellular activation, differentiation and apoptosis, including T cell activation and cytokine induction (Smith et al., Cell (1994) 76:959), 4-1 BB/4-1 BBL overexpression has never been mentioned as to be responsible for the occurrence of pruritus-like skin diseases and/or eye diseases.

[0089] Thus, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes seems to be a suitable model for analyzing molecular and cellular mechanisms underlying the development of pruritus-like skin disease, comprising prurigo nodularis, atopic dermatitis, neurodermatitis, urticarial, allergy, psoriasis, uremic pruritus, diabetes mellitus, and leukemia. Since pathophysiology and origin of pruritus are not well understood up to now, there is a need to comprehend molecular and cellular mechanisms in order to develop new and specific therapy approaches.

[0090] Moreover, although not reported so far, the data of the present invention surprisingly suggest a role of 4-1 BB/4-1 BBL signaling in the development of an eye diseases characterized by blindness, cataracts, heavy scarring and deformation of the lens. Thus, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes can be a suitable model for analyzing molecular and cellular mechanisms underlying the development of such eye diseases. In one embodiment the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes is a suitable model for analyzing molecular and cellular mechanisms underlying the development of uveitis. In addition, it was also found that various immune cells such as T cells, dendritic cells, granulocytes infiltrate regions within the eye that are normally immune- privileged. Specifically, it is apparent from Figure 20 that T-cells, both CD4-positive- and CD8- positive T cells as well as antigen-presenting cells, such as dendritic cells infiltrate the eye and are in the vicinity of a so-called coloboma.

[0091] Accordingly, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes might be a suitable model for investigating the efficacy of therapeutic compounds in treatment of a pruritus-like disease. Moreover, the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes might be a suitable model for investigating the efficacy of therapeutic compounds in treatment of an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens. The term "therapeutic compound" as used herein refers to any compounds suitable to treat pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens.

[0092] "Investigating the efficacy of therapeutic compounds" as used herein means to analyze if a therapeutic compound has any influence on the progress of a disease, in particular on a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens. In the scope of the present invention, a therapeutic compound may be efficient in treatment of a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, in case of a positive influence on the progression of said disease. Positive in this regards means that the hallmarks of said disease will significantly be reduced. On the contrary, a therapeutic compound may not be efficient in treatment of a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, in case of no influence on the progression of said disease. No influence in this regard means that the hallmarks of said disease will not significantly be reduced. In order to investigate the efficacy of a therapeutic compound in treatment of a pruritus-like disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, the non- human transgenic animal overexpressing 4-1 BB in basal keratinocytes needs to be treated with the therapeutic compound and the progress of the disease needs to be compared to a non- human transgenic animal not treated with said compound. [0093] When treating pruritus-like skin diseases, the therapeutic compound is preferably a 4- 1 BB/4-1 BBL antagonist blocking the 4-1 BB/4-1 BBL signaling. 4-1 BB/4-1 BBL antagonists suitable in the scope of the present invention are defined elsewhere herein.

Generation of a transgenic animal

[0094] As mentioned above, in various aspects, the present invention relates to the method of making the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes. In this context, a transgene has to be transferred into the early developing embryo. As described herein, said method comprises introducing additional 4-1 BB gene copies into the genome of an animal used to make a transgenic animal. Usually, 4-1 BB cDNA is introduced into the germ line of said animal.

[0095] Techniques for generating genetically altered animal models has been perfected over the years and the skilled artisan is aware of the variety of techniques used to introduce human genes or other genes of interest into strains of laboratory animals to study the function or pathology involved with that particular gene.

[0096] According to the present invention, the animal used to make a transgenic animal is preferably a rodent. In some embodiments said animal is a mouse. In some embodiments said animal is a rat. In some embodiments said animal is a guinea pig. In some embodiments said animal is a rabbit. In some embodiments said animal is a zebrafish. Preferably, the animal used to make a transgenic animal according to the present invention is a mouse of the C57BL/6 species. In various embodiments the 4-1 BB cDNA introduced into the germ line of said animal is human. In some embodiment the 4-1 BB cDNA introduced into the germ line of said animal is non-human. In some embodiment the 4-1 BB cDNA introduced into the germ line of said animal is murine.

[0097] In the context of the present invention, it is particularly envisaged to use a K14-4-1 BB DNA construct to introduce additional 4-1 BB gene copies into the genome of an animal used to make a transgenic animal. The DNA construct preferably comprises in the following order (5' to 3') a keratin 14 promoter, an intron, preferably a β-globulin intron, 4-1 BB cDNA, and a poly A sequence, preferably a K14 poly A sequence (Figure 7). Restriction digestion of the K14 expression vector with and without the 4-1 BB cDNA insert reveals a size of 3970 base pairs of the restriction cassette (Figure 8). The K14 promoter used in the present invention to overexpress 4-1 BB in a transgenic animal is known to be active in basal keratinocytes of the skin. Said tumor will be turned on in the early embryogenesis on day fifteen.

[0098] In some embodiments the 4-1 BB cDNA comprised in the K14-4-1 BB DNA construct used in the method of making the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes has the DNA sequence depicted in SEQ ID NO: 1 . In some embodiments the 4- 1 BB cDNA comprised in the K14-4-1 BB DNA construct used in the method of making the non- human transgenic animal overexpressing 4-1 BB in basal keratinocytes has the sequence depicted in SEQ ID NO: 2. The corresponding amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are depicted in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0099] Preferably, said K14-4-1 -BB DNA construct is microinjected into the pro-nucleus of said animals' fertilized ovum. Such technique was described in detail by Cho et al. (NIH Public Access Author Manuscript (2009)). Afterwards, the fertilized egg including the desired K14-4- 1 BB DNA construct is implanted into the foster mother and the offspring will be screened for 4- 1 BB transgenic animals by phenotype analysis. In some embodiments the foreign 4-1 BB cDNA can also be injected into the nucleus of a fertilized ovum.

[0100] The present inventors introduced the K14-4-1 BB DNA construct into the pro-nucleus of a C57BL/6 mouse. In this regard the insertion is non-targeted, that means incorporation of 4-1 BB copies into the endogenous gene locus of said animal happens randomly, usually as multiple copies in tandem, and numbers of incorporated 4-1 BB copies may vary between transgenic lines. Endogenous 4-1 BB is expressed on chromosome 4. However, in transgenic mice it is not clear into which chromosome(s) the injected K14-4-1 BB construct has integrated.

[0101] For genotyping the transfected animals in order to determine transgene copy numbers, a real-time quantitative PCR-based system can be used as described in detail elsewhere herein. Such method was disclosed as well by Ballester et al., (BioTechniques (2004), 37:610-613) and is well known to those skilled in the art. PCR results from 4-1 BB transfected keratinocytes are depicted in Figure 9, showing the amplification of a ca. 950bp fragment including the K14-4-1 BB cDNA in comparison to a mock K14 cDNA. In order to quantify the gene expression of 4-1 BB in the epidermis of naive and different transgenic founder lines, total RNA was isolated from ear skin biopsies, reverse transcribed into cDNA, and subsequently gene expression was assessed. mRNA levels in the epidermis of different founder lines are depicted in Figure 10. Results of the additional K14-4-1 BB copy numbers in the genome of different K14-4-1 BB transgenic mouse founder lines according to qPCR analysis are shown in Figure 1 1 , disclosing that between 1 and 14 additional 4-1 BB gene copies can be incorporated into the endogenous gene locus. In the context of the present invention, 4-1 BB expression may be determined using any desired technique known to those skilled in the art.

[0102] Additionally, the offspring of the animal to whom a K14-4-1 BB DNA construct has been introduced was further screened by phenotype analysis for transgenic descendants. In the context of the present invention, said phenotype may comprise a pruritus-like skin disease and/or a pathological eye phenotype. In this regard, pruritus-like skin diseases of the transgenic animals overexpressing 4-1 BB are characterized by exhibition of inflammatory skin lesions at the ears, snout, and neck. Different C57BL/6 founder lines containing between two and twelve additional 4-1 BB gene copies and developing inflammatory hallmarks of human pruritus are depicted in Figure 12 as compared to a wild type animal. Moreover, the pruritus-phenotype of the transgenic animals may be characterized by an increased scratch behavior as compared to a wild type animal (see above, Figure 2C). Additionally, protein expression of 4-1 BB in basal keratinocytes of the different founder lines containing between two and fourteen additional 4- 1 BB gene copies was investigated by the present inventors. Cryosections from ear skin of naive wild type and different transgenic mouse founder lines were stained with an antibody against 4- 1 BB, whereas nuclei were counterstained with DAPI (Figure 13).

[0103] According to the present invention, the screened pathological eye phenotype of tg mice overexpressing 4-1 BB in basal keratinocytes may be characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes. Moreover, cell layers on the anterior side of the lens sticking together with the lens can be found in the eyes of said tg mice. As described herein, the pathological eye phenotype is essentially not caused by an increased scratch behavior of the transgenic animal, as said animals exhibit an unimpaired cornea. Rather the pathological eye phenotype emerges prior to any hallmarks of pruritus. Some of the transgenic animals are further characterized by a restricted mobility of the eyelid. In some embodiments the transgenic animals are not characterized by a restricted mobility of the eyelid.

[0104] Animal models are suitable to delineate molecular mechanisms of gene products and their interactions, influencing cellular processes that form the basis of physiological systems. In this context, transgenic founder lines exhibiting high 4-1 BB protein-levels in basal keratinocytes and showing characteristic hallmarks of human pruritus should be considered as ideal animal model to analyze the molecular and cellular mechanisms underlying the development of pruritus, and to evaluate the efficacy of novel therapeutics in treatment of pruritus-like skin diseases. Further, transgenic founder lines exhibiting high 4-1 BB protein-levels in basal keratinocytes and showing an eye phenotype characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens should be considered as ideal animal model to analyze the molecular and cellular mechanisms underlying the development of several eye disease, and for evaluating the efficacy of novel therapeutics in treatment of such eye diseases. In some embodiments of the present invention, a mouse of a C57BL/6 founder line comprising twelve additional 4-1 BB gene copies as compared to a wild type animal seems to be an ideal model to study molecular and cellular mechanisms involved in the development of a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, and for investigating the efficacy of novel therapeutics for itchy diseases and/or eye diseases.

[0105] In one aspect of the present invention, 4-1 BB cDNA is used for making the transgenic animal described herein. Said animal is characterized by a pathological eye phenotype comprising blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes, and said animal is further characterized by a pruritus-like skin disease comprising inflammatory skin lesions at the ears, snout and neck of said animal, and increased scratch behavior. The transgenic animal according to the present disclosure is preferably a rodent. In some embodiments the non-human transgenic animal is a mouse. In some embodiments the non-human transgenic animal is a rat. In some embodiments the non-human transgenic animal is a guinea pig. In some embodiments the non-human transgenic animal is a rabbit. In some embodiments the non-human transgenic animal is a zebrafish. In some embodiments the non-human transgenic animal is a mouse of the C57BL/6 species. In some embodiments the cDNA used according to the present invention is non-human. In some embodiments the 4-1 BB cDNA is murine. In some embodiments the 4-1 BB cDNA is human.

Cell line from the transgenic animal

[0106] Additionally to the non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes, the present invention further provides a cell line overexpressing 4-1 BB which is derived from said multicellular transgenic animal. Preferably, these cells contain additionally to the copies in the endogenous gene locus at least two further 4-1 BB copies and not more than fourteen 4-1 BB copies. In one embodiment the cells of said cell line comprise additionally to the copies in the endogenous gene locus twelve additional 4-1 BB copies.

[0107] Said cells are preferably heterozygous for the additional 4-1 BB copies. In the present invention, mononuclear cells for establishment of a cell culture will be extracted from the transgenic animal, preferably from the epidermis, that means from the superior layer of the skin of said transgenic animal. Moreover, mononuclear cells can be released from deeper layers of the skin by enzymatic digestion with enzymes which break down the tissue structure.

Alternatively, pieces of tissue can be placed in growth media, and the cells that grow out are available for culture, known as explant culture. Cells cultured directly from the transgenic animal are known as primary cells with a limited lifespan, but can be transformed into immortalized cell line with the ability to proliferate indefinitely through random mutation or deliberate modification. The skilled artisan is aware of several ways to isolate cells from tissues for ex vivo cultures and to establish immortalized cell lines.

[0108] In the disclosure of the present invention, the cells extracted from the skin of the transgenic animal essentially overexpress 4-1 BB. In one embodiment of the present invention, cells for establishment of a cell line are extracted from the lesional skin of a patient suffering from a pruritus-like disease. In one embodiment the cell line derived from the lesional skin of a patient suffering from a pruritus-like disease is a keratinocyte cell line.

[0109] Cell lines overexpressing 4-1 BB might be useful for screening specific 4-1 BB/4-1 BBL antagonists useful for treating a pruritus-like skin disease by assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling as described elsewhere herein. Moreover, cell lines overexpressing 4-1 BB, might be useful to further study in vitro molecular and cellular mechanisms involved in the development and treatment of pruritus-like skin diseases and/or eye diseases characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens.

Treatment and diagnosis

[0110] The present inventors observed increased levels of histamine in lesional skin from K14- 4-1 BB tg mice and since blocking histamine signaling using histamine receptor antagonists has been successfully employed for the treatment of pruritus or prurigo patients in the past, the present inventors intended to analyze whether histamine receptor antagonists (like Tavegil^®) might also be able to ameliorate ongoing disease in K14-4-1 BB tg mice. Therefore, K14-4-1 BB tg mice with full-blown disease were intravenously injected with Tavegil^® for 8 weeks. Notably, systemic Tavegil^® treatment markedly reduced the dermatitis and scratching behavior in K14-4- 1 BB tg mice (Figure 14A and C). This was associated with a decrease in mast cells and CD8⁺ T cells infiltrating lesional skin (Figure 14B) and consequently, a down-regulated IL-31 expression in Tavegil^®-treated tg mice versus PBS-treated controls (Figure 14C).

[0111] Moreover, K14-4-1 BB tg mice overexpressing 4-1 BB in basal keratinocytes and treated with an anti-4-1 BB antibody once per week for six weeks, show a clearly reduced pruritus- phenotype (Figure 15B). Additionally, K14-4-1 BB tg mice which were treated with anti-4-1 BB before exhibiting any hallmarks of human pruritus did not develop a pruritus-like skin disease in the period of observation (Figure 15A). [0112] Together, these data further confirm that cutaneous 4-1 BB/4-1 BBL signaling is crucially involved in the development and progression of itch. Thus, the present inventors suggest that blocking 4-1 BB/4-1 BBL signaling e.g. by specific antagonist might be suitable for the treatment of a human subject suffering from a pruritus-like skin disease in association with different disorders like leukemia, kidney diseases, diabetes, inflammatory skin diseases. Moreover, the present invention further discloses that a 4-1 BB/4-1 BBL antagonist might be useful to prevent a human subject from developing a pruritus-like skin disease.

[0113] The present invention further reveals that 4-1 BB/4-1 BBL signaling seems to induce substance P/neurokinin-receptor-mediated pruritus. K14-4-1 BB tg mice treated with a neurokinin-signaling pathway antagonist, such as Ivemend or Aprepitant did not develop inflammatory skin lesions or increased scratch behavior, while antagonists of the opioid or histamine signaling pathway were less effective (Figure 18 and Figure 19). Accordingly, it can be assumed that neurokinin-receptor-mediated signaling plays a major role in 4-1 BB/4-1 BBL- mediated cell activation. Thus, the present invention discloses that blocking of the neurokinin- mediated signaling pathway might be suitable to prevent a human subject from exhibiting hallmarks of pruritus or a pruritus-like skin disease. Therefore, the present invention provides for the use of a neurokinin-signaling pathway antagonist to prevent a subject from developing a 4- 1 BB/4-1 BBL-mediated pruritus-like skin diseases. Moreover, the present disclosure relates to the treatment of a 4-1 BB/4-1 BBL-mediated pruritus-like skin diseases using a neurokinin- signaling pathway antagonist. The person skilled in the art is aware of a large number of peptidic and non-peptidic neurokinin-signaling pathway antagonists such as substance P analoga, Ivemend, Emend® (aprepitant), FK-888, Vofopitant (GR 205 171 ), Ezlopitant (CJ 1 1.974), CP 122.721 , CP-96345, CP-99994, GR-205171 , lanepitant (LY-303870), TAK-637, T- 2328 which can be applied within the scope of the present invention.

[0114] Although antagonists of 4-1 BB/4-1 BBL interaction have be reported as to be useful in cancer therapy (Cheuk et al., Cancer Gene Therapy (2004) 1 1 ; 215-226) and treatment of atherosclerosis, graft vs. host disease, and sepsis (US 201 1/0229460 A1 ), 4-1 BB/4-1 BBL antagonists have not been described as to be suitable in the treatment of pruritus-like skin disease.

[0115] As mentioned above, the 4-1 BB/4-1 BBL antagonist used in a method or use disclosed in this document is in various embodiments preferably a specific inhibitor or antagonist of the 4- 1 BB/4-1 BBL interaction.

[0116] In some embodiments, the 4-1 BB/4-1 BBL antagonist for use in the present invention is directed to down regulate the expression of the human or murine 4-1 BB gen. The DNA sequences of the human and murine 4-1 BB cDNA sequences are depicted in Figure 16, showing high sequence homology between human and murine 4-1 BB cDNA. In some embodiments the 4-1 BB/4-1 BBL antagonist of the present invention is directed to down regulate the expression of the human or murine 4-1 BB genes having at least 90%, preferably at least 95%, especially preferred at least 97% homology to the human or murine 4-1 BB DNA sequence or to the 4-1 BB cDNA sequences depicted in SEQ ID NO: 3 and 4, respectively.

[0117] In some embodiments the 4-1 BB/4-1 BBL antagonist for use in the present invention is directed to inhibition or neutralization of the human or murine 4-1 BB protein. The protein sequences of the human and murine 4-1 BB proteins are depicted in Figure 17, showing high sequence homology between human and murine 4-1 BB protein. In some embodiments the 4- 1 BB/4-1 BBL antagonist of the present invention is directed to inhibition or neutralization of the human or murine 4-1 BB proteins having at least 90%, preferably at least 95%, especially preferred at least 97% homology to the human or murine 4-1 BB protein sequences depicted in Figure 17.

[0118] A 4-1 BB/4-1 BBL antagonist used in a method or use herein refers to a compound that typically blocks the 4-1 BB/4-1 BBL signaling. The 4-1 BB/4-1 BBL antagonist preferably decreases the expression level of IL-2, IL-4, IL-10, IL-17, IL-31 , and/or IFNy. Preferably the 4- 1 BB/4-1 BBL antagonist for use in the present invention is physiologically well accepted. Preferred 4-1 BB/4-1 BBL antagonists show a binding constant to either 4-1 BB or 4-1 BB ligand of about at least 10⁷ M^"1. In some embodiments the binding constant is at least 10⁸ M^"1. In some embodiments the binding constant is at least 10⁹ M^"1.

[0119] In some embodiments the 4-1 BB/4-1 BBL antagonist is a peptide. In some embodiments the 4-1 BB/4-1 BBL antagonist is an organic small molecule. In some embodiments the 4-1 BB/4- 1 BBL antagonist is an antisense oligonucleotide. In some embodiments the 4-1 BB/4-1 BBL antagonist is a siRNA. In some embodiments the 4-1 BB/4-1 BBL antagonist is an antisense expression vector. In some embodiments the 4-1 BB/4-1 BBL antagonist is a recombinant virus. With the term "organic small molecule" is meant any molecule, such as a pharmaceutically active ingredient, which is not a protein, a peptide, a nucleic acid or a virus and has a molecular weight of less than 5000 Dalton (Da), less than 3000 Da, less than 1500 Da or less than 1000 Da. When used herein, the term "organic small molecule" can be substituted with the term "low molecular weight compound".

[0120] In various embodiments the 4-1 BB/4-1 BBL antagonist used in a method or use of the present invention is an antagonistic antibody. Antibodies for use herein may be directed against 4-1 BB or 4-1 BB ligand. The term "antibody" as used herein comprises polyclonal as well as monoclonal antibodies, chimeric antibodies, human or humanized antibodies, which may be present in bound or soluble form. Said term also includes fragments or derivatives of an antibody, such as Fab, F(ab)2, Fv, scFv, nanobodies, domain antibodies and the like. Polyclonal antibodies are heterogeneous mixtures of antibody molecules being produced from sera of animals which have been immunized with the antigen. The present invention comprises also polyclonal monospecific antibodies which are obtained by purification of the antibody mixture (e.g. via chromatography over a column carrying peptides of the specific epitope). A monoclonal antibody represents a homogenous population of antibodies specific for a single epitope of the antigen. Monoclonal antibodies can be prepared according to methods described in the prior art (Kohler & Milstein, Nature (1975) 256: 495-497; US-Patent 4,376,1 10; Ausubel et al., Current Protocols in Molecular Biology (1998) John Wiley & Sons, New York).

[0121] Antibodies for use in the present invention can belong to any one of the following classes of immunoglobulins, comprising IGG, IgM, IgE, IgA, and GILD, and, where applicable, a subclass of the afore-mentioned classes, e.g. sub-classes of the IgG class. IgG and its subclasses lgG1 , lgG2, lgG2a, lgG2b, lgG3 or IgM are preferred. IgG subtypes lgG1/k or lgG2b/k are especially preferred.

[0122] Chimeric antibodies are species containing components of different origin (e.g. antibodies containing a variable region derived from a murine monoclonal antibody, and a constant region derived from a human immunoglobulin). Chimeric antibodies are employed in order to reduce the immunogenicity of the species when administered to the patient and to improve the production yield. For example, in comparison to hybridoma cell lines, murine monoclonal antibodies give higher yields. However, they lead to a higher immunogenicity in a human patient. Therefore, chimeric human/murine antibodies are preferably used. Even more preferred is a monoclonal antibody in which the hypervariable complementarity defining regions (CDR) of a murine monoclonal antibody are combined with the further antibody regions of a human antibody. Such an antibody is called a humanized antibody. Chimeric antibodies and methods for their production are described in the prior art (Cabilly et al., Proc. Natl. Sci. USA (1984) 81 :3273-3277; Morrison et al., Proc. Natl. Acad. Sci USA (1984) 81 :6851 -6855; Boulianne et al., Nature (1984) 312:643-646; Cabilly et al., EP-A-125023; Neuberger et al., Nature (1985) 314:268-270; Taniguchi et al., EP-A-171496; Morrion et al., EP-A-173494; Neuberger et al., WO 86/01533; Kudo et al., EP-A-184187; Sahagan et al., J. Immunol. (1986) 137:1066-1074; Robinson et al., WO 87/02671 ; Liu et al., Proc. Natl. Acad. Sci USA (1987) 84: 3439-3443; Sun et al., Proc. Natl. Acad. Sci USA (1987) 84:214218; Better et al., Science (1988) 240:1041 -1043 (1988), and Harlow & Lane, Antibodies: A Laboratory Manual, (1988)). [0123] According to the present invention, the term "antibody" further encompasses complete antibody molecules as well as fragments thereof being capable of binding to 4-1 BB or 4-1 BB ligand, and thus exerting an antagonistic effect to 4-1 BB function. Thus, in some embodiments the antibody according to the present invention may be a fragment or derivative of the aforementioned species. Such antibodies or antibody fragments may also be present as recombinant molecules, e.g. as fusion proteins with other (proteinaceous) components. Antibody fragments are typically produced through enzymatic digestion, protein synthesis or by recombinant technologies known to a person skilled in the art. Therefore, antibodies for use in the present invention may also be recombinant antibodies or fragments thereof as well as single chain antibodies, e.g. scFv-constructs, or synthetic antibodies.

[0124] Preferably, the 4-1 BB/4-1 BBL antagonist used in a method or use of the present invention is a fusion protein consisting of the extracellular portion of human 4-1 BB coupled to a stabilizing entity. Preferably, the stabilizing entity is the Fc region of human immunoglobulin G. The extracellular portion of human 4-1 BB is coupled to the Fc region of human immunoglobulin G1. In some embodiments the extracellular portion of human 4-1 BB is coupled to the Fc region of human immunoglobulin G2. In some embodiments the extracellular portion of human 4-1 BB is coupled to the Fc region of human immunoglobulin G3. In some embodiments the extracellular portion of human 4-1 BB is coupled to the Fc region of human immunoglobulin G4. The Fc region of the human immunoglobulin G extends the half-life of said 4-1 BB/4-1 BBL antagonist. In one embodiment the 4-1 BB74-1 BBL antagonist is a glycosylated 4-1 BB antibody. In one embodiment the 4-1 BB/4-1 BBL antagonist is lipocalin mutein.

[0125] In particular preferred embodiments of the present invention, antibodies, peptides or small organic molecules are directed to one or more epitope(s) located in the extracellular domain of 4-1 BB. Specific examples of antagonistic antibodies against 4-1 BB are clone BBK-2 (Biosource, Ratingen, Germany), clone 4B4-1 (available, e.g., from Ancell or Becton Dickinson) and a polyclonal antibody (anti-4-1 BB) available from Chemicon.

[0126] The 4-1 BB/4-1 BBL antagonist used in a method or use herein might possess strong anti-inflammatory properties. In various embodiments the 4-1 BB/4-1 BBL antagonist of the present invention is capable to decrease the number of activated, histamine releasing mast cells in the lesional skin of a patient suffering from a pruritus-like skin disease as compared to a patient not treated with a 4-1 BB/4-1 BBI antagonist. The 4-1 BB/4-1 BBL antagonist is further capable to decrease histamine concentration in the lesional skin of a patient suffering from a pruritus-like skin disease as compared to a patient not treated with a 4-1 BB/4-1 BBL antagonist.

Moreover, the 4-1 BB/4-1 BBL antagonist is capable to down-regulate the level of IL-31 expressing CD8⁺ T cells in the lesional skin of a patient suffering from a pruritus-like skin disease as compared to a patient not treated with a 4-1 BB/4-1 BBI antagonist. In addition, the 4- 1 BB/4-1 BBL antagonist used in a method or use of the present invention is capable to significantly decrease the expression level of IL-31 , IFNy, IL-2, IL-4, IL-10 and/or IL-17 by CD8⁺ T cells in the lesional skin of a patient suffering from a pruritus-like skin disease as compared to a patient not treated with a 4-1 BB/4-1 BBI antagonist. The 4-1 BB/4-1 BBI antagonist will preferably reduce the number of mast cells, eosinophils, and/or of proliferating and activated CD8+ T cells infiltrating cutaneous lesions of a patient suffering from a pruritus-like skin disease as compared to a patient not treated with a 4-1 BB/4-1 BBI antagonist. Additionally, the 4-1 BB/4- 1 BBL antagonist used in a method or use of the present invention is capable to decrease characteristic hallmarks of human pruritus such as epidermal hyperplasia, irregular acanthosis, fibrosis, and/or collagenosis.

[0127] In one aspect of the present invention, the 4-1 BB/4-1 BBL antagonist will be used for the preparation of a medicament for treatment of a patient suffering from a pruritus-like skin disease. In some embodiments the 4-1 BB/4-1 BBL antagonist will be used for the preparation of a medicament used to prevent a human subject from developing a pruritus-like skin disease. Such molecules are typically provided as components of a pharmaceutical composition, optionally including at least one further active ingredient, preferably together with pharmaceutically acceptable excipients and/or additives. The 4-1 BB/4-1 BBL antagonist described herein can be formulated in a variety of useful formats for administration by a variety of routes. Concentrations of the 4-1 BB/4-1 BBL antagonist described will be such that a therapeutically effective dose of the 4-1 BB/4-1 BBL antagonist is included in the formulation, e.g., a pharmaceutical composition comprising a therapeutically effective dose of the 4-1 BB/4- 1 BBL antagonist and a carrier. The dosage regimen will be determined by the attending physician and clinical factors. As it is well known in the medical arts, dosages for any one patient depend upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs administered concurrently. Determination of the appropriate concentration of a 4-1 BB/4-1 BBL antagonist would be readily apparent to those of ordinary skill in the art.

[0128] In some embodiments, the 4-1 BB/4-1 BBL antagonist of the present invention may be formulated, for example, for intravenous, oral, sublingual, intranasal, intraocular, rectal, transdermal, intradermal, subcutaneous, mucosal, topical, or parenteral administration. Thus, the 4-1 BB/4-1 BBL antagonist may be administered in pharmaceutically acceptable formulations and in substantially non-toxic quantities. The present invention therefore also includes pharmaceutically compositions comprising a 4-1 BB/4-1 BBL antagonist of the present invention, including the 4-1 BB/4-1 BBL antagonist and biologically active fragments thereof, and a pharmaceutically acceptable carrier or diluent. [0129] In one aspect the present invention relates to a method for screening a 4-1 BB/4-1 BBL antagonist useful for treating a pruritus-like skin disease, the method including assaying the 4- 1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling. In a further aspect the present invention relates to a method for screening a 4-1 BB/4-1 BBL antagonist useful for preventing a pruritus-like skin disease, the method including assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling. In this context, the methods for screening a 4-1 BB/4-1 BBL useful for treating or preventing a pruritus-like skin disease include assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling.

[0130] The term "assaying the activity" of a 4-1 BB/4-1 BBL antagonist as used in the present disclosure refers to examining the ability of a 4-1 BB/4-1 BBL antagonist to significantly inhibit 4- 1 BB/4-1 BBL signaling. It will be understood by those skilled in the art, that such an assessment is usually not intended to be correct for 100% of the antagonist to be investigated. The term, however, requires that a prediction can be made for a significant inhibition of 4-1 BB/4-1 BBL signaling by a 4-1 BB/4-1 BBL antagonist in a proper and correct manner. Whether a 4-1 BB/4- 1 BBL antagonist is statistically significant in inhibiting 4-1 BB/4-1 BBL signaling, can be determined by those skilled in the art using various well known statistic evaluation tools, e.g., determination of confidence intervals, p-value determination, Student's t-test, and Mann- Whitney test. Suitable confidence intervals are, for example, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%. Suitable p-values are preferably 0.1 , 0.05, 0.01 , 0.005, or 0.0001 .

[0131] Assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling comprises in one embodiment the administration of a 4-1 BB/4-1 BBL antagonist to a cell line overexpressing 4-1 BB. In this regard, the change of the expression level of a biomarker by said cell line will be measured or detected.

[0132] The term "biomarker" is defined as a physical sign or laboratory measurement that occurs in association with a natural or pathological process, and that has putative diagnostic and/or prognostic utility. More precisely, the term "biomarker" may comprise a protein or a gene encoding a protein/peptide, which is expressed at a lower or higher level by a cell under different cellular conditions. In the present disclosure, said biomarker is preferably expressed and released by a subject under native and/or pathological conditions, such as pruritus-like skin diseases. The biomarker described herein is usually a cytokine expressed and released by an immune cell, in particular activated T-cells, eosinophils and/or a mast cells in the lesional skin of a subject. Said biomarker is preferably one of IL-2, IL-4, IL-10, IL-17, IL-31 , and IFNy. In the present invention, measuring the change of the expression level of one or more of said biomarkers can be used for screening a 4-1 BB/4-1 BBI antagonist useful for preventing and/or treating a pruritus-like skin disease.

[0133] The term "detect" or "detecting", as well as the term "determine" or "determining" when used in the context of a biomarker refers to any method that can be used to identify the presence of a protein/polypeptide, such as a cytokine, released or expressed by a cell. When used herein in combination with the words "level", "amount" or "value", the words "detect", "detecting", "determine" or "determining" are understood to refer to a quantitative as well as a qualitative level.

[0134] Said biomarker is preferably a cytokine and will be selected from the group consisting of IL-31 , IFNy, IL-4, IL-2, IL-10, and IL-17. The expression level of one or more of said biomarker will be compared to a reference expression level of said biomarker released by the same cell line which instead was not treated with a 4-1 BB/4-1 BBL antagonist. The expression level of one or more biomarker is measured in a sample obtained from the cell line overexpressing 4-1 BB and quantified by methods known to those skilled in the art, e.g. by PCR or ELISA techniques. Preferably, quantifying the expression level of a biomarker includes measuring the level of the biomarkers mRNA in the sample. In such a case, biomarker mRNA is extracted from the cell, reverse transcribed into cDNA and quantified by real-time PCR as described elsewhere herein.

[0135] Assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling comprises in some embodiments administering a 4-1 BB/4-1 BBL antagonist to a non- human transgenic animal overexpressing 4-1 BB in basal keratinocytes. In this context the change of the expression level of the biomarker by said transgenic animal will be measured. Said biomarker is preferably one or more cytokines and will be selected from the group consisting of IL-31 , IFNy, IL-4, IL-2, IL-10, and IL-17. The expression level of one or more of said biomarkers can be compared to a reference expression level of said biomarker released by the same transgenic animal which instead was not treated with a 4-1 BB/4-1 BBL antagonist.

[0136] According to the present invention, the 4-1 BB/4-1 BBL antagonist is useful for treating a pruritus-like skin disease, or preventing a pruritus-like skin disease, if the expression of said biomarker under administration of a 4-1 BB/4-1 BBL antagonist is significant lower than the reference expression level for said biomarker. The 4-1 BB/4-1 BBL antagonist is not useful for treating a pruritus-like skin disease, or preventing a pruritus-like skin disease, if the expression of said biomarker under administration of a 4-1 BB/4-1 BBL antagonist is approximate or higher than the reference expression level of said biomarker.

[0137] The expression level of the biomarker is measured in a sample obtained from the non- human transgenic animal overexpressing 4-1 BB in basal keratinocytes and quantified by methods known to those skilled in the art, e.g. by PCR or ELISA techniques. The sample is preferably a tissue sample of said transgenic animal, preferably a sample taken from the skin of said animal. In some embodiments the sample is taken from lesional skin of said transgenic animal. Measuring the expression level of one or more biomarkers by the non-human transgenic animal preferably includes measuring the level of biomarkers mRNA in the sample. In such a case, biomarker mRNA is extracted from the tissue sample, reverse transcribed into cDNA and quantified by real-time PCR as described elsewhere herein.

[0138] In one aspect the present disclosure relates to a 4-1 BB/4-1 BBL antagonist used to prevent a human subject from developing of pruritus-like skin disease. In this context, the human subject to whom a 4-1 BB/4-1 BBL antagonist has been administered, will not exhibit characteristic hallmarks of human pruritus. In some embodiments the 4-1 BB/4-1 BBL antagonist will be used to prevent a human subject from developing epidermal hyperplasia. In some embodiments the 4-1 BB/4-1 BBL antagonist will be used to prevent a human subject from developing irregular acanthosis. In some embodiments the 4-1 BB/4-1 BBL antagonist will be used to prevent a human subject from developing fibrosis. In some embodiments the 4-1 BB/4- 1 BBL antagonist will be used to prevent a human subject from developing collagenosis. In some embodiments the 4-1 BB/4-1 BBL antagonist will be used to prevent a human subject from an increased infiltration of lymphocytes, mast cells and/or eosinophils into the dermis of said human subject. Preferably, the human subject who can be prevented from developing of pruritus-like skin disease is a healthy human subject not exhibiting any hallmarks of human pruritus.

[0139] As disclosed by the present invention (Figure 6), patients with prurigo or diabetic prurigo show a higher expression of 4-1 BB and 4-1 BBL in the lesional skin as compared to a healthy human skin, underlining the involvement 4-1 BB/4-1 BBL signaling in induction of a pruritus-like skin disease. Moreover, K14-4-1 BB tg mice overexpressing 4-1 BB in basal keratinocytes and treated with anti-4-1 BB show a clearly reduced pruritus-phenotype, or do not develop a prurituslike skin disease when treated with anti-4-1 BB before exhibiting any hallmarks of human pruritus.

[0140] Accordingly, a method for treatment of a subject suffering from a pruritus-like skin disease is envisaged herein, said method comprising administering a therapeutically effective amount of a 4-1 BB/4-1 BBL antagonist to the subject in need thereof. In a preferred embodiment the subject is a human subject.

[0141] The terms "treatment" or "treat" as used herein mean to reduce, stabilize, or inhibit progression of a pruritus-like skin disease and/or symptoms associated therewith. Said symptoms may be hallmarks of human pruritus such as epidermal hyperplasia, acanthosis, fibrosis, collagenosis, and/or an increased infiltration of lymphocyte like T-cells, mast cells, or eosinophils into the dermis of said subject. Those in need of treatment include those already with the disorder as well as those prone to having the disorder. Preferably, a treatment reduces, stabilizes, or inhibits progression of a symptom that is associated with the presence and/or progression of a disease or pathological condition.

[0142] The 4-1 BB/4-1 BBL antagonist used in a method or use of the present invention is potentially useful for treatment of a human subject suffering from a pruritus-like skin disease, if the expression of said biomarker under administration of a 4-1 BB/4-1 BBL antagonist is significant lower than the reference expression level for said biomarker. Thus, in the scope of the present invention, the 4-1 BB/4-1 BBL antagonist useful for treatment of a human subject suffering from a pruritus-like skin disease should significantly decreases the expression level of a biomarker when administered to a cell line overexpressing 4-1 BB or when administered to a non-human transgenic animal overexpressing 4-1 BB in basal keratinocytes. In this regard said biomarker is one selected from the group consisting of IL-31 , IFNy, IL-4, IL-2, IL-10 and IL-17. It is particularly envisaged that the 4-1 BB/4-1 BBI antagonist used in a method or use of the present invention decreases the expression level of at least one of these biomarkers by 20% as compared to a control. In some embodiments the expression level of at least one of said biomarkers will be reduced by more than 20%, such as from 20% to about 50%, as compared to a control. In some embodiments the measurable expression level of said biomarker will be reduced by more than 50% (e.g. from 50% to 100%) as compared to an appropriate control. The respective control may be the expression level of a sample taken from the cell line overexpressing 4-1 BB or the non-human transgenic animal cutaneously overexpressing 4-1 BB, both not treated with a 4-1 BB/4-1 BBL antagonist. The 4-1 BB/4-1 BBL antagonist used in a method or use of the present invention is instead not potentially useful treatment of a human subject suffering from a pruritus-like skin disease, if the expression of a biomarker under administration of a 4-1 BB/4-1 BBL antagonist is approximate or higher than the reference expression level for the biomarker, said biomarker selected from the group consisting of IL-31 , IFNy, IL-4, IL-2, IL-10 and IL-17.

[0143] The term "potentially useful" when used in the context of treatment of a human subject suffering from a pruritus-like skin disease with a therapeutically effective amount of a 4-1 BB/4- 1 BBL antagonist means, that a 4-1 BB/4-1 BBL antagonist will not in all cases turn out to be therapeutically effective. By "therapeutic effect" or "therapeutically effective" is meant that a 4- 1 BB/4-1 BBL antagonist may produce the therapeutic effect for which it is administered, namely an effect on pruritus-like skin diseases. Thus, the term "therapeutic effect" refers to the inhibition of factors causing or contributing to the disease. Therapeutically effective further means, that the 4-1 BB/4-1 BBL antagonist will significantly improve the progress of the disease. The 4- 1 BB/4-1 BBL antagonist will not in all cases turn out to be therapeutically effective, because the method disclosed herein cannot provide a 100% safe prediction whether or not a subject may be responsive to a 4-1 BB/4-1 BBL antagonist, since individual factors such as age, body weight, general health, sex, diet, drug interaction and the like may have an influence as to whether or not a subject will be responsive to said 4-1 BB/4-1 BBL antagonist. The therapeutic effect of the respective methods or method steps may be detectable by all established methods and approaches which will indicate a therapeutic effect.

[0144] In the scope of the present invention, it is for example envisaged that the therapeutic effect is detected by way of surgical resection or biopsy of the affected skin or the effected tissue, which is subsequently analyzed by way of, for example, immunological techniques. Alternatively it is also envisaged that certain biomarkers in the skin of the patient are detected in order to diagnose whether or not the therapeutic approach is effective. Additionally or alternatively, it is also possible to evaluate the general appearance of the respective patient (fitness, wellbeing) which will also aid the skilled practitioner to evaluate whether therapy is effective. Those skilled in the art are aware of numerous other ways which will enable a practitioner to observe a therapeutic effect of a 4-1 BB/4-1 BBL antagonist in the context of a method or use of the present disclosure.

[0145] In some embodiments, when treating a human subject suffering from a pruritus-like skin disease with a therapeutically effective amount of a 4-1 BB/4-1 BBL antagonist, said 4-1 BB/4- 1 BBL antagonist is orally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is parenterally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is subcutaneously administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intravenously administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intramuscularly administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intraperitoneally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by intranasal instillation. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by implantation. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by intracavitary instillation. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by intravesical instillation. In some embodiments the 4-1 BB/4-1 BBL antagonist is intraocularly administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intraarterially administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is intralesionally administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is transdermal^ administered. In some embodiments the 4-1 BB/4-1 BBL antagonist is administered by application to mucous membranes. [0146] Such method for treatment of a subject suffering from a pruritus-like skin disease, comprising administering a therapeutically effective amount of a 4-1 BB/4-1 BBL antagonist to said subject, can be performed also in conjugation with other therapies, for example radiation therapies, prior to, concurrently with, or after administration of the 4-1 BB74-1 BBL antagonist.

[0147] In a further aspect, the present invention claims a method for diagnosing and/or evaluating whether a subject may already or may be of a risk to develop a pruritus-like skin- disease and/or an eye disease, preferably characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, comprising determining whether in a sample the 4-1 BB and 4-1 BBL expression level in basal keratinocytes of said subject is increased in comparison to a reference value. In this regard, an increased 4-1 BB and 4-1 BBL expression level in basal keratinocytes indicates a higher risk to develop a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens. A 4-1 BB and 4-1 BBL expression at normal level in basal keratinocytes indicates a lower risk to develop a pruritus-like skin disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens. The 4-1 BB and 4-1 BBL expression level in basal keratinocytes of a subject may be determined using any desired technique known to those skilled in the art and methods disclosed herein. A "sample" when used herein refers to a biological sample. The term "biological sample", as used herein, refers to a sample obtained from an organism or from components (e.g., cells) of an organism. The sample may be of any biological tissue or fluid. Frequently the sample will be a "clinical sample" which is a sample derived from a patient. Such samples include, but are not limited to, sputum, cerebrospinal fluid, blood, blood fractions (e.g. serum, plasma), blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, and pleural fluid, or cells therefrom. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes. Such samples include, for example, whole blood, serum, etc. Preferably, a sample is a sample that includes skin tissue or skin cells. Biological samples, (e.g. serum) can be analyzed directly or they may be subject to some preparation prior to use in methods or assays of this invention. Such preparation can include, but is not limited to, suspension/dilution of the sample in water or an appropriate buffer or removal of cellular debris, e.g. by centrifugation, or selection of particular fractions of the sample before analysis.

[0148] In a further aspect, the present invention discloses a method for evaluating the progression of a pruritus-like skin-disease in a patient. Said method comprises: (a) determining the amount of 4-1 BB or 4-1 BBL present in a biological sample of a patient, and (b) comparing the amount of 4-1 BB or 4-1 BBL ligand in said sample to a control value obtained from a biological sample of said patient at a date earlier than the date upon which the biological sample of (a) was obtained. The result of the comparison provides an evaluation of the progression of the pruritus-like skin-disease in a patient, wherein said pruritus-like skin disease is associated with 4-1 BB overexpression in basal keratinocytes. In some embodiment the biological sample is a tissue or a cell sample from said patient. In some embodiments the biological sample is a sample taken from the lesional skin of said patient. In some embodiments the biological sample is a sample taken from basal keratinocytes.

[0149] In this regards, the term "evaluating the progression" refers to any procedure or method used to assess whether or not a patient suffering from a pruritus-like skin disease is responsive to treatment with a therapeutic compound. Thus, a method for evaluating the progression of a pruritus-like skin disease might be particularly useful when treating a patient suffering from a pruritus-like skin disease with a 4-1 BB/4-1 BBL antagonist. Such evaluation may help an attending physician to obtain the appropriate information to set the appropriate therapy conditions for the treatment of a pruritus-like skin disease. As mentioned herein, the progression of a pruritus-like skin disease might depend on many factors, including the patient's size, body weight, body surface area, age, the particular compound to be administered, sex, time and route of administration, the patients history, general health, molecular markers, biomarkers, and other drugs being administered can influence the response of a human subject to treatment with a 4-1 BB/4-1 BBL antagonist. The skilled person is aware of numerous other ways which will enable him or her to evaluate the progression of a pruritus-like skin disease in a patient.

BRIEF DESCRIPTION OF THE DRAWINGS

[0150] Figure 1 : Overexpression of 4-1 BB in basal keratinocytes from K14-4-1 BB transgenic mice. (A) Cryosections from ear skin of naive wild type (wt) and transgenic (tg) C57BL/6 mice stained with antibodies against 4-1 BB and nuclei counterstaining with DAPI. (B) Quantification of gene expression of 4-1 BB in naive wt and tg mice, total RNA was isolated from ear skin biopsies and reverse transcribed into cDNA. Subsequently, the gene expression was assessed by PCR using primers for 4-1 BB and β-actin.

[0151] Figure 2: K14-4-1 BB transgenic mice develop pruritus-like skin lesions and show increased scratch behavior. (A) Typical skin pathology of wild type and K14-5-1 BB transgenic mice at the age of 16 weeks. Two mice in each group are depicted. (B) Hematoxylin and Eosin (H&E) staining of lesional skin from wild type and transgenic mice. (C) Scratching behavior of wild type and K14-4-1 BB transgenic mice at the age of 16 weeks, assessed by counting the scratches per minute from n = 10 mice each group over a time frame of 3 x 60 min. ^*, p < 0.05 versus wild type (wt).

[0152] Figure 3: Increased numbers of activated, histamine releasing mast cells and up- regulated levels of IL-31 expressing CD8⁺ T cells in lesional skin from K14-4-1 BB transgenic (tg) mice. (A) Immunofluorescence staining of cutaneous lesions from K14-4-1 BB tg C57BL/6 mice at the age of 16 weeks and corresponding skin areas of age-matched wild type (wt) controls using an antibody against CD1 17. Original magnification 200 x, sectional enlargement 400 x. (B) Histamine concentration in lesional skin from K14-4-1 BB tg mice and corresponding skin areas from wt controls as quantified by ELISA. n = 8 mice in each group; +, p < 0.05 versus wt. (C) Immunofluorescence staining of CD8⁺ T cells infiltrating lesional skin from K14-4-1 BB tg mice and corresponding skin areas from wt controls. Original magnification 200 x, one representative image for each group is shown. (D) IL-31 mRNA expression in cutaneous skin lesions from K14-4-1 BB tg mice and corresponding skin areas from wt controls as quantified by real-time PCR. n = 8 mice in each group; +, p < 0.05 versus wt.

[0153] Figure 4: Cutaneous 4-1 BB/4-1 BBL signaling up-regulates the proliferation and cytokine secretion in CD8⁺ T cells and CD4⁺ T cells and the expression of activation- and cytotoxic markers in CD8⁺ T. (A) CD8⁺ and CD4⁺ T cells were purified from K14-4-1 BB transgenic (tg) and wild type (wt) C57BL/6 mice. Prior to cell isolation, mice were injected with BrdU (100 μg per mouse, intraperitoneally), allowing quantification of cell proliferation in vivo. After the isolation of CD4⁺ and CD8⁺ T cells, proliferation of both cell subsets was assessed by flow cytometry using an anti-BrdU antibody (upper part). In order to quantify the cytokine expression (B), mRNA was extracted from purified CD8⁺ as well as CD4⁺ T cells and reverse transcribed into cDNA. To quantify the expression of activation- and cytotoxic markers (C), mRNA was extracted from purified CD8⁺ and reverse transcribed into cDNA. Gene expression levels were determined by real-time PCR from n = 5 mice in each group (lower part); p < 0.05 versus wt. Real-time PCR was performed on an AbiPrism 7300 cycler using the SYBR Green master-mix and primers specific for the above mentioned genes.

[0154] Figure 5: Hematoxylin and Eosin (H&E) staining of sections through the eye of a K14-4-1 BB transgenic C57BL/6 mouse. Histological data of a female K14- 4-1 BB tg No. D389 C57BL/6 mouse having 12 additional 4-1 BB copies disclose additional cell layers on the anterior side of the lens in the eye of said animal, wherein said cells stick together with the iris.

[0155] Figure 6: Expression of 4-1 BB and 4-1 BB Ligand (4-1 BBL) in human skin.

Comparison between healthy human skin and skin from patients with prurigo and diabetic prurigo, respectively.

[0156] Figure 7: Plasmid-card and schematic description of the K14-4-1 BB expression vector, used for generation of transgenic animals overexpressing 4-1 BB. The DNA construct comprises in the following order (5' to 3') a keratin 14 promoter, a β-globulin intron, 4- 1 BB cDNA, and a K14 poly A sequence. The K14-1 -4-BB DNA construct is microinjected into the pro-nucleus of a fertilized ovum of an animal.

[0157] Figure 8: Restriction digestion of the K14 expression vector with and without the 4-1 BB cDNA insert with the restriction enzyme EcoRI and Hind///. A size of 3970 base pairs of the 4-1 BB restriction cassette is revealed in comparison to a 3200bp restriction cassette without insert and the 1930bp plasmid-backbone.

[0158] Figure 9: PCR results from 4-1 BB transfected keratinocytes. Amplification of a ca. 950bp fragment including the K14-4-1 BB cDNA in comparison to a mock K14 cDNA.

[0159] Figure 10: 4-1 BB mRNA expression levels in the epidermis of different K-14-4-1 BB transgenic C57BL/6 mouse founder lines. The number of additional 4-1 BB copies for different K14-4-1 BB tg mice is indicated above the figure.

[0160] Figure 11 : Results of additional K14-4-1 BB copy numbers in the genome of different K14-4-1 BB transgenic C57BL/6 mouse founder lines according to qPCR analysis. The number of additional 4-1 BB copies for different K14-4-1 BB tg mice is indicated above the figure. [0161] Figure 12: Phenotype of different K14-4-1 - transgenic C57BL/6 mouse founder lines in comparison to a wild type mouse. The transgenic mouse founder lines contain additionally to the copies in the endogenous gene locus between two and twelve further 4-1 BB copies. The number of additional 4-1 BB copies is indicated above the figure.

[0162] Figure 13: Protein overexpression of 4-1 BB in basal keratinocytes of different K14-4-1 BB transgenic C57BL/6 mouse founder lines. Cryosections from ear skin of naive wild type (wt) and different transgenic (tg) mouse founder lines were stained with an antibody against 4-1 BB. Nuclei were counterstained with DAPI and one representative image for each founder line is shown. The transgenic mouse founder lines contain additionally to the copies in the endogenous gene locus between two and fourteen further 4-1 BB copies as depicted under the images. The number of additional 4-1 BB copies for different K14-4-1 BB tg mice is indicated above the figure.

[0163] Figure 14: Use of Tavegil, a histamine receptor antagonist, for treatment of pruritus/prurigo patients, ameliorated ongoing disease in K14-4-1 BB transgenic C57BL/6 mice. (A) Typical skin pathology of K14-4-1 BB tg mice after 8 weeks of treatment with PBS or Tavegil. Two mice in each group are depicted. (B) Hematoxylin and Eosin (H&E) as well as immunofluorescence staining of lesional skin from tg mice treated with PBS or Tavegil. (C) Scratch behavior and IL-31 expression in the skin of K14-4-1 BB tg mice after treatment with PBS or Tavegil. Data from n = 5 mice in each group are depicted; p < 0.05 versus PBS treatment.

[0164] Figure 15: Treatment of K14-4-1 BB transgenic C57BL/6 mice with anti-4-1 BB. (A)

K14-4-1 BB tg mice do not develop a pruritus-like skin disease when treated with anti-4-1 BB once per week for six weeks before exhibiting any hallmarks of human pruritus. (B) K14-4-1 BB tg mice overexpressing 4-1 BB in basal keratinocytes and exhibiting hallmarks of human pruritus show a clearly reduced pruritus-phenotype when treated with anti-4-1 BB once per week for six weeks.

[0165] Figure 16: Sequence homology of the human and murine 4-1 BB cDNA The upper row represents the human 4-1 BB cDNA sequence (SEQ ID NO: 2), the lower row represents the murine 4-1 BB cDNA sequence (SEQ ID NO: 1 ).

[0166] Figure 17: Sequence homology of the human and murine 4-1 BB protein. The upper row represents the human 4-1 BB protein sequence (SEQ ID NO: 4), the lower row represents the murine 4-1 BB protein sequence (SEQ ID NO: 3). [0167] Figure 18: Treatment of K14-4-1 BB transgenic C57BL/6 mice with antagonists of the opioid- and neurokinin-signaling pathway. Detection of the clinical score over a period of time between 13 and 31 weeks of age.

[0168] Figure 19: Treatment of K14-4-1 BB transgenic C57BL/6 mice with antagonists of the opioid- and neurokinin-signaling pathway. Detection of the scratching behavior over a period of time between 13 to 31 weeks of age.

[0169] Figure 20: Visualization of CD4-pos., CD8-pos. cells in immune-privileged regions of the eye in K14-4-1 BB transgenic C57BL/6.

A) HE-staining, B) CD4 and CD8 staining (FITC), C) 4-1 BB staining (PE), D) overlay of (B) and (C).

EXAMPLES

[0170] The following examples illustrate the invention. These examples should not be construed as to limit the scope of this invention. The examples are included for purposes of illustration and the present invention is limited only by the claims.

Generation of the K14-4-1 BB DNA construct and the transgenic animal overexpressing 4-1 BB in basal keratinocvte

Murine 4-1 BB cDNA was cloned into a K14 expression vector used to incorporate additional 4- 1 BB gene copies into a non-human animal in order to generate a non-human transgenic animal overexpressing 4-1 BB in basal keratin ocytes. The DNA construct comprises in the following order (5' to 3') a human keratin 14 promoter, a β-globulin intron, the murine 4-1 BB cDNA, and a K14 poly A sequence (Figure 7). Restriction digestion of the K14 expression vector using the restriction endonucleases EcoRI and Hind 111 with and without the 4-1 BB cDNA insert reveals a size of 3970 base pairs of the 4-1 BB cassette or 3200 bp of the mock cassette, respectively (Figure 8). Said K14-4-1 -BB DNA construct was microinjected into both pro-nuclei of fertilized oocytes from C57BL/6 mice. Afterwards, the microinjected fertilized oocytes including the desired K14-4-1 BB DNA construct were implanted into pseudo-pregnant foster mice. Four weeks later the pups were analyzed for the integration of the 4-1 BB DNA construct into the genomic DNA by PCR.

Genotyping of the offspring of the transgenic C57BL/6 mouse and quantification of 4-1 BB gene expression and IL-31 mRNA expression in basal keratinocytes of naive and tag C57BL/6 mice For genotyping the transfected C57BL/6 mice offspring, a real-time quantitative PCR-based system can be used. In order to quantify the gene expression of 4-1 BB and IL-31 in the epidermis of naive wild type and different transgenic founder lines, total RNA was isolated from ear skin biopsies, reverse transcribed into cDNA, and subsequently gene expression was assessed. 4-1 BB mRNA levels in the epidermis of different founder lines are depicted in Figure 10. Results of the additional K14-4-1 BB copy numbers in the genome of different K14-4-1 BB transgenic mouse founder lines according to qPCR analysis are shown in Figure 1 1 , disclosing that between 1 and 14 additional 4-1 BB gene copies can be incorporated into the endogenous gene locus. IL-31 mRNA level in the epidermis of K14-41 -BB tg mice is depicted in Figure 3D. The following PCR protocol was applied:

Primer: AM28 (5^'- CAATGATATACACTGTTTGAGATG -3^') (SEQ ID NO: 5)

4-1 BB-reverse (5^'- GATAGTACATCACACTCATAGCCTCCTCC -3^') (SEQ ID NO: 6)

PCR-Mixture (25 μΙ):

0,125μΙ GoTaq-Polymerase

5 μΙ GoTaq Puffer (5x)

1 μΙ Primer AM28

1 μΙ Primer 41 BB-reverse

1 μΙ dNTPs (10 mM)

1 ,5 μΙ Mg (25mM)

H20 ad 25 μΙ

PCR-Protocol:

94°C 2:00 min

94°C 1 :00 min

62°C 1 :00 min□ 40 Zyklen

72°C 1 :30 min

72°C 10:00 min

These PCR conditions are not intended to limit the invention, but simply illustrate specific conditions which are normally applied to achieve a satisfactory result of genotyping of a non- human transgenic animal. PCR results from 4-1 BB transfected keratinocytes are depicted in Figure 9, showing the amplification of a ca. 950bp fragment including the K14-4-1 BB cDNA in comparison to a mock K14 cDNA.

Up-regulation of proliferation and cytokine secretion in CD8⁺ and CD4⁺ T cells CD8⁺ and CD4⁺ T cells were purified from K14-4-1 BB transgenic (tg) and wild type (wt) C57BL/6 mice. Prior to cell isolation, mice were injected with BrdU (100 μg per mouse, intraperitoneal^), which allows the quantification of cell proliferation in vivo. Immediately after the isolation of CD4⁺ and CD8⁺ T cells, the proliferation of both cell subsets was assessed by flow cytometry using an anti-BrdU antibody (upper part, one representative histogram overlay is shown). To quantify the cytokine expression, mRNA was extracted from purified CD8⁺ as well as CD4⁺ T cells and reverse transcribed into cDNA. Gene expression levels were determined by real-time PCR from n = 5 mice in each group (lower part); p < 0.05 versus wt. Real-time PCR was performed on an AbiPrism 7300 cycler using the SYBR Green master-mix and primers specific for the above mentioned genes.

Scatch behavior of wild type and K14-4-1 BB C57BL/6 transgenic mice

Scratching behavior of wild type and K14-4-1 BB transgenic mice at the age of 16 weeks was assessed by counting the scratched per minute from n = 10 mice each group over a time frame of 3 x 60 min. As a result, an increased frequency of scratching in K14-4-1 BB tg mice compared to wildtype controls could be observed when the animals were video monitored over time (Fig. 2C).

Equally, scratching behavior was assessed under treatment of K14-4-1 BB transgenic mice with neurokinin signaling pathway and opioid signaling pathway antagonists. Here animals treated with the neurokinin signaling pathway antagonist Ivemend did not show scratching behavior and did not develop a pruritus-like skin disease over a period of time between 13 and 31 weeks of age, while opioid or histamine signaling pathway antagonists, such as such as Naloxon and Tavegil, respectively, were less effective (Figure 19).

Immunohistology of lesional skin in 4-1 BB tg C57BL/6 mice

For immunofluorescence staining skin biopsies were embedded in NEG50, cryopreserved in liquid nitrogen and cut into 3 μηη sections. Subsequently, sections were incubated over night with the appropriate dilutions of the indicated primary antibodies against CD1 17 (specific for mast cells) and CD8 (T cells). To visualize cell infiltrates, AlexaFluor coupled secondary antibodies were used and nuclei were counterstained with DAPI.

Antibodies used for immunofluorescence staining of cryosections from K14-4-1 BB tg mice are: Anti-CD1 17 (clone 2B8, Biolegend, diluted 1 :100 in DCS-antibody dilution buffer, incubation over night at 4 °C) Anti-CD8-Biotin (clone 53-6.7, Biolegend, diluted 1 :100 in DCS-antibody dilution buffer, incubation over night at 4 °C)

Secondary antibodies (AlexaFluor 568 donkey anti-rat IgG or AlexaFluor 488 Streptavidin, diluted 1 :1000 in DCS-antibody dilution buffer, incubation for 3 h at room temperature)

ELISA

Histamine concentration in lesional skin from K14-4-1 BB tg mice and corresponding skin areas from wt controls were quantified by ELISA according to the manufacturer's instructions (Neogen). Briefly, fresh tissue was homogenized using an ultra turrax workstation and subjected to ELISA. Skin samples from n = 8 mice in each group were analyzed for their histamine content; ^*, p < 0.05 versus wt.

Skin histology and eye histology of wild type and tg C57BL/6 mice

For skin and eye histology of 4-1 BB tg C57BL/6 mice, skin biopsies and eye preparations were fixed in 4 % formaldehyde for 24 h, embedded in paraffin and cut into 3 μηη sections (skin) or 8 μηη sections (eye). Subsequently, hematoxylin and eosin (H&E) staining of tissue sections was performed using an autostainer according to standard methods.

Immunohistology of lesional skin in human pruritus patients

Cryosections (5 μηη) from the skin of human patients suffering from pruritus or prurigo nodularis, and control patients not exhibiting any hallmarks of human pruritus, were stained with fluorescence labeled antibody against 4-1 BB and 4-1 BBL. Slides were incubated at room temperature for 30 min, subsequently cryosections were fixed in 2 % PFA + 1 % 2,4,6-trinitro- phenoi for 10 min and washed 3 times with PBS + 0.05 % Tween20. After blocking non-specific binding with 10 % BSA diluted in PBS + 0.05 % Tween20 cryosections were incubated with biotin-labeled anti-human 4-1 BB or 4-1 BBL (clone 4B4-1 or 5F4, respectively; both antibodies were purchased from Biolegend, diluted 1 :100 in PBS + 0.05 % Tween20 and incubated over night at 4 C). The 4-1 BB or 4-1 BBL staining was visualized using AlxaFluor 568- or Brilliant- Violet 421 -coupled secondary antibodies (diluted 1 :1000 in PBS + 0.5 % Tween20 and incubated for 1 h at room temperature).

However, immunohistology of lesional skin revealed characteristic hallmarks of human pruritus such as epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis, and the infiltration of lymphocytes like T cells, mast cells, and eosinophils into the dermis (Fig. 2B).

In support of this, we observed increased frequencies of scratching in K14-4-1 BB tg mice compared to wildtype controls when the animals were video monitored over time (Fig. 2C). Tavegil treatment, treatment with anti-4-1 BB, treatment with neurokinin signaling pathway antagonists, histamine signaling pathway and opioid signaling pathway antagonists

K14-4-1 BB tg mice with full-blown disease were intravenously injected with 0.05 mg Tavegil^® per kg body weight in weekly intervals for 8 weeks. Alternatively, K14-4-1 BB tg mice with full-blown disease were intravenously injected with 7.5 mg anti-4-1 BB (clone TKS-1 , Biolegend) per kg body weight in weekly intervals for 6 weeks.

Additionally, K14-4-1 BB tg mice which did not yet exhibit hallmarks of human pruritus were treated with anti-4-1 BB over a time period of 6 weeks. All mice were monitored for the progression of disease twice weekly and were photographed in weekly intervals.

Moreover, K14-4-1 BB tg mice were treated with neurokinin signaling pathway and opioid or histamine signaling pathway antagonists, and mice were monitored for the clinical score over a period of time between 13 and 31 weeks of age. Animals treated with the neurokinin signaling pathway antagonist Ivemend had a positive clinical score, while animals treated with opioid signaling pathway antagonists such as Naloxon and the histamine pathway antagonist Tavegil had a negative clinical score.

_*****

[0171] It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.

Claims

1 . A non-human transgenic animal characterized by overexpression of 4-1 BB in basal keratinocytes, wherein the transgenic animal comprises, additionally to the copy in the endogenous gene locus, at least two further 4-1 BB copies and develops a pruritus-like skin disease and/or a pathological eye phenotype.

2. The non-human transgenic animal of claim 1 , comprising additionally to the copy in their endogenous gene locus at least two further transgenic 4-1 BB copies and not more than fourteen further 4-1 BB copies.

3. The non-human transgenic animal of claim 1 or 2, characterized in that said animal is heterozygous for the additional 4-1 BB copies.

4. The non-human transgenic animal of claim 1 to 3, wherein said additional 4-1 BB copies are transfected into the animals' genome as a K14-4-1 -BB DNA construct, the K14-4- 1 BB DNA construct comprising in the following order (5' to 3'):

a) a keratin 14 promoter,

b) an intron, preferably a β-globulin intron,

c) 4-1 BB cDNA,

d) a poly A sequence, preferably a K14 poly A sequence.

5. The non-human transgenic animal of claim 1 to 4, characterized by overexpression of 4- 1 BB in the skin of said animal as compared to a wild type animal.

6. The non-human transgenic animal of claim 1 to 5, characterized by overexpression of 4- 1 BB in basal keratinocytes of said animal as compared to a wild type animal.

7. The non-human transgenic animal of claim 1 to 6, wherein said animal is a rodent.

8. The non-human transgenic animal of claim 7, selected from the group consisting of mouse, rat, guinea pig, rabbit, and zebrafish.

9. The non-human transgenic animal of claim 8, wherein said animal is a mouse of the C57BL/6 species.

10. The non-human transgenic animal of claim 1 to 9, exhibiting inflammatory skin lesions at the ears, snout, and neck.

1 1 . The non-human transgenic animal of claim 1 -9, exhibiting an increased scratch behavior.

12. The non-human transgenic animal of claim 1 to 10, wherein said pruritus-like skin disease comprises itch, prurigo nodularis, atopic dermatitis, neurodermatitis, urticaria, allergy, psoriasis, uremic pruritus, diabetes mellitus, and leukemia.

13. The non-human transgenic animal of claim 1 to 1 1 , exhibiting characteristic hallmarks of human pruritus.

14. The non-human transgenic animal of claim 13, wherein a characteristic hallmarks of human pruritus is one of epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis, and infiltration of lymphocyte like T-cells, mast cells, and eosinophils into the dermis.

15. The non-human transgenic animal of claim 1 to 14, wherein the pathological eye phenotype is characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes.

16. The non-human transgenic animal of claim 15, wherein the pathological eye phenotype is not caused by an increased scratch behavior of the transgenic animal.

17. The non-human transgenic animal of claim 15 and 16 exhibiting an unimpaired cornea.

18. The non-human animal of claim 15 to 17, further characterized by a restricted mobility of the eyelid.

19. The non-human transgenic animal of any of the preceding claims exhibiting increased infiltration of activated mast cells into the lesional skin as compared to a wild type animal.

20. The non-human transgenic animal of claim 19 exhibiting increased IL-31 mRNA levels and histamine release in the lesional skin as compared to a wild type animal.

21 . The non-human transgenic animal of any of the preceding claims, exhibiting increased numbers of proliferating and activated CD8⁺ T-cells in the lesional skin and regional lymph nodes as compared to a wild type animal.

22. The non-human transgenic animal of any of the preceding claims, said animal being a model suitable for analyzing molecular and cellular mechanisms underlying the development of pruritus-like skin diseases.

23. The non-human transgenic animal of any of the preceding claims, said animal being a model suitable for analyzing molecular and cellular mechanisms underlying the development of eye diseases characterized by blindness, cataracts, heavy scarring and/or deformation of the lens.

24. The non-human transgenic animal of any of the preceding claims, said animal being a model suitable for analyzing molecular and cellular mechanisms underlying the development of uveitis.

25. The non-human transgenic animal of any of the preceding claims, said animal being a model suitable for investigating the efficacy of therapeutic compounds in treatment of pruritus-like skin diseases and/or eye diseases characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens.

26. A cell line derived from the transgenic animal of claim 1 or 2, which overexpresses 4- 1 BB.

27. A method of making the non-human transgenic animal of any one of claim 1 to 25, said method comprising introducing into said animal 4-1 BB cDNA.

28. The method according to claim 27, wherein the 4-1 BB cDNA is human 4-1 BB cDNA.

29. The method according to claim 27 or 28, said method comprising: a) microinjecting a K14-4-1 -BB DNA constructs into the pro-nucleus of said animals' fertilized ovum, said microinjected 14-4-1 BB DNA construct comprising in the following order (5' to 3'):

i) a keratin 14 promoter,

ii) a β-globulin intron,

iii) 4-1 BB cDNA,

iv) a K14 poly A sequence;

b) screening the animals' offspring for 4-1 BB transgenic animals by phenotype analysis.

30. The method according to claim 29, wherein said screened phenotype comprises a pruritus-like skin disease and/or a pathological eye phenotype.

31 . The method according to claim 30, wherein the pruritus-like skin disease comprises inflammatory skin lesions at the ears, snout, and neck of the transgenic animal, and an increased scratch behavior of the transgenic animal.

32. The method according to claim 31 , wherein the pruritus-like skin disease further comprises characteristic hallmarks of human pruritus, wherein characteristic hallmarks of human pruritus is one of epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis, and infiltration of lymphocyte like T-cells, mast cells, and eosinophils into the dermis.

33. The method according to claim 30, wherein the pathological eye phenotype is characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes.

34. The method according to claim 33, wherein the pathological eye phenotype is not caused by an increased scratch behavior of the transgenic animal.

35. The method according to claim 33 or 34, wherein both eyes of the transgenic animal exhibit an unimpaired cornea.

36. The method according to claim 33 to 35, wherein the transgenic animal is further characterized by a restricted mobility of the eyelid.

37. The method according to claim 28 to 36, wherein said transgenic animal is a mouse of the C57BL/6 species.

38. Use of 4-1 BB cDNA for making a transgenic non-human animal, wherein said animal is characterized by:

a) a pruritus-like skin disease comprising inflammatory skin lesions at the ears, snout and neck of said animal, and increased scratch behavior; and/or

b) an pathological eye phenotype comprising blindness, cataracts, heavy scarring, and/or deformation of the lens in both of the transgenic animals' eyes.

39. A method for the treatment of a human subject suffering from a pruritus-like skin disease, said method comprising administering a therapeutically effective amount of a 4-1 BB/4- 1 BBL antagonist to a human subject in need thereof.

40. The method according to claim 39, wherein the pruritus-like skin disease is one of itch, prurigo nodularis, atopic dermatitis, neurodermatitis, urticaria, allergy, psoriasis, uremic pruritus, diabetes mellitus, and leukemia.

41 . The method of claim 40, wherein the human subject exhibiting characteristic hallmarks of human pruritus, characterized by pruritus like epidermal hyperplasia, irregular acanthosis, fibrosis, collagenosis, and infiltration of lymphocyte like T-cells, mast cells, and eosinophils into the dermis.

42. The method according to claim 39 to 41 , wherein the administration is carried out orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, or by application to mucous membranes.

43. A 4-1 BB/4-1 BBL antagonist for use in the treatment of a human subject suffering from a pruritus-like skin disease.

44. A 4-1 BB/4-1 BBL antagonist used to prevent a human subject from developing of prurituslike skin diseases.

45. The 4-1 BB/4-1 BBL antagonist for use according to claim 43 or 44, wherein the 4-1 BB/4- 1 BBL antagonist is a specific inhibitor of the 4-1 BB/4-1 BBL interaction.

46. The 4-1 BB/4-1 BBL antagonist for use according to claim 45, wherein the 4-1 BB/4-1 BBL antagonist blocks the 4-1 BB/4-1 BBL signaling.

47. The 4-1 BB/4-1 BBL antagonist for use according to claim 43 to 46, wherein the 4-1 BB/4- 1 BBL antagonist is selected from the group consisting of a peptide, an organic small molecule, an antisense oligonucleotides, siRNA, an antisense expression vector, and a recombinant virus.

48. The 4-1 BB/4-1 BBL antagonist for use according to claim 43 to 46, wherein the 4-1 BB/4- 1 BBL antagonist is a fusion protein consisting of the extracellular portion of human 4-1 BB coupled to a stabilizing entity.

49. The 4-1 BB/4-1 BBL antagonist for use according to claim 48, wherein the stabilizing entity is the Fc region of human immunoglobulin G.

50. The 4-1 BB/4-1 BBL antagonist for use according to claim 48 wherein the extracellular portion of human 4-1 BB is coupled to the Fc region of human immunoglobulin G, selected from the group consisting of lgG1 , lgG2, lgG3, and lgG4.

51 . The 4-1 BB/4-1 BBL antagonist for use according to claim 49 to 50, wherein the Fc region of the human immunoglobulin G extends the half-life of said 4-1 BB/4-1 BBL antagonist.

52. The 4-1 BB/4-1 BBL antagonist for use according to claim 43 to 46, wherein the 4-1 BB/4- 1 BBL antagonist is an aglycosylated 4-1 BB antibody or lipocalin mutein, inhibiting the 4- 1 BB/4-1 BBL interaction.

53. The 4-1 BB/4-1 BBL antagonist for use according to claim 43 to 52, wherein the 4-1 BB/4- 1 BBL antagonist significantly decreases the expression level of IL-2, IL-4, IL-10, IL-17, IL- 31 , and/or IFNy by activated CD8⁺ effector T cells in the lesional skin.

54. Use of a 4-1 BB antagonist for the preparation of a medicament for treatment of a human subject suffering from a pruritus-like skin disease.

55. A method for screening a 4-1 BB/4-1 BBL antagonist useful for treating a pruritus-like skin disease, the method including assaying the 4-1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling.

56. A method for screening a 4-1 BB/4-1 BBL antagonist useful for preventing a human subject from developing a pruritus-like skin disease, the method including assaying the 4- 1 BB/4-1 BBL antagonist for activity in inhibiting the 4-1 BB/4-1 BBL signaling.

57. The method for screening a 4-1 BB/4-1 BBL antagonist according to claim 55 or 56, the method comprising:

a) contacting a 4-1 BB/4-1 BBL antagonist with a cell line overexpressing 4-1 BB, b) measuring for a change of the expression level of a biomarker, wherein said biomarker is one of IL-2, IL-4, IL-10, IL-17, IL-31 , and IFNy,

c) comparing the expression level of one or more of said biomarkers by the cell line of (a) to a reference expression level of said biomarker.

58. The method for screening a 4-1 BB/4-1 BBL antagonist according to claim 55 or 56, the method comprising: a) administering a 4-1 BB/4-1 BBL antagonist to the non-human transgenic animal of claim 1 or 2,

b) measuring for a change of the expression level of a biomarker, wherein said biomarker is one of IL-2, IL-4, IL-10, IL-17, IL-31 , and IFNy,

c) comparing the expression level of one or more of said biomarkers by said transgenic animals of (a) to a reference expression level of said biomarker.

59. The method according to claim 57 or 58, wherein if the expression level of said biomarker under administration of a 4-1 BB74-1 BBI antagonist is approximate or higher than the reference expression level of said biomarker, the 4-1 BB/4-1 BBL antagonist is not useful for treating a pruritus-like skin-disease.

60. The method according to claim 57 or 58, wherein if the expression level of said biomarker under administration of a 4-1 BB/4-1 BBL antagonist is significant lower than the reference expression level for said biomarker, the 4-1 BB/4-1 BBL antagonist is useful for treating a pruritus-like skin-disease.

61 . The method according to claim 57, wherein the expression level of said biomarker is measured in a sample obtained from said cell line.

62. The method according to claim 58, wherein the expression level of said biomarker is measured in a sample obtained from the non-human transgenic animal.

63. The method according to claim 62, wherein the sample is a tissue sample.

64. The method according to claim 56 to 63, wherein measuring the expression level of one or more biomarkers includes measuring the level of biomarker mRNA in the sample.

65. A method for evaluating whether a subject may be of a risk to develop a pruritus-like skin- disease and/or an eye disease characterized by blindness, cataracts, heavy scarring, and/or deformation of the lens, comprising determining whether the 4-1 BB expression level in a sample of said subject is increased in comparison to a reference value.

66. The method according to claim 65, wherein an increased 4-1 BB expression level indicates a higher risk to develop a pruritus-like skin-disease and/or said eye disease.

67. The method according to claim 65, wherein 4-1 BB expression at a normal level indicates a lower risk to develop a pruritus-like skin-disease or said eye disease.

68. A method for diagnosing, monitoring or evaluating the progression of a pruritus-like skin- disease in a patient, comprising:

a) determining the amount of 4-1 BB or 4-1 BBL present in a biological sample of a patient, and

b) comparing the amount of 4-1 BB or 4-1 BBL ligand determined in (a) to a control value obtained from a biological sample of said patient at a date earlier than the date upon which the biological sample of (a) was obtained, wherein the result of the comparison of (b) provides an evaluation of the progression of the pruritus-like skin-disease in the patient, wherein said pruritus-like skin disease is associated with 4-1 BB overexpression in basal keratinocytes and selected from the group consisting of itch, prurigo nodularis, atopic dermatitis, neurodermatitis, urticaria, allergy, psoriasis, uremic pruritus, diabetes mellitus, and leukemia.

69. Use of a neurokinin-signaling pathway antagonist for preventing a human subject from developing a 4-1 BB/4-1 BBL-mediated pruritus-like skin diseases.

70. A method for the treatment of a human subject suffering from a 4-1 BB/4-1 BBL-mediated pruritus-like skin disease, said method comprising administering a therapeutically effective amount of a neurokinin-signaling pathway antagonist to a human subject in need thereof.

71 . A neurokinin-signaling pathway antagonist for use in the treatment of a human subject suffering from a 4-1 BB/4-1 BBL-mediated pruritus-like skin diseases.

72. A neurokinin-signaling pathway antagonist used to prevent a human subject from developing of pruritus-like skin diseases.