WO2011090351A2 - Diagnostic method and diagnosing kit for prostatitis - Google Patents

Diagnostic method and diagnosing kit for prostatitis Download PDF

Info

Publication number
WO2011090351A2
WO2011090351A2 PCT/KR2011/000452 KR2011000452W WO2011090351A2 WO 2011090351 A2 WO2011090351 A2 WO 2011090351A2 KR 2011000452 W KR2011000452 W KR 2011000452W WO 2011090351 A2 WO2011090351 A2 WO 2011090351A2
Authority
WO
WIPO (PCT)
Prior art keywords
hbd
gene
prostatitis
expression
prostate
Prior art date
Application number
PCT/KR2011/000452
Other languages
French (fr)
Korean (ko)
Other versions
WO2011090351A3 (en
Inventor
명순철
김원용
이태진
김해종
정자랑
김혜진
Original Assignee
중앙대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 중앙대학교 산학협력단 filed Critical 중앙대학교 산학협력단
Publication of WO2011090351A2 publication Critical patent/WO2011090351A2/en
Publication of WO2011090351A3 publication Critical patent/WO2011090351A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/34—Genitourinary disorders
    • G01N2800/342—Prostate diseases, e.g. BPH, prostatitis

Definitions

  • the present invention relates to a method for diagnosing prostatitis and a diagnostic kit therefor. More specifically, a prostatitis diagnosis method comprising measuring the expression amount of HBD (Human ⁇ defensin) -2 gene from a subject's prostate sample, and the expression amount of HBD (human ⁇ defensin) -2 can be measured. It relates to a kit for diagnosing prostatitis comprising a primer, probe or antibody.
  • Antimicrobial peptides are an important component of the innate host-defense system against bacteria, bears, parasites and viruses. These peptides found in the human body include, for example, ⁇ -defensin, ⁇ -defensin and cathelicidin [l]. Unlike ⁇ -defensins, which are mainly produced by neutrophi Is, ⁇ -defensins are produced directly by epithelial cells and fight infection through direct bactericidal and cell-mediated immune regulation [2].
  • HBD-1 to HBD-4 have been identified and analyzed as four types of human ⁇ -defensin (HBD) [2L Among these four types, HBD-1 is a genitourinary system, respiratory system and It is reported that while it is constitutively produced by various epithelial tissues such as the skin [3], HBD-2, HBD-3 and HBD-4 are produced inducibly [1].
  • HBD-2 is a cysteine-rich cationic low molecular weight antimicrobial peptide found in psoriasis skin and is believed to be involved in skin defense and inflammatory effects [4].
  • HBD-2 is E. coli (£ sc / / er / c /?
  • HBD-2 is rarely expressed in normal epithelial cells, but is expressed when the epithelial cells are stimulated by microorganisms or cytokines such as TNF- ⁇ and IL- ⁇ [5, 6]. However, the expression of HBD-2 in the prostate has not been studied to date.
  • defensin In addition to its antimicrobial activity, defensin possesses additional functions related to host defense, such as inducing histamine release by mast cells and chemoattraction of various cells of the immune system, including neutrophils and T cells. In addition, it is presumed that they are also involved in cancer development [8-10].
  • the prostate epithelium has a strong innate immune system that protects male reproductive organs from various infections.
  • the epithelium with the stratified columnar structure of the prostate gland primarily forms a physical barrier against pathogenic microorganisms, which is further reinforced by the natural microflora and acidic environment, which provides the opposing activity against various bacteria involved in prostate infection.
  • Zinc and lactoferrin are known to function similar to defensins in the prostate. Zinc accumulates in the prostate, where the prostate typically contains the highest zinc concentration in the human body [12].
  • Prostate cancer is associated with the lack of zinc accumulation in prostate cells. It implies a very important role. Lactoferrin kills bacteria, plays an important role in immunomodulatory activity, and is also involved in the prostate inflammatory response [14].
  • NF- ⁇ Nuclear Factor- ⁇
  • the NF-KB family of transcription factors remain in an inactivated state that is inactivated in the cytoplasm of almost all vertebrate cells in complex with the inhibitory factor ⁇ protein [18].
  • Phosphorus ⁇ protein is phosphorylated and then degraded by 26S proteasome, thereby bringing NF- ⁇ into the nucleus To activate NF- ⁇ dependent transcriptional activity [19].
  • the present inventors studied the pattern of the anti-microbial peptide human ⁇ -defensin (HBD) -2, which is an antimicrobial peptide, against human infection in prostate epithelial cells.
  • HBD-2 is constantly expressed in prostatic epithelial cells, and its expression level is greatly increased by infection of microorganisms, and the increase of such expression is achieved through activation of the transcription factor NF- ⁇ .
  • the present invention was completed by confirming that the measurement of the expression level of HBD-2 in the prostate can be useful for the diagnosis of prostatitis. Accordingly, it is an object of the present invention to provide a kit for diagnosing prostatitis comprising a primer, a probe or an antibody capable of measuring the expression of HBD (Human ⁇ defensin) -2 gene.
  • the present invention is to provide a method for diagnosing prostatitis in a subject. Another object of the present invention is to provide a method for measuring the expression amount of HBD-2 in a prostate sample of a subject for the diagnosis of prostatitis.
  • the present invention provides a method for diagnosing prostatitis comprising the step of measuring the expression level of HBD (Human ⁇ defensin) -2 gene from a subject's prostate sample.
  • HBD Human ⁇ defensin
  • the present invention relates to a primer or probe specifically binding to (H) human ⁇ defensin (HBD) gene sequence, or (b) HBD-2 protein
  • HBD human ⁇ defensin
  • kit for diagnosing prostatitis in humans comprising an antibody (ant ibody) that specifically binds.
  • the present invention is based on an increase in the expression level of the HBD-2 gene in prostate tissue and its correlation with prostatitis.
  • the gene of HB 2 in prostate tissue shows an expression pattern that increases expression above its constitutive expression level.
  • An increase in HBD-2 gene expression due to prostatitis herein means expression at a higher level compared to the level of homeostatic expression.
  • the term "subject” refers to a subject who is supposed to suffer from prostatitis and is trying to diagnose prostatitis, preferably human.
  • prostatitis refers to an inflammatory disease occurring in the prostate.
  • causes that can cause prostatitis include microbial infection, and more specifically, bacteria (Escherichia coli), Krebsiella 7ebs / e // a), enterobacteriaceae ( ⁇ erobac er / a) Infection with Gram-negative bacteria, such as, but not limited to, Proteas (/ O es) and Serratia species.
  • the measurement of the expression amount of the HBD-2 gene in the method of the present invention is the measurement of the mRNA amount or protein amount of the HBD-2 gene.
  • the measurement of the expression amount of the HBD-2 gene in the method of the present invention comprises the step of RT-PCR (reverse transcript ion-polymerase chain react ion) mRNA of the HBD-2 gene do.
  • Determination of the amount of HBD-2 gene expression involves immunoassaying proteins of the HBD-2 gene.
  • the HBD-2 gene in the method of the present invention is increased in the expression level in the prostatitis sample compared to the expression level in the normal prostate sample.
  • the expression level of the HBD-2 gene in the prostate sample is increased above its constant expression level, it is diagnosed as prostatitis.
  • the prostate sample in the method of the present invention is epithelial tissue or epithelial cells of the prostate.
  • the primer or probe in the kit of the present invention has the nucleotide sequence disclosed in SEQ ID NO: 1 sequence or SEQ ID NO: 2 sequence.
  • the detection of prostateitis by measuring the expression level of the HBD-2 gene can be largely performed by two methods, namely, genetic analysis and immunoassay. Can be.
  • primers or probes that specifically bind to the HBD-2 gene sequence are used.
  • gene amplification reaction is performed to check the expression level of the HBD-2 gene. Since the present invention analyzes the expression level of the HBD-2 gene, the expression level of the HBD-2 gene is determined by examining the amount of HBD-2 mRNA expression in a sample (eg, a cell or tissue) to be analyzed.
  • a sample eg, a cell or tissue
  • the present invention performs gene amplification reaction using primers that bind to mRNA or cDNA as a template of mRNA in a sample.
  • total RNA is isolated from the sample. Isolation of total RNA can be carried out according to conventional methods known in the art. See Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere , C. et al., Plant Mol. Biol. Rep., 9: 242 (1991); Ausube 1, FM et al., Current Protocols in Molecular Biology, John Wi 1 ley & Sons (1987); and Chomczynski, P. et al.
  • Triz can be used to easily isolate total RNA in cells. Subsequently, cDNA is synthesized from the isolated mRNA, and the cDNA is amplified. Since the total RNA of the present invention is isolated from human samples, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence characteristic ( PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual, 3rd ed.
  • the synthesized cDNA is amplified by a gene amplification reaction.
  • the primers used in the present invention are hybridized or annealed to one site of the template to form a double chain structure. Conditions for nucleic acid localization suitable for forming such double-chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).
  • DNA polymerases can be used for amplification of the present invention and include "Clenau" fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase.
  • the polymerase is a thermostable DNA polymerase obtained from a variety of bacterial species, which include Thermus aquaticus (Taq), Thermus thermophi lus (Tth), Thermus fi 1 iformis, Therm is flavus, Thermococcus literalis, and Pyrococcus fur iosus (Pfu).
  • the reaction vessel When carrying out the polymerization reaction, it is preferable to provide an excess amount of components necessary for the reaction to the reaction vessel. Excess of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. Joiners such as Mg 2+ , dATP, dCTP, dGTP and dTTP are required to provide to the reaction mixture such that the desired degree of amplification can be achieved.
  • the amplification process of the present invention is a single process without changing conditions such as addition of reactants. It may be carried out in a counterungmul.
  • annealing or localization is carried out under stringent conditions that allow for specific binding between the target nucleotide sequence and the primer.
  • Stringent conditions for annealing are sequence-dependent and vary with ambient environmental variables.
  • amplification reaction means a reaction that amplifies a nucleic acid molecule.
  • Various amplification reactions have been reported in the art, which are called polymerase chain reaction (hereinafter referred to as PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (hereinafter referred to as RT-PCR).
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • CP-PCR primed polymerase chain reaction
  • AP-PCR arbitrarily primed polymerase chain reaction
  • AP-PCR nucleic acid sequence based amplification
  • NASBA nucleic acid sequence based amplification
  • LAMP loop-mediated isothermal amplification
  • Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4, 988,617 and US Pat. No. 09 / 854,317.
  • the amplification process is carried out according to the polymerase chain react ion (PCR) disclosed in US Pat. Nos. 4,683,195, 4, 683, 202 and 4,800,159.
  • PCR is the best known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR.
  • DD-PCR differential display PCR
  • RACE rapid amplification of cDNA ends
  • IPCR inverse polymerase chain reaction
  • vectorette PCR vectorette PCR
  • TA I L-PCR thermal asymmetric interlaced PCR
  • the primer used in the amplification reaction in the present invention is an oligonucleotide having a sequence complementary to the cDNA sequence of HBD-2.
  • the term “primer” refers to a template—a single capable of acting as an initiation point for directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerization reaction enzymes) in a suitable complete solution at a suitable temperature. Refers to stranded nucleotides. Suitable lengths of primers are typically 15-30 nucleotides, although varying depending on various factors, such as temperature and the use of the primer. Short primer molecules generally require lower temperatures to form hybrid complexes that are highly stable with the template.
  • the sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and is sufficient if it has sufficient complementarity within a range that can be hybridized with the template to perform a primer-specific function. Therefore, the primer set of the present invention does not need to have a sequence that is perfectly complementary to the HBD-2 cDNA sequence, which is a template, and it is sufficient that the primer set has sufficient complementarity within a range capable of acting as a primer by the sequence. .
  • the primer used in the present invention has a sequence that is perfectly complementary to the HBD-2 cDNA sequence.
  • the primer of the present invention is a sequence complementary to the mRNA (ie cDNA) sequence of HBD-2 Can be prepared.
  • the design of such primers can be readily performed by those skilled in the art with reference to the cDNA sequence of HBD-2, for example, using a primer design program (eg, PRIMER 3 program). Specific examples of the primers of the present invention are described in SEQ ID NO: 1 sequence and 2nd sequence.
  • the amplified HBD-2 cDNA is analyzed by a suitable method to investigate the expression level of the HBD-2 gene. For example, the degree of expression of the HBD-2 gene is examined by performing gel electrophoresis on the amplified reaction product described above and observing and analyzing the resulting band. Through this amplification reaction, prostateitis is diagnosed when the expression of the HBD-2 gene occurs at a high level compared to the level of constant expression in prostate tissue or cells.
  • prostateitis can be diagnosed by a hybridization-based analysis using a probe that is common to the HBD-2 gene or the cDNA of HBD-2.
  • probe is a single-chain nucleic acid molecule and includes a sequence that is complementary to a target nucleic acid sequence.
  • the probe of the present invention can be modified within a range that does not impair the advantages of the probe of the present invention, that is, the improvement of the localization specificity.
  • These modifications, ie labels can provide a signal to detect whether they are localized, which can be linked to oligonucleotides.
  • Suitable labels include fluorophores (e.g.
  • fluorescein fluorescein, phycoerythr in, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia), chromophores, chemilumines, magnetic particles, radioactivity Isotopes (P 32 and S 35 ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg gold) and antibodies, streptavi Hapten with specific binding partners, such as, but not limited to, dine, biotin, digoxigenin and chelating groups.
  • specific binding partners such as, but not limited to, dine, biotin, digoxigenin and chelating groups.
  • Labeling is carried out in a variety of methods conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels can be detected by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, polarization high frequency, nanocrystals Provide a signal.
  • the probe of the present invention which is popularized in the cDNA of HBD-2, is immobilized on an insoluble carrier (e.g., nitrocelose or nylon filter, glass plate, silicone and fluorocarbon support), Microarrays can be prepared.
  • an insoluble carrier e.g., nitrocelose or nylon filter, glass plate, silicone and fluorocarbon support
  • Microarrays can be prepared.
  • the probes of the present invention are used as hybridizable array elements.
  • Immobilization to an insoluble carrier is carried out by chemical bonding methods or by covalent binding methods such as UV.
  • the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface.
  • the hybridization array element may be linked to the carrier via a linker (eg, ethylene glycol oligomer and diamine).
  • a linker eg, ethylene glycol oligomer and diamine.
  • the cDNA of HBD-2 can be obtained by the above process.
  • the cDNA of HBD-2 can be labeled to perform a shake reaction-based assay.
  • probes are hybridized with cDNA molecules.
  • suitable isomerization conditions can be determined in a series of procedures by an optimization procedure. This procedure is carried out by a person skilled in the art in order to establish a protocol for use in the laboratory.
  • the temperature, concentration of components, shake and wash times, complete fluid components, and their pH and conditions of ionic strength depend on various factors, such as the length of the probe and the amount of GC and the target nucleotide sequence.
  • Detailed conditions for the shake are described in Joseph Sambrook, et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And M ⁇ M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. NY (1999).
  • the localization signal can be carried out by various methods, for example, depending on the type of label bound to the probe.
  • the substrate of the enzyme can be counteracted with the result of the shake reaction to determine whether it is shaken.
  • Combinations of enzymes / substrates that can be used include peroxidase (e.g. horseradish peroxidase) and chloronaph, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacrydi Nitrate), resorufin benzyl Ether, luminol, amplexed reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (-pheny 1 ened i am i ne-HC 1 and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di [3-ethylbenzthiazol ine sulfonate]), o-phenylenediamine (OPD) and naprol
  • the probe When the probe is labeled with gold particles, it can be detected by silver dyeing using silver nitrate.
  • the prostatitis can be diagnosed by analyzing the intensity of the above-mentioned generalization signal by the above-mentioned generalization process. That is, if the signal for HBD-2 cDNA in the sample is stronger than that of the constant expression level, it is diagnosed as prostatitis.
  • the expression level of HBD-2 protein in the present invention can be used to diagnose prostatitis by measuring according to an immunoassay method.
  • immunoassays can be performed according to a variety of previously developed immunoassays (i ⁇ unoassay) or immunostaining protocols.
  • the immunoassay or immunostaining format may include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, ELISA (enzyme—linked immunosorbent assay), capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, immunofluorescence Staining and immunoaffinity tablets include, but are not limited to.
  • the immunoassay or method of immunostaining is described in Enzyme I 'unoassay, E. T. Maggio, ed. , CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme ⁇ linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed. , Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.
  • antibodies labeled with radioisotopes may be used to detect HBD-2 protein.
  • the method of the present invention is an ELISA method
  • certain embodiments of the present invention comprise the steps of: (i) coating the prostate sample lysate to be analyzed on the surface of a solid substrate; ( ⁇ ) reacting the sample digest with an antibody against HBD-2 protein as a primary antibody; (iii) reacting the resultant of step (ii) with the secondary antibody to which the enzyme is bound; And (iv) measuring the activity of the enzyme.
  • Suitable for the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates.
  • Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence reaction, luminescence or infrared reaction, for example, alkaline phosphatase, ⁇ -galactosidase, hose Radishperoxidase, luciferase and cytokine ⁇ 450.
  • alkaline phosphatase When alkaline phosphatase is used as the enzyme that binds to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium ( ⁇ ), and naph -ASB1-phosphate (naphtho AS-Bl) are used as substrates.
  • BCIP bromochloroindolyl phosphate
  • ⁇ nitro blue tetrazolium
  • naph -ASB1-phosphate naph -ASB1-phosphate
  • chromogenic reaction substrates such as -phosphate
  • ECF enhanced chemi fluorescence
  • horse radish peroxidase is used, chloronaph, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis -N-methylacridinium nitrate), resoruppin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-pheny 1 ened i am i ne- HC 1 and pyrocatechol), TMB (tetramethyl benzidine), ABTS (2,2 ' ⁇ Azine ⁇ di [3—ethylbenzthiazol ine sulfonate]), o-phenylenediamine (OPD) and nap / pyronine, glucose oxidase and t -Nitroblue tetra
  • certain embodiments of the invention comprise the steps of: (i) coating an antibody against HBD-2 protein as a capturing antibody to the surface of a solid substrate; (ii) reacting the capture antibody with the prostate sample digest; (Hi) reacting the result of step (ii) with a detecting antibody that has a label that generates a signal and specifically reacts with HBD-2 protein; And (iv) measuring the signal resulting from the label.
  • the detection antibody carries a label which generates a detectable signal.
  • the label may include chemicals (e.g., biotin), enzymes (alkaline phosphatase, ⁇ -galactosidase, horse radish peroxidase and cytokine ⁇ 450), radioactive substances (e.g., C 14 , I 125 , ⁇ 32 and S 35 ), fluorescent materials such as fluorescein, luminescent materials, chemi luminescent and ' fluorescence resonance energy transfer (FRET). Methods are described in Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.
  • Measurement of the final enzyme activity or signal in the ELISA method and capture-ELISA method can be carried out according to various methods known in the art. Detection of this signal allows for qualitative or quantitative analysis of HBD-2 protein. If biotin is used as a label, the signal can be easily detected with streptavidin and luciferase if luciferase is used.
  • the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as a supernatant, a DNA polymerase (eg, Thermus aquat i cus (Taq)). , Thermus thermophi lus (Tth), Thermus fi 1 i formis, Therm is f 1 avus, Thermococcus literal is or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu), DNA polymerase joiners and dNTPs .
  • a DNA polymerase eg, Thermus aquat i cus (Taq)
  • Tth Thermus thermophi lus
  • Thermus fi 1 i formis Therm is f 1 avus
  • Thermococcus literal is or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu), DNA polymerase joiners and dNTPs .
  • the kit of the present invention may optionally include a secondary antibody and a substrate of a label.
  • Kits of the invention can be prepared in a number of separate packaging or compartments containing the reagent components described above.
  • the present invention relates to a method for diagnosing prostatitis and a kit for use in the method. More specifically, from the subject's prostate sample, HBD (Human ⁇ A method for diagnosing prostatitis comprising measuring the expression level of defensin) -2 gene and a kit for diagnosing prostatitis comprising a primer, a probe or an antibody capable of measuring the expression level of human ⁇ defensin (HBD) -2 will be.
  • HBD Human ⁇
  • the present invention is based on the finding that increased expression levels of HBD-2 in prostate tissue or cells correlate with the development of prostatitis. According to the method and kit of the present invention, it is possible to accurately and quickly diagnose prostatitis through a simple molecular biological analysis.
  • Lane 1 shows the results of RT-PCR detection of human ⁇ -defensin-2 (HBD-2) in prostate tissue and cell lines.
  • Lane 1 RWPE-1 cells
  • Lane 2 DU-145 cells
  • Lane 3 PC-3 cells
  • Lanes 4-6 sample of prostatic hyperplasia (BPH)
  • GAPDH internal control.
  • 2A and 2B show the results of immunochemical staining of HBD-2 in tissue samples obtained from patients with prostatic hyperplasia.
  • FIG. 2A shows that the prostate portion surrounded by inflammatory cells or the prostate portion surrounded by intraluminal inflammatory cells (open curve arrow) shows HBD- as compared to the portion without open inflammatory cells (open line arrow). 2 shows that the expression is detected more strongly.
  • inflammatory cells including macrophage, show increased expression of HBD-2 (blocked straight arrow) (X400).
  • HBD-2 mRNA expression was analyzed by RT-PCR after treatment with LPS (10 mg /) in RWPE-1 cells.
  • 3B shows that LPS induces production of HBD-2 protein in prostate epithelial cells.
  • the concentration of HBD-2 was measured by ELISA in the culture supernatant of RWPE-1 cells treated with LPS (10 mg /). Concentration per mL of supernatant Protein picograms are shown, representative of three independent experiments.
  • 4A-4D show that NF- ⁇ activation is required for LPS-induced HBD-2 expression in RWPE-1 cells.
  • 4a shows the results of immunoblotting of ⁇ phosphorylation following LPS stimulation (10 mg / ra) in RWPE-1 cells.
  • 4B shows the results for the kinetics of ⁇ degradation in LPS-activated RWPE-1 cells.
  • 4C shows EMSA results of NF- ⁇ in RWPE-1 cells stimulated with LPS for 1 hour (lane 3). Lane 1 is free of nuclear extracts, lane 2 is control cells and lane 4 is competition tested with unlabeled oligonucleotides.
  • 4D shows the results of measuring the effect of NF- ⁇ inhibition using Bayll-7082 on LPS induction of HBD-2 in RWPE-1 cells.
  • Bay Bayll-7082. *: P ⁇ 0.05, compared with control; #: p ⁇ 0.05, compared with LPS-treated group.
  • LPS Lipopolysaccharide
  • HBD-2 Human beta defensin-2
  • EL ISA kit is available from KOMA Biotech Inc. It was purchased from (Seoul, Korea).
  • Anti- ⁇ and Anti-Phosphorus I ⁇ ⁇ ⁇ are available from Cell Signaling Technology Inc. USA).
  • Prostate tissue samples were obtained from three patients clinically benign prostatic hyperplasia (BPH). All patients agreed to use their prostate tissue for research and the study was approved by the Chung-Ang University Medical Review Board. Patients were transurethral to the prostate at Chung-Ang University Hospital in May 2009. resection). After surgery, each prostate sample was separated into two, one immediately frozen in liquid nitrogen and the other fixed with 10% formalin and paraffin-sealed until use.
  • BPH clinically benign prostatic hyperplasia
  • RWPE-1 Immortalized human prostate epithelial cell line
  • PC-3 and DU-145 were purchased from American Type Culture Collect ion (Manassas, VA, USA).
  • RWPE-1 cells contain 5% C0 2 in Kerat inocyte-SFM (Invitrogen Corporation, Carlsbad, CA, USA) supplemented with 0.05 mg / mi bovine pituitary extract (BPE) and 5 ng / mC epidermal growth factor (EGF). Incubated in a humid atmosphere.
  • PC-3 and DU-145 cells contain RPMI 1640 (WelGENE, Seoul, South Korea), 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen Corporation) and 1%> penicillin-streptomycin (WelGENE) ol. Cultured in growth medium. Cells were passaged by conventional methods at 80-90% confluency.
  • HBD-2 in BPH tissues was studied using the Ultravision LP Detection System (LabVision Corporation, Fremont, CA, USA). Briefly, slides with BPH tissues are waxed in xylene for at least 20 minutes, and 100%, 95%, 90% and 80% ethane is continuously in solution. Rehydrate. After washing for 5 minutes in water, the slides were pretreated in 0.01 M sodium citrate complete solution and autoclave at 120 ° C. for 1 minute to recover antigen. After washing the slides, the peroxidase activity of the intrinsic was blocked by treatment for 30 minutes at 3% 3 ⁇ 40 2.
  • Mouse primary polyclonal antibody (1:50, Abeam, MA, USA) against human ⁇ -defensin-2 (HBD-2) was applied to the slide sections and incubated for 2 hours in a humidified chamber at room temperature. . Negative controls were prepared by replacing the primary antibody with non-immune serum.
  • the slides were washed with PBS, incubated with secondary antibodies at room temperature, and washed again with PBS. Slides were incubated for 10 minutes with horseradish peroxidase conjugated tertiary antibody and for 10 minutes with diaminobenzidine. Slides were counterstained with Mayer's hematoxyl in, then dehydrated and placed on cover slips.
  • RNA Isolation and RT—PCR Reverse Transcriptase-Polymerase Chain Reaction
  • the concentration of human ⁇ -defensin-2 present in the supernatant of LWPE-1 cells stimulated by LPS was determined using the HBDOiuman ⁇ -defensin) -2 EL ISA kit (KOMA Biotech Inc, Korea) according to the manufacturer's instructions. Measured. The minimum detectable concentration was identified at a concentration of about 8 pg / HBD-2 recombinant peptide. A standard curve was prepared using serially diluted recombinant peptides included in the kit. The optical density of the wells was measured at 450 nm using a microplate reader (TECAN Systems Inc, San Jose, Calif., USA).
  • Total protein extracts from RWPE-1 cells consisted of 1.5% sodium dodecyl sulfate (SDS), 62.5 mM Tris-HCl (pH 6.8), 5 mM ethylenediaminetetraacetic acid (EDTA), 1% 2-ME (2). -mercaptoethanol), 1 ⁇ g / l antipain di hydrochloride, 1 ⁇ g / mi chymostatin, and 1 ⁇ g / leupeptin (all from Sigma-Aldr ich, Seoul, Korea). Cell lysates were centrifuged to separate the supernatants and then stored at -80 ° C.
  • Proteins constituting epithelial cell lysates were separated by SDS / PAGE on 10% separation gels and transferred to nitrocelose membranes (Bi Rad Laboratories). Gels and nitrocell membranes were stained using Coomassie Brilliant Blue (Sigma) and Ponceau S (Sigma), respectively, to ensure that the proteins loaded in the wells were equal. The membrane was incubated and blocked for 2 hours at room temperature in TBS (Tris-buf fered saline, 150 mM NaCl, 25 mM Tris, pH 7.4) containing 0.05% Tween 20 (Sigma) and 3% skim powder (Sigma).
  • TBS Tris-buf fered saline, 150 mM NaCl, 25 mM Tris, pH 7.4
  • Binding reactions were performed with binding complete fluid (10 mM TrisHCl [H 7.5], 50 mM KC1, 50 mM NaCl, 1 mM MgCl 2 , 1 mM EDTA, with a total volume of 20 ⁇ total with nuclear protein of 5 and labeled probes). , 5 mM DTT, and 5% glycerol) at 25 ° C for 15 minutes. Unlabeled wild-type probes were added to the binding reaction in an amount of 200-fold excess mole for competitive analysis. DNA-protein complexes
  • HBD-2 raRNA was examined in all tested samples except cell line PC_3. That is, it was examined in a sample of normal prostate epithelial cell line RWPE-1, prostate cancer cell line DU-145 and three prostatic hyperplasia (BPH) patients (Fig. 1). According to the results shown in FIG. 1, it was found that HBD-2 is constantly expressed in prostate epithelial cells, ie, normal prostate epithelial cell line RWPE-1, prostate cancer cell line DU-145, and prostatic hyperplasia tissue. . In addition, as a result of immunohistochemical analysis of prostate tissue, HBD-2 protein was also detected in prostate tissue samples taken from BPH patients (FIGS.
  • HBD-2 HBD-2-expressing macrophages barely penetrated the non-inflammatory matrix BPH tissue (FIG. 2B).
  • LPS and RWPE-1 cells were used as a model system to analyze the effects of bacterial infection on prostate epithelial cells, which is one of the best studied LPS recognition systems, and is also known as Gram-negative bacteria, eg ⁇ Because Escherichia coli, Krebsiella 057ebs / e // a), Enterobacteria, Proteus, and Serratia are the most frequent pathogens affecting this organ [20].
  • HBD-2 mRNA levels were significantly increased in RWPE-1 cells treated with 1 ipopolysacchar ide (LPS) for 3-24 hours (FIG. 3A).
  • LPS 1 ipopolysacchar ide
  • HBD-2 mRNA resultsed in protein translation.
  • ELISA was performed on the HBD-2 protein to determine if it was related to an increase in translation. Consistent with the results of HBD-2 mRNA expression shown in FIG. 3A, the concentration of HBD-2 protein was greatly increased in a time dependent manner in medium in which LW-stimulated RWPE-1 cells were cultured (FIG. 3B).
  • Bayll-7082 inhibits the activation of NF-KB by inhibiting ⁇ phosphorylation [21L Bayll-7082 inhibited the production of HBD-2 induced by LPS, which is HBD-2 in which NF- ⁇ is induced by LPS It is implied that it is related to the generation of (Fig. 4D).

Abstract

The present invention relates to a diagnostic method for prostatitis and to a kit used with the method. More specifically, the invention relates to a diagnostic method for prostatitis comprising the step of measuring the amount of HBD (Human β defensin)-2 gene expression from a prostate sample from a subject, and relates to a kit for diagnosing prostatitis comprising a primer, probe or antibody able to measure the amount of HBD (Human β defensin)-2 expression. The present invention is based on a new finding that an increase in the level of HBD-2 expression from prostate tissue or cells correlates with the occurrence of prostatitis. The method and kit of the present invention allow prostatitis to be accurately and rapidly diagnosed by means of a straightforward molecular biological analysis.

Description

【명세서】  【Specification】
【발명의 명칭】 [Name of invention]
전립선염의.진단 방법 및 진단용 키트  Diagnosis method and kit for diagnosis of prostatitis
【기술분야】 Technical Field
본 발명은 전립선염의 진단 방법 및 이를 위한 진단 키트에 관한 것이다. 보다 구체적으로 대상자 (subject)의 전립선 시료로부터 HBD (Human β defensin)-2 유전자의 발현양을 측정하는 단계를 포함하는 전립선염 진단 방법 및 HBD (human β defensin)-2의 발현양을 측정할 수 있는 프라이머， 프로브 또는 항체를 포함하는 전립선염 진단용 키트에 관한 것이다.  The present invention relates to a method for diagnosing prostatitis and a diagnostic kit therefor. More specifically, a prostatitis diagnosis method comprising measuring the expression amount of HBD (Human β defensin) -2 gene from a subject's prostate sample, and the expression amount of HBD (human β defensin) -2 can be measured. It relates to a kit for diagnosing prostatitis comprising a primer, probe or antibody.
【배경기술】 Background Art
항균성 펩타이드는 (antimicrobial peptide)는 세균， 곰광이， 기생충 및 바이러스에 대한 선천적 숙주 -방어 시스템의 중요한 구성요소이다. 인체에서 발견된 이들 펩타이드들은 예를 들어， α-디펜신 (defensin), β-디펜신 및 카텔리시딘 (cathelicidin)[l]을 포함한다. 호중구 (neutrophi Is)에 의해 주로 생성되는 α-디펜신과는 달리 β-디펜신은 상피세포에 의해 직접 생성되어 직접적인 살균작용 및 세포-매개성 면역 조절을 통해 감염에 대항한다 [2]· 현재까지， 4가지 종류의 인간 β-디펜신 (Human β-defensin; HBD)로서 HBD-1 내지 HBD-4이 확인되어 그 특성이 분석되었다 [2L 이들 4가지 종류 중에서, HBD-1은 비뇨생식기, 호흡기 및 피부와 같은 다양한 상피 조직에 의해 항상적으로 (constitutively) 생성되는 반면 [3]， HBD-2, HBD-3 및 HBD—4는 유도적으로 (inducible) 생성된다고 보고되어 있다 [1]. HBD-2는 건선 부위 피부에서 발견되는 시스테인 (cystein)이 풍부한 양이온성 저분자량 항균 펩타이드로써， 피부방어 및 염증 작용에 관련되어 있을 것으로 추정되고 있다 [4]· HBD— 2는 대장균 (£sc//er/c/?/a coli) , -o^ 5" ( Pseudomonas aeruginosa)^ 같은 그람음성균과 이스트 (yeast)인 캔디다 알비칸스 albicans 대한 항균활성이 황색포도상구균 (5 a/¾¾K/ocod:ci/s aureus)^ 같은 그람 양성균에 대한 항균활성 보다 더욱 강하다고 알려져 있다 [4]. HBD-2는 정상 상피세포에서는 거의 발현되지 않지만， 상피세포가 미생물이나 TNF-α 및 IL-β와 같은 사이토카인에 의해 자극되면 발현이 된다 [5， 6]. 그러나， 현재까지 전립선에서 HBD-2의 발현에 대해서는 연구된 바 없다. 디펜신 (defensin)은 항균효능 이외에도 비만세포에 의한 히스타민 방출 유도와, 호중구 (neutrophils) 및 T 세포를 포함하는 면역시스템의 다양한 세포들의 화학주성 (chemoattraction) 유도와 같은 숙주 방어와 관련된 추가적 기능을 보유하고 있다 [7]· 또한， 이들은 암 발생에도 관련되어 있는 것으로 추정되고 있다 [8-10]. Antimicrobial peptides are an important component of the innate host-defense system against bacteria, bears, parasites and viruses. These peptides found in the human body include, for example, α-defensin, β-defensin and cathelicidin [l]. Unlike α-defensins, which are mainly produced by neutrophi Is, β-defensins are produced directly by epithelial cells and fight infection through direct bactericidal and cell-mediated immune regulation [2]. HBD-1 to HBD-4 have been identified and analyzed as four types of human β-defensin (HBD) [2L Among these four types, HBD-1 is a genitourinary system, respiratory system and It is reported that while it is constitutively produced by various epithelial tissues such as the skin [3], HBD-2, HBD-3 and HBD-4 are produced inducibly [1]. HBD-2 is a cysteine-rich cationic low molecular weight antimicrobial peptide found in psoriasis skin and is believed to be involved in skin defense and inflammatory effects [4]. HBD-2 is E. coli (£ sc / / er / c /? / a coli), -o ^ 5 " (Pseudomonas aeruginosa) ^ and antimicrobial activity against yeast Candida albicans albicans, yeast (5 a / ¾¾K / ocod: ci / s aureus) ^ for gram-positive bacteria It is known to be stronger than antimicrobial activity [4]. HBD-2 is rarely expressed in normal epithelial cells, but is expressed when the epithelial cells are stimulated by microorganisms or cytokines such as TNF-α and IL-β [5, 6]. However, the expression of HBD-2 in the prostate has not been studied to date. In addition to its antimicrobial activity, defensin possesses additional functions related to host defense, such as inducing histamine release by mast cells and chemoattraction of various cells of the immune system, including neutrophils and T cells. In addition, it is presumed that they are also involved in cancer development [8-10].
전립선 상피는 남성의 생식기관을 각종의 감염으로부터 보호하는 강력한 선천성 면역시스템올 갖고 있다. 전립선의 성층화된 기둥 구조를 갖는 상피는 1차적으로 병원성 미생물에 대한 물리적 장벽을 형성하고， 이는 자연 미생물총 및 산성환경에 의해 더욱 보강되는데， 이는 전립선 감염에 관련된 다양한 세균에 대한 대항적 활성을 제공한다 [11]· 아연 (Zinc) 및 락토페린 (lactoferrin)은 전립선에서 디펜신과 유사한 기능을 하는 것으로 알려져 있다. 아연은 전립선에서 다량 축적되는데， 전립선이 전형적으로 인체에서 가장 높은 아연 농도를 포함하고 있다 [12]· 전립선암은 전립선 세포들의 아연 축적능력의 부재와 관련이 있으몌 13], 이는 아연이 전립선에서 매우 중요한 역할을 한다는 것을 암시한다. 락토페린은 세균을 살상하고， 면역조절작용에서 중요한 역할을 하며 , 전립선 염증 반응에도 관여한다고 보고되어 있다 [14].  The prostate epithelium has a strong innate immune system that protects male reproductive organs from various infections. The epithelium with the stratified columnar structure of the prostate gland primarily forms a physical barrier against pathogenic microorganisms, which is further reinforced by the natural microflora and acidic environment, which provides the opposing activity against various bacteria involved in prostate infection. [11] Zinc and lactoferrin are known to function similar to defensins in the prostate. Zinc accumulates in the prostate, where the prostate typically contains the highest zinc concentration in the human body [12]. Prostate cancer is associated with the lack of zinc accumulation in prostate cells. It implies a very important role. Lactoferrin kills bacteria, plays an important role in immunomodulatory activity, and is also involved in the prostate inflammatory response [14].
보호성 반웅을 매개하는 디펜신 패밀리에 속하는 항균성 펩타이드가 어떠한 역할을 하는 지에 대해서는 다른 조직에서 연구되어 이미 확립되어 있다 [15 - 17]. 그러나， 전립선 상피세포에서 β-디펜신의 발현이 세균 감염에 반웅하여 유도되는 지에 대해서는 아직 조사되지 않았다. NF-κΒ (Nuclear Factor- κΒ)는 항균성 펩타이드의 활성을 유도하여 선천성 면역 및 후천성 면역 모두에서 중요한 역할을 하는 세포내 신호전달인자이다. 전사인자인 NF-KB 패밀리는 억제성 인자인 ΙκΒ 단백질과 결합된 복합체를 이루어 거의 모든 척추동물 세포의 세포질내에서 활성을 나타내지 않는 억제된 상태로 존재하지만 [18], 활성화가 시작되면 억제성 인자인 ΙκΒ 단백질이 인산화된 후 26S 프로테아좀 (proteasome)에 의해 분해되고, 이에 의해 NF-κΒ를 핵 내부로 이동케 하여 NF-κΒ 의존성 전사 활성을 활성화시키도록 한다 [19]. The role of antimicrobial peptides in the defensin family that mediates protective reactions has been studied in other organizations and has already been established [15-17]. However, it has not yet been investigated whether the expression of β-defensin in prostate epithelial cells is induced by bacterial infection. Nuclear Factor-κΒ (NF-κΒ) is an intracellular signaling factor that plays an important role in both innate and acquired immunity by inducing the activity of antimicrobial peptides. The NF-KB family of transcription factors remain in an inactivated state that is inactivated in the cytoplasm of almost all vertebrate cells in complex with the inhibitory factor ΙκΒ protein [18]. Phosphorus ΙκΒ protein is phosphorylated and then degraded by 26S proteasome, thereby bringing NF-κΒ into the nucleus To activate NF-κΒ dependent transcriptional activity [19].
현재까지 전립선 상피세포에서 HBD-27} 항상적으로 발현되는지 여부 및 미생물 감염에 의해 HBD-2의 발현이 상향조절되는 지에 대해서 연구되어 있지 않을 뿐만 아니라， 미생물 감염에 의해 NF-KB 활성화가 유도되는 지에 대해서도 조사되어 있지 않다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.  To date, it has not been studied whether HBD-27} is constantly expressed in prostate epithelial cells and whether the expression of HBD-2 is upregulated by microbial infection, and that NF-KB activation is induced by microbial infection. It has not been investigated. Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
【발명의 상세한 설명】 [Detailed Description of the Invention]
【기술적 과제】  [Technical problem]
본 발명자들은 인간 전립선 상피세포에서 미생물 등의 감염에 대해 항균성 펩타이드인 인간 β-디펜신 (Human β defensin, HBD)-2이 어떠한 패턴으로 발현되는 지에 대해 연구하였다. 그 결과, HBD-2가 전립선 상피세포에서 항상적으로 발현되며， 미생물 등의 감염에 의해 이의 발현 수준이 크게 증가하고， 이러한 발현의 증가는 전사인자 NF-κΒ의 활성화를 통해 이루어진다는 것을 실험적으로 규명하였으며， 이를 근거로 전립선에서의 HBD-2의 발현 수준의 측정이 전립선염의 진단에 유용하게 사용될 수 있음을 확인하여 본 발명을 완성하였다. 따라서, 본 발명의 목적은 HBD(Human β defensin)-2 유전자의 발현을 측정할 수 있는 프라이머， 프로브 또는 항체를 포함하는 전립선염 진단용 키트를 제공하는 것에 있다.  The present inventors studied the pattern of the anti-microbial peptide human β-defensin (HBD) -2, which is an antimicrobial peptide, against human infection in prostate epithelial cells. As a result, HBD-2 is constantly expressed in prostatic epithelial cells, and its expression level is greatly increased by infection of microorganisms, and the increase of such expression is achieved through activation of the transcription factor NF-κΒ. The present invention was completed by confirming that the measurement of the expression level of HBD-2 in the prostate can be useful for the diagnosis of prostatitis. Accordingly, it is an object of the present invention to provide a kit for diagnosing prostatitis comprising a primer, a probe or an antibody capable of measuring the expression of HBD (Human β defensin) -2 gene.
본 발명은 대상자 (subject)의 전립선염 진단 방법을 제공하는 것에 있다. 또한， 본 발명의 다른 목적은 전립선염의 진단을 위해 대상자의 전립선 시료에서 HBD-2의 발현양을 측정하는 방법을 제공하는 것에 있다. 【기술적 해결방법】 The present invention is to provide a method for diagnosing prostatitis in a subject. Another object of the present invention is to provide a method for measuring the expression amount of HBD-2 in a prostate sample of a subject for the diagnosis of prostatitis. Technical Solution
본 발명의 일 양태에 따르면， 본 발명은 대상자 (subject)의 전립선 시료로부터 HBD (Human β defensin)-2 유전자의 발현양을 측정하는 단계를 포함하는 전립선염 진단 방법을 제공한다.  According to one aspect of the invention, the present invention provides a method for diagnosing prostatitis comprising the step of measuring the expression level of HBD (Human β defensin) -2 gene from a subject's prostate sample.
본 발명의 다른 일 양태에 따르면， 본 발명은 (a) HBD (human β defensin)-2 유전자 서열에 특이적으로 결합하는 프라이머 (primer) 또는 프로브 (probe), 또는 (b) HBD-2 단백질에 특이적으로 결합하는 항체 (ant ibody)를 포함하는 인간의 전립선염 진단용 키트를 제공한다.  According to another aspect of the present invention, the present invention relates to a primer or probe specifically binding to (H) human β defensin (HBD) gene sequence, or (b) HBD-2 protein Provided is a kit for diagnosing prostatitis in humans comprising an antibody (ant ibody) that specifically binds.
본 발명은 전립선 조직에서 HBD-2 유전자의 발현 수준의 증가와 전립선염과의 상관성에 기초한다. 즉， 미생물 등의 감염에 의한 전립선염의 발생시에 전립선 조직 (특히 상피조직)에서 HB으 2의 유전자는 이의 항상적 (constitutive) 발현 수준 이상으로 발현이 증가하는 발현 패턴을 보인다. 본 명세서에서 전립선염으로 인한 HBD-2 유전자 발현의 증가는 항상적 발현 수준과 비교하여 이 보다 높은 수준으로 발현되는 것을 의미한다.  The present invention is based on an increase in the expression level of the HBD-2 gene in prostate tissue and its correlation with prostatitis. In other words, when prostatitis is caused by an infection of a microorganism or the like, the gene of HB 2 in prostate tissue (particularly epithelial tissue) shows an expression pattern that increases expression above its constitutive expression level. An increase in HBD-2 gene expression due to prostatitis herein means expression at a higher level compared to the level of homeostatic expression.
본 명세서에서 상기 용어 "대상자 (subject)" 는 전립선염을 겪을 것으로 추정되어 전립선염 여부를 진단하고자 하는 대상자를 의미하며， 바람직하게는 인간 (human)을 의미한다.  As used herein, the term "subject" refers to a subject who is supposed to suffer from prostatitis and is trying to diagnose prostatitis, preferably human.
본 명세서에서 상기 용어 "전립선염"은 전립선에서 발생되는 염증성 질환을 의미한다. 상기 전립선염을 일으킬 수 있는 원인으로는 예를 들어 미생물의 감염을 들 수 있으며， 보다 구체적으로는 균 {Escherichia coli) , 크렙시엘라 7ebs/e//a), 장내세균 (^ erobac er/a) , 프로테어스 ( /O e s) 및 세라티아 (Serratia) 종과 같은 그람음성 세균에 의한 감염을 들 수 있으나, 이에 한정되지 않는다.  As used herein, the term "prostatitis" refers to an inflammatory disease occurring in the prostate. Examples of the cause that can cause prostatitis include microbial infection, and more specifically, bacteria (Escherichia coli), Krebsiella 7ebs / e // a), enterobacteriaceae (^ erobac er / a) Infection with Gram-negative bacteria, such as, but not limited to, Proteas (/ O es) and Serratia species.
본 발명의 바람직한 구현예에 따르면， 본 발명의 방법에서 상기 HBD-2 유전자의 발현양의 측정은 HBD-2 유전자의 mRNA 양 또는 단백질 양의 측정이다. 본 발명의 다른 바람직한 구현예에 따르면， 본 발명의 방법에서 상기 HBD- 2 유전자의 발현양의 측정은 HBD-2 유전자의 mRNA를 RT—PCR (reverse transcript ion - polymerase chain react ion)하는 단계를 포함한다.  According to a preferred embodiment of the present invention, the measurement of the expression amount of the HBD-2 gene in the method of the present invention is the measurement of the mRNA amount or protein amount of the HBD-2 gene. According to another preferred embodiment of the invention, the measurement of the expression amount of the HBD-2 gene in the method of the present invention comprises the step of RT-PCR (reverse transcript ion-polymerase chain react ion) mRNA of the HBD-2 gene do.
본 발명의 또 다른 바람직한 구현예에 따르면， 본 발명의 방법에서 상기 HBD-2 유전자 발현양의 측정은 HBD-2 유전자의 단백질을 면역분석 (immunoassay)하는 단계를 포함한다. According to another preferred embodiment of the present invention, in the method of the present invention Determination of the amount of HBD-2 gene expression involves immunoassaying proteins of the HBD-2 gene.
본 발명의 또 다른 바람직한 구현예에 의하면， 본 발명의 방법에서 상기 HBD-2 유전자는 정상 전립선 시료에서의 발현 수준에 비해 전립선염 시료에서의 발현 수준이 증가되어 있다. 본 발명의 방법에서 전립선 시료에서의 HBD-2 유전자의 발현 수준이 이의 항상적 발현수준 보다 증가되어 있으면 전립선염으로 진단한다.  According to another preferred embodiment of the present invention, the HBD-2 gene in the method of the present invention is increased in the expression level in the prostatitis sample compared to the expression level in the normal prostate sample. In the method of the present invention, if the expression level of the HBD-2 gene in the prostate sample is increased above its constant expression level, it is diagnosed as prostatitis.
본 발명의 또 다른 바람직한 구현예에 의하면， 본 발명의 방법에서 상기 전립선 시료는 전립선의 상피 조직 또는 상피 세포이다.  According to another preferred embodiment of the present invention, the prostate sample in the method of the present invention is epithelial tissue or epithelial cells of the prostate.
본 발명의 또 다른 바람직한 구현예에 따르면， 본 발명의 키트에서 상기 프라이머 또는 프로브는 서열목록 제 1 서열 또는 서열목록 제 2 서열에 개시된 뉴클레오타이드 서열을 갖는다.  According to another preferred embodiment of the present invention, the primer or probe in the kit of the present invention has the nucleotide sequence disclosed in SEQ ID NO: 1 sequence or SEQ ID NO: 2 sequence.
본 발명의 방법에서 HBD-2 유전자의 발현 수준을 측정하여 전립선염의 발생 여부를 판단하는 것은 크게 두 가지의 방법， 즉 유전적분석 (genetic analysis) 방법과 면역분석 (i画 unoassay)방법으로 실시할 수 있다.  In the method of the present invention, the detection of prostateitis by measuring the expression level of the HBD-2 gene can be largely performed by two methods, namely, genetic analysis and immunoassay. Can be.
우선， 유전적 분석에 기초하여 본 발명을 설명하면 다음과 같다.  First, the present invention will be described based on genetic analysis.
유전적 분석에 기초하여 본 발명을 실시하는 경우， HBD-2 유전자 서열에 특이적으로 결합하는 프라이머 또는 프로브가 이용된다.  When practicing the present invention based on genetic analysis, primers or probes that specifically bind to the HBD-2 gene sequence are used.
프라이머를 이용하는 경우에는, 유전자 증폭 반웅을 실시하여 HBD-2 유전자의 발현 정도를 조사한다. 본 발명은 HBD-2 유전자의 발현 정도를 분석하는 것이기 때문에， 분석 대상의 시료 (예컨대， 세포 또는 조직)에서 HBD- 2의 mRNA 발현양을 조사하여 HBD-2 유전자의 발현 정도를 결정한다.  In the case of using a primer, gene amplification reaction is performed to check the expression level of the HBD-2 gene. Since the present invention analyzes the expression level of the HBD-2 gene, the expression level of the HBD-2 gene is determined by examining the amount of HBD-2 mRNA expression in a sample (eg, a cell or tissue) to be analyzed.
따라서， 본 발명은 원칙적으로 시료 내의 mRNA를 주형으로 하고 mRNA 또는 cDNA에 결합하는 프라이머를 이용하여 유전자 증폭 반웅을 실시한다. mRNA를 얻기 위하여， 시료에서 총 RNA를 분리한다. 총 RNA를 분리하는 것은 당업계에 공지된 통상의 방법에 따라 실시될 수 있다 (참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press(2001); Tesniere, C. et al. , Plant Mol. Biol. Rep. , 9:242(1991); Ausube 1 , F.M. et al., Current Protocols in Molecular Biology, John Wi 1 ley & Sons (1987)； 및 Chomczynski， P. et al. , Anal. Biochem. 162:156(1987)). 예컨대， Triz이을 이용하여 용이하게 세포 내의 총 RNA를 분리할 수 있다. 이어， 분리된 mRNA로부터 cDNA를 합성하고, 이 cDNA를 증폭한다. 본 발명의 총 RNA는 인간의 시료로부터 분리되는 것이기 때문에， mRNA의 말단에는 폴리 -A 테일을 갖고 있으며， 이러한 서열 특성을 이용한 올리고 dT 프라이머 및 역전사 효소를 이용하여 cDNA을 용이하게 합성할 수 있다 (참조: PNAS USA, 85:8998(1988)； Libert F, et al. , Science, 244:569(1989); 및 Sambrook, J. et al., Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press(2001)) . 이어， 유전자 증폭 반응을 통하여 합성된 cDNA를 증폭한다. 본 발명에 이용되는 프라이머는 주형의 한 부위에 흔성화 또는 어닐링되어 이중쇄 구조를 형성한다. 이러한 이중쇄 구조를 형성하는 데 적합한 핵산 흔성화의 조건은 Joseph Sambrook, 등， Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor , N.Y.(2001) 및 Haymes, B. D. , 등， Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985)에 개시되어 있다. Therefore, in principle, the present invention performs gene amplification reaction using primers that bind to mRNA or cDNA as a template of mRNA in a sample. To obtain mRNA, total RNA is isolated from the sample. Isolation of total RNA can be carried out according to conventional methods known in the art. See Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere , C. et al., Plant Mol. Biol. Rep., 9: 242 (1991); Ausube 1, FM et al., Current Protocols in Molecular Biology, John Wi 1 ley & Sons (1987); and Chomczynski, P. et al. , Anal. Biochem. 162: 156 (1987). For example, Triz can be used to easily isolate total RNA in cells. Subsequently, cDNA is synthesized from the isolated mRNA, and the cDNA is amplified. Since the total RNA of the present invention is isolated from human samples, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence characteristic ( PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). Subsequently, the synthesized cDNA is amplified by a gene amplification reaction. The primers used in the present invention are hybridized or annealed to one site of the template to form a double chain structure. Conditions for nucleic acid localization suitable for forming such double-chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).
다양한 DNA 중합효소가 본 발명의 증폭에 이용될 수 있으며， E. coli DNA 중합효소 I의 "클레나우" 단편， 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 바람직하게는， 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고， 이는 Thermus aquaticus(Taq) , Thermus thermophi lus(Tth) , Thermus f i 1 iformis, Therm is flavus, Thermococcus literalis, 및 Pyrococcus fur iosus(Pfu)를 포함한다 .  Various DNA polymerases can be used for amplification of the present invention and include "Clenau" fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtained from a variety of bacterial species, which include Thermus aquaticus (Taq), Thermus thermophi lus (Tth), Thermus fi 1 iformis, Therm is flavus, Thermococcus literalis, and Pyrococcus fur iosus (Pfu).
중합 반응을 실시할 때， 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반웅에 필요한 성분들의 과량은， 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양올 의미한다. Mg2+ 와 같은 조인자， dATP, dCTP, dGTP 및 dTTP를 소망하는 증폭 정도가 달성될 수 있을 정도로 반웅 흔합물에 제공하는 것이 요청된다. When carrying out the polymerization reaction, it is preferable to provide an excess amount of components necessary for the reaction to the reaction vessel. Excess of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. Joiners such as Mg 2+ , dATP, dCTP, dGTP and dTTP are required to provide to the reaction mixture such that the desired degree of amplification can be achieved.
증폭 반웅에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실， 완충액은 모든 효소들이 최적의 반웅 조건에 근접하도록 한다. 따라서 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반웅물에서 실시될 수 있다. All enzymes used for the amplification reaction can be active under the same reaction conditions. In fact, the buffer ensures that all enzymes are close to the optimum reaction conditions. Thus, the amplification process of the present invention is a single process without changing conditions such as addition of reactants. It may be carried out in a counterungmul.
본 발명에서 어닐링 또는 흔성화는 타겟 뉴클레오타이드 서열과 프라이머 사이에 특이적 결합을 가능하게 하는 엄격조건 하에서 실시된다. 어닐링을 위한 엄격조건은 서열 -의존적이며 주위 환경적 변수에 따라 다양하다.  In the present invention, annealing or localization is carried out under stringent conditions that allow for specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary with ambient environmental variables.
본 명세서에 기술된 용어 "증폭 반응" 은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며， 이는 중합효소 연쇄반응 (이하 PCR이라 한다) (미국 특허 제 4,683,195， 4,683,202, 및 4,800,159호)， 역전사-중합효소 연쇄반웅 (이하 RT-PCR로 표기한다) (Sambrook 등， Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press(2001)), Miller, H. I. (W0 89/06700) 및 Davey, C. 등 (EP 329,822)의 방법, 리가아제 연쇄 반응 (ligase chain reaction; LCR)(17, 18), Gap-LCR(W0 90/01069), 복구 연쇄 반응 (repair chain reaction; EP 439,182), 전사 -중재 증폭 (transcript ion-mediated amplification; TMA)(19) (W0 88/10315) , 자가 유지 염기서열 복제 (self sustained sequence repl icat ion) (20) (W0 90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭 (selective amplification of target polynucleotide sequences ) (미국 특허 제 6， 410， 276호)， 컨센서스 서열 프라이밍 중합효소 연쇄 반웅 (consensus sequence  As used herein, the term “amplification reaction” means a reaction that amplifies a nucleic acid molecule. Various amplification reactions have been reported in the art, which are called polymerase chain reaction (hereinafter referred to as PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (hereinafter referred to as RT-PCR). (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, HI (W0 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction ( ligase chain reaction (LCR) (17, 18), Gap-LCR (W0 90/01069), repair chain reaction (EP 439,182), transcription ion-mediated amplification (TMA) (19) (W0 88/10315), self sustained sequence repl icat ion (20) (W0 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6, 410, 276), consensus sequence priming polymerase chain reaction (consensus seque) nce
primed polymerase chain reaction; CP-PCR) (미국 특허 제 4,437,975호)， 임의적 프라이밍 증합효소 연쇄 반응 (arbitrarily primed polymerase chain reaction; AP-PCR) (미국 특허 제 5,413,909호 및 제 5,861, 245호)， 핵산 염기서열 기반 증폭 (nucleic acid sequence based amplification; NASBA) (미국 특허 제 5,130, 238호， 제 5,409,818호， 제 5,554,517호， 및 제 6,063,603호), 가닥 치환 증폭 (strand displacement amplification) 및 고리 -중재 항온성 증폭 (loop- mediated isothermal amplification; LAMP)를 포함하나， 이에 한정되지는 않는다. 사용 가능한 다른 증폭 방법들은 미국특허 제 5，242，794， 5,494,810, 4, 988,617호 및 미국 특허 제 09/854, 317호에 기술되어 있다.  primed polymerase chain reaction; CP-PCR) (US Pat. No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR) (US Pat. Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (nucleic) acid sequence based amplification (NASBA) (US Pat. Nos. 5,130, 238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification and loop-mediated isothermal amplification (LAMP), but is not limited thereto. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4, 988,617 and US Pat. No. 09 / 854,317.
본 발명의 가장 바람직한 구현예에서， 증폭 과정은 미국특허 제 4,683,195호， 제 4, 683, 202호 및 계 4,800,159호에 개시된 PCR (polymerase chain react ion)에 따라 실시된다. PCR은 가장 잘 알려진 핵산 증폭 방법으로， 그의 많은 변형과 응용들이 개발되어 있다. 예를 들어, PCR의 특이성 또는 민감성을 증진시키기 위해 전통적인 PCR 절차를 변형시켜 터치다운 (touchdown) PCR, 핫 스타트 (hot start) PCR, 네스티드 (nested) PCR 및 부스터 (booster) PCR이 개발되었다. 또한， 실시간 (real-time) PCR, 분별 디스플레이 PCR(dif ferential display PCR: DD- PCR), cDNA 말단의 신속 증폭 (rapid amplification of cDNA ends: RACE), 멀티플렉스 PCR, 인버스 중합효소 연쇄반응 (inverse polymerase chain reaction: IPCR) , 백토레트 (vectorette) PCR, TA I L-PCR( thermal asymmetric interlaced PCR)및 멀티플렉스 PCR이 특정한 웅용을 위해 개발되었다. PCR에 대한 자세한 내용은 McPherson, M.J., 및 Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000)에 기재되어 있으며， 그의 교시사항은 본 명세서에 참조로 삽입된다. In the most preferred embodiment of the present invention, the amplification process is carried out according to the polymerase chain react ion (PCR) disclosed in US Pat. Nos. 4,683,195, 4, 683, 202 and 4,800,159. PCR is the best known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse) Polymerase chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TA I L-PCR), and multiplex PCR have been developed for specific purposes. For more information on PCR, see McPherson, MJ, and Moller, SG PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.
본 발명에서 증폭 반응에 이용되는 프라이머는 HBD-2의 cDNA 서열에 상보적인 서열을 갖는 올리고뉴클레오타이드이다. 본 명세서에서 용어 "프라이머" 는 적합한 온도에서 적합한 완층액 내에서 적합한 조건 (즉， 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반웅 효소)하에서 주형 -지시 DNA 합성의 개시점으로 작용할 수 있는 단일 -가닥 을리고뉴클레오타이드를 의미한다. 프라이머의 적합한 길이는 다양한 인자， 예컨대， 온도와 프라이머의 용도에 따라 변이가 있지만 전형적으로 15-30 뉴클레오타이드이다. 짧은 프라이머 분자는 주형과 층분히 안정된 하이브리드 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다.  The primer used in the amplification reaction in the present invention is an oligonucleotide having a sequence complementary to the cDNA sequence of HBD-2. As used herein, the term “primer” refers to a template—a single capable of acting as an initiation point for directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerization reaction enzymes) in a suitable complete solution at a suitable temperature. Refers to stranded nucleotides. Suitable lengths of primers are typically 15-30 nucleotides, although varying depending on various factors, such as temperature and the use of the primer. Short primer molecules generally require lower temperatures to form hybrid complexes that are highly stable with the template.
프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 흔성화 되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 층분한 상보성을 가지면 층분하다. 따라서， 본 발명에서의 프라이머 세트는 주형인 HBD-2 cDNA서열에 완벽하게 상보적인 서열을 가질 필요는 없으며， 이 서열에 흔성화되어 프라이머 작용을 할 수 있는 범위 내에서 층분한 상보성을 가지면 충분하다. 바람직하게는， 본 발명에서 이용되는 프라이머는 HBD-2 cDNA 서열에 완벽하게 상보적인 서열을 갖는 것이다.  The sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and is sufficient if it has sufficient complementarity within a range that can be hybridized with the template to perform a primer-specific function. Therefore, the primer set of the present invention does not need to have a sequence that is perfectly complementary to the HBD-2 cDNA sequence, which is a template, and it is sufficient that the primer set has sufficient complementarity within a range capable of acting as a primer by the sequence. . Preferably, the primer used in the present invention has a sequence that is perfectly complementary to the HBD-2 cDNA sequence.
본 발명의 프라이머는 HBD-2의 mRNA (즉, cDNA) 서열에 상보적인 서열로 제조될 수 있다. 이러한 프라이머의 디자인은 HBD-2의 cDNA 서열올 참조하여 당업자에 의해 용이하게 실시할 수 있으며， 예컨대, 프라이머 디자인용 프로그램 (예: PRIMER 3 프로그램)을 이용하여 할 수 있다. 본 발명의 프라이머의 구체적인 예는 서열목록 제 1 서열 및 제 2서열에 기재되어 있다. 이렇게 증폭된 HBD-2 cDNA를 적합한 방법으로 분석하여 HBD-2 유전자의 발현 정도를 조사한다. 예를 들어, 상술한 증폭 반웅 결과물을 젤 전기영동을 하고， 그 결과 형성되는 밴드를 관찰 및 분석함으로써 HBD-2 유전자의 발현 정도를 조사한다. 이러한 증폭 반응을 통하여, HBD-2 유전자의 발현이 전립선 조직 또는 세포에서의 항상적 발현 수준과 비교하여 높은 수준으로 나오는 경우에는 전립선염으로 진단된다. The primer of the present invention is a sequence complementary to the mRNA (ie cDNA) sequence of HBD-2 Can be prepared. The design of such primers can be readily performed by those skilled in the art with reference to the cDNA sequence of HBD-2, for example, using a primer design program (eg, PRIMER 3 program). Specific examples of the primers of the present invention are described in SEQ ID NO: 1 sequence and 2nd sequence. The amplified HBD-2 cDNA is analyzed by a suitable method to investigate the expression level of the HBD-2 gene. For example, the degree of expression of the HBD-2 gene is examined by performing gel electrophoresis on the amplified reaction product described above and observing and analyzing the resulting band. Through this amplification reaction, prostateitis is diagnosed when the expression of the HBD-2 gene occurs at a high level compared to the level of constant expression in prostate tissue or cells.
또한， HBD-2 유전자 또는 HBD-2의 cDNA에 흔성화 되는 프로브를 이용하여 흔성화 -기초 분석을 하여 전립선염을 진단할 수도 있다. 본 명세서에서 용어 "프로브" 는 단일쇄 핵산 분자이며， 타겟 핵산 서열에 상보적인 서열을 포함한다. 본 발명의 일 구현예에 따르면， 본 발명의 프로브의 이점， 즉 흔성화 특이성의 개선이 손상되지 않는 범위 내에서， 본 발명의 프로브를 변형할 수 있다. 이들 변형， 즉 표지는 흔성화 여부를 검출케 하는 시그널을 제공할 수 있으며， 이는 올리고뉴클레오타이드에 연결될 수 있다. 적합한 표지는 형광단 (예컨대， 플루오리신 (fluorescein), 피코에리트린 (phycoerythr in)， 로다민， 리사민 (lissamine), 그리고 Cy3와 Cy5 (Pharmacia)), 발색단， 화학발광단， 자기입자， 방사능동위원소 (P32 및 S35), 매스 표지, 전자밀집입자， 효소 (알칼린 포스파타아제 또는 호스래디쉬 퍼옥시다아제)， 조인자, 효소에 대한 기질， 중금속 (예컨대， 금) 그리고 항체， 스트렙타비딘, 바이오틴， 디곡시게닌과 킬레이팅기와 같은 특정 결합 파트너를 갖는 햅텐을 포함하나， 이에 한정되는 것은 아니다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법， 예컨대， 닉 트랜스레이션 (nick translation) 방법， 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광， 방사능， 발색 측정， 중량 측정， X-선 회절 또는 흡수， 자기， 효소적 활성， 매스 분석， 결합 친화도， 흔성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널올 제공한다. In addition, prostateitis can be diagnosed by a hybridization-based analysis using a probe that is common to the HBD-2 gene or the cDNA of HBD-2. As used herein, the term “probe” is a single-chain nucleic acid molecule and includes a sequence that is complementary to a target nucleic acid sequence. According to one embodiment of the present invention, the probe of the present invention can be modified within a range that does not impair the advantages of the probe of the present invention, that is, the improvement of the localization specificity. These modifications, ie labels, can provide a signal to detect whether they are localized, which can be linked to oligonucleotides. Suitable labels include fluorophores (e.g. fluorescein, phycoerythr in, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia), chromophores, chemilumines, magnetic particles, radioactivity Isotopes (P 32 and S 35 ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg gold) and antibodies, streptavi Hapten with specific binding partners, such as, but not limited to, dine, biotin, digoxigenin and chelating groups. Labeling is carried out in a variety of methods conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels can be detected by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, polarization high frequency, nanocrystals Provide a signal.
본 발명의 일 구현예에 따르면, HBD-2의 cDNA에 흔성화되는 본 발명의 프로브는 불용성 담체 (예컨대， 니트로셀 를로오스 또는 나일론 필터， 유리판， 실리콘 및 플루오로카본 지지체)에 고정화되어， 마이크로어레이를 제조할 수 있다. 마이크로어레이에 있어서 본 발명의 프로브는 흔성화 어레이 요소 (hybridizable array element)로서 이용된다. 불용성 담체에로의 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어， 상기 흔성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고， 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한， 상기 흔성화 어레이 요소는 링커 (예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 담체에 결합될 수 있다. HBD-2의 cDNA는 상술한 과정에 의해 얻을 수 있다. 프로브 대신에 HBD-2의 cDNA를 표지하여 흔성화 반응 -기초 분석을 실시할 수도 있다. 프로브를 이용하는 경우， 프로브를 cDNA 분자와 흔성화시킨다. 본 발명에서， 적합한 흔성화 조건은 최적화 절차에 의하여 일련의 과정으로 결정될 수 있다. 이런 절차는 연구실에서 사용을 위한 프로토콜을 수립하기 위하여 당업자에 의하여 일련의 과정으로 실시된다. 예를 들어， 온도， 성분의 농도， 흔성화 및 세척 시간， 완층액 성분 및 이들의 pH 및 이온세기 둥의 조건은 프로브의 길이 및 GC 양 및 타깃 뉴클레오타이드 서열 등의 다양한 인자에 의존한다. 흔성화를 위한 상세한 조건은 Joseph Sambrook, et al . , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor , N.Y.(2001); 및 M丄 ·Μ. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999)에서 확인할 수 있다. 흔성화 반응 이후에， 흔성화 반웅을 통하여 나오는 흔성화 시그널을 검출한다. 흔성화 시그널은 예컨대, 프로브에 결합된 표지의 종류에 따라 다양한 방법으로 실시할 수 있다. 예를 들어, 프로브가 효소에 의해 표지된 경우, 이 효소의 기질을 흔성화 반웅 결과물과 반웅시켜 흔성화 여부를 확인할 수 있다. 이용될 수 있는 효소 /기질의 조합은, 퍼옥시다아제 (예컨대， 호스래디쉬 퍼옥시다아제)와 클로로나프를， 아미노에틸카바졸， 디아미노벤지딘， D-루시페린， 루시게닌 (비스 -N-메틸아크리디늄 니트레이트)， 레소루핀 벤질 에테르， 루미놀， 암플렉스레드 시약 (10-아세틸 -3,7-디하이드록시페녹사진)， HYR ( -pheny 1 ened i am i ne-HC 1 and pyrocatechol ) , TMB(tetramethylbenzidine) , ABTS(2,2 '-Azine-di [3-ethylbenzthiazol ine sulfonate]), o-페닐렌디아민 (OPD) 및 나프롤 /파이로닌; 알칼린 포스파타아제와 브로모클로로인돌일 포스페이트 (BCIP), 니트로 블루 테트라졸리움 (NBT), 나프를 -AS-B1- 포스페이트 (naphthol-AS-Bl-phosphate) 및 ECF 기질; 글루코스 옥시다아제와 t— NBT(nitroblue tetrazolium)등이다. 프로브가 금 입자로 표지된 경우에는 실버 니트레이트를 이용하여 실버 염색 방법으로 검출할 수 있다. 상술한 흔성화 과정에 의한 흔성화 시그널의 세기를 분석함으로써， 전립선염을 진단할 수 있다. 즉， 시료에서 HBD-2 cDNA에 대한 시그널이 항상적 발현 수준의 것 보다 강하게 나오는 경우에는 전립선염으로 진단된다. According to one embodiment of the present invention, the probe of the present invention, which is popularized in the cDNA of HBD-2, is immobilized on an insoluble carrier (e.g., nitrocelose or nylon filter, glass plate, silicone and fluorocarbon support), Microarrays can be prepared. In microarrays, the probes of the present invention are used as hybridizable array elements. Immobilization to an insoluble carrier is carried out by chemical bonding methods or by covalent binding methods such as UV. For example, the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface. In addition, the hybridization array element may be linked to the carrier via a linker (eg, ethylene glycol oligomer and diamine). The cDNA of HBD-2 can be obtained by the above process. Instead of the probe, the cDNA of HBD-2 can be labeled to perform a shake reaction-based assay. When using probes, probes are hybridized with cDNA molecules. In the present invention, suitable isomerization conditions can be determined in a series of procedures by an optimization procedure. This procedure is carried out by a person skilled in the art in order to establish a protocol for use in the laboratory. For example, the temperature, concentration of components, shake and wash times, complete fluid components, and their pH and conditions of ionic strength depend on various factors, such as the length of the probe and the amount of GC and the target nucleotide sequence. Detailed conditions for the shake are described in Joseph Sambrook, et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And M 丄 M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. NY (1999). After the shake reaction, the shake signal coming through the shake reaction is detected. The localization signal can be carried out by various methods, for example, depending on the type of label bound to the probe. For example, when the probe is labeled by an enzyme, the substrate of the enzyme can be counteracted with the result of the shake reaction to determine whether it is shaken. Combinations of enzymes / substrates that can be used include peroxidase (e.g. horseradish peroxidase) and chloronaph, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacrydi Nitrate), resorufin benzyl Ether, luminol, amplexed reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (-pheny 1 ened i am i ne-HC 1 and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di [3-ethylbenzthiazol ine sulfonate]), o-phenylenediamine (OPD) and naprol / pyronine; Alkaline phosphatase with bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphth-AS-B1-phosphate and ECF substrate; Glucose oxidase and t—nitroblue tetrazolium (NBT). When the probe is labeled with gold particles, it can be detected by silver dyeing using silver nitrate. The prostatitis can be diagnosed by analyzing the intensity of the above-mentioned generalization signal by the above-mentioned generalization process. That is, if the signal for HBD-2 cDNA in the sample is stronger than that of the constant expression level, it is diagnosed as prostatitis.
다음으로， 면역분석 (i隱 unoassay) 방법에 기초하여 본 발명을 설명하면 다음과 같다.  Next, the present invention will be described based on the immunoassay (i 隱 unoassay) method.
즉， 본 발명에서 HBD-2 단백질의 발현 수준은 면역분석 방법에 따라 측정하여 전립선염을 진단하는 데 이용될 수 있다. 이러한 면역분석은 종래에 개발된 다양한 면역분석 (i醒 unoassay) 또는 면역염색 (immunostaining) 프로토콜에 따라 실시될 수 있다. 상기 면역분석 또는 면역염색 포맷은 방사능면역분석， 방사능면역침전, 면역침전, EL ISA (enzyme— linked immunosorbent assay) , 캡처 -ELISA, 억제 또는 경쟁 분석， 샌드위치 분석， 유세포 분석 (flow cytometry), 면역형광염색 및 면역친화성 정제를 포함하지만, 이에 한정되는 것은 아니다. 상기 면역분석 또는 면역염색의 방법은 Enzyme I隱 unoassay, E. T. Maggio, ed. , CRC Press, Boca Raton, Florida, 1980; Gaastra, W.， Enzymeᅳ linked immunosorbent assay(ELISA) , in Methods in Molecular Biology, Vol . 1， Walker, J.M. ed. , Humana Press, NJ, 1984； 및 Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, 1999에 기재되어 있으며， 상기 문헌은 본 명세서에 참조로서 삽입된다.  That is, the expression level of HBD-2 protein in the present invention can be used to diagnose prostatitis by measuring according to an immunoassay method. Such immunoassays can be performed according to a variety of previously developed immunoassays (i 醒 unoassay) or immunostaining protocols. The immunoassay or immunostaining format may include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, ELISA (enzyme—linked immunosorbent assay), capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, immunofluorescence Staining and immunoaffinity tablets include, but are not limited to. The immunoassay or method of immunostaining is described in Enzyme I 'unoassay, E. T. Maggio, ed. , CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme ᅳ linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed. , Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.
예를 들어， 본 발명의 방법이 방사능면역분석 방법에 따라 실시되는 경우， 방사능동위원소 (예컨대， C14, I125, P32 및 S35)로 레이블링된 항체가 HBD-2 단백질을 검출하는 데 이용될 수 있다. 본 발명의 방법이 ELISA 방식으로 실시되는 경우， 본 발명의 특정 실시예는 (i) 분석하고자 하는 전립선 시료 분해물을 고체 기질의 표면에 코팅하는 단계; (Π) 일차 항체로서 HBD-2 단백질에 대한 항체와 상기 시료 분해물을 반응시키는 단계; (iii) 상기 단계 (ii)의 결과물을 효소가 결합된 이차항체와 반응시키는 단계; 및 (iv) 상기 효소의 활성을 측정하는 단계를 포함한다. 상기 고체 기질로 적합한 것은 탄화수소 폴리머 (예컨대， 폴리스틸렌 및 폴리프로필렌)， 유리， 금속 또는 젤이며， 가장 바람직하게는 마이크로타이터 플레이트이다. 상기 이차항체에 결합된 효소는 발색반응， 형광반웅， 발광반응 또는 적외선 반응을 촉매하는 효소를 포함하나, 이에 한정되지 않으며， 예를 들어, 알칼린 포스파타아제， β- 갈락토시다아제 , 호스 래디쉬퍼옥시다아제， 루시퍼라아제 및 사이토크름 Ρ450을 포함한다. 상기 이차항체에 결합하는 효소로서 알칼린 포스파타아제가 이용되는 경우에는， 기질로서 브로모클로로인돌일 포스페이트 (BCIP), 니트로 블루 테트라졸리움 (ΝΒΤ), 나프를 -ASB1-포스페이트 (naphtho AS-Bl-phosphate) 및 ECF( enhanced chemi fluorescence)와 같은 발색반응 기질이 이용되고， 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프를， 아미노에틸카바졸， 디아미노벤지딘， D-루시페린， 루시게닌 (비스 -N-메틸아크리디늄 니트레이트)， 레소루핀 벤질 에테르， 루미놀， 암플렉스 레드 시약 (10-아세틸 -3,7- 디하이드록시페녹사진), HYR( p-pheny 1 ened i am i ne-HC 1 and pyrocatechol ) , TMB(tetramethyl benzidine) , ABTS(2,2 '一 Azine一 di [3— ethylbenzthiazol ine sulfonate]), o-페닐렌디아민 (OPD) 및 나프를 /파이로닌， 글루코스 옥시다아제와 t-NBT(nitroblue tetrazol ium) 및 m-PMS(phenzaine methosul fate)와 같은 기질이 이용될 수 있다. For example, when the method of the present invention is carried out in accordance with radioimmunoassay methods, antibodies labeled with radioisotopes (eg, C 14 , I 125 , P 32 and S 35 ) may be used to detect HBD-2 protein. Can be used. The method of the present invention is an ELISA method When implemented, certain embodiments of the present invention comprise the steps of: (i) coating the prostate sample lysate to be analyzed on the surface of a solid substrate; (Π) reacting the sample digest with an antibody against HBD-2 protein as a primary antibody; (iii) reacting the resultant of step (ii) with the secondary antibody to which the enzyme is bound; And (iv) measuring the activity of the enzyme. Suitable for the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates. Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence reaction, luminescence or infrared reaction, for example, alkaline phosphatase, β-galactosidase, hose Radishperoxidase, luciferase and cytokine Ρ450. When alkaline phosphatase is used as the enzyme that binds to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (ΝΒΤ), and naph -ASB1-phosphate (naphtho AS-Bl) are used as substrates. When chromogenic reaction substrates such as -phosphate) and enhanced chemi fluorescence (ECF) are used, and horse radish peroxidase is used, chloronaph, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis -N-methylacridinium nitrate), resoruppin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-pheny 1 ened i am i ne- HC 1 and pyrocatechol), TMB (tetramethyl benzidine), ABTS (2,2 '一 Azine 一 di [3—ethylbenzthiazol ine sulfonate]), o-phenylenediamine (OPD) and nap / pyronine, glucose oxidase and t -Nitroblue tetrazol ium (NBT) and m-PMS (phe substrates such as nzaine methosul fate) may be used.
본 발명의 방법이 캡처 -ELISA 방식으로 실시되는 경우， 본 발명의 특정 실시예는 (i) 포획항체 (capturing antibody)로서 HBD—2 단백질에 대한 항체를 고체 기질의 표면에 코팅하는 단계; (ii) 포획항체와 전립선 시료 분해물을 반응시키는 단계; (Hi) 상기 단계 (ii)의 결과물을 시그널을 발생시키는 레이블이 결합되어 있고, HBD-2 단백질에 특이적으로 반응하는 검출항체 (detecting antibody)와 반웅시키는 단계; 및 (iv) 상기 레이블로부터 발생하는 시그널을 측정하는 단계를 포함한다. 상기 검출 항체는 검출 가능한 시그널을 발생시키는 레이블을 가지고 있다. 상기 레이블은 화학물질 (예컨대 , 바이오틴)， 효소 (알칼린 포스파타아제， β- 갈락토시다아제， 호스 래디쉬 퍼옥시다아제 및 사이토크름 Ρ450), 방사능물질 ((예컨대， C14, I125， Ρ32 및 S35), 형광물질 (예컨대， 플루오레신)， 발광물질， 화학발광물질 (chemi luminescent) 및' FRET( fluorescence resonance energy transfer)을 포함하나， 이에 한정되는 것은 아니다. 다양한 레이블 및 레이블링 방법은 Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, 1999에 기재되어 있다. When the method of the invention is carried out in a capture-ELISA mode, certain embodiments of the invention comprise the steps of: (i) coating an antibody against HBD-2 protein as a capturing antibody to the surface of a solid substrate; (ii) reacting the capture antibody with the prostate sample digest; (Hi) reacting the result of step (ii) with a detecting antibody that has a label that generates a signal and specifically reacts with HBD-2 protein; And (iv) measuring the signal resulting from the label. The detection antibody carries a label which generates a detectable signal. The label may include chemicals (e.g., biotin), enzymes (alkaline phosphatase, β-galactosidase, horse radish peroxidase and cytokine Ρ450), radioactive substances (e.g., C 14 , I 125 , Ρ 32 and S 35 ), fluorescent materials such as fluorescein, luminescent materials, chemi luminescent and ' fluorescence resonance energy transfer (FRET). Methods are described in Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.
상기 ELISA 방법 및 캡처 -ELISA 방법에서 최종적인 효소의 활성 측정 또는 시그널의 측정은 당업계에 공지된 다양한 방법에 따라 실시될 수 있다. 이러한 시그널의 검출은 HBD-2 단백질의 정성적 또는 정량적 분석을 가능하게 한다. 만일, 레이블로서 바이오틴이 이용된 경우에는 스트렙타비딘으로， 루시퍼라아제가 이용된 경우에는 루시페린으로 시그널을 용이하게 검출할 수 있다.  Measurement of the final enzyme activity or signal in the ELISA method and capture-ELISA method can be carried out according to various methods known in the art. Detection of this signal allows for qualitative or quantitative analysis of HBD-2 protein. If biotin is used as a label, the signal can be easily detected with streptavidin and luciferase if luciferase is used.
본 발명의 인간 전립선염 진단용 키트가 만일 PCR 증폭 과정에 적용되는 경우， 본 발명의 키트는 선택적으로， PCR 증폭에 필요한 시약, 예컨대， 완층액， DNA 증합효소 (예컨대， Thermus aquat i cus (Taq) , Thermus thermophi lus (Tth) , Thermus f i 1 i formis , Therm is f 1 avus , Thermococcus literal is 또는 Pyrococcus furiosus (Pfu)로부터 수득한 열 안정성 DNA 중합효소), DNA 증합 효소 조인자 및 dNTPs를 포함할 수 있다.  If the kit for diagnosing the human prostatitis of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as a supernatant, a DNA polymerase (eg, Thermus aquat i cus (Taq)). , Thermus thermophi lus (Tth), Thermus fi 1 i formis, Therm is f 1 avus, Thermococcus literal is or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu), DNA polymerase joiners and dNTPs .
본 발명에서 인간 전립선염 진단용 키트가 면역분석방법에 적용되는 경우 본 발명의 키트는 선택적으로， 이차항체 및 표지의 기질을 포함할 수 있다.  When the kit for diagnosing human prostatitis in the present invention is applied to an immunoassay method, the kit of the present invention may optionally include a secondary antibody and a substrate of a label.
본 발명의 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.  Kits of the invention can be prepared in a number of separate packaging or compartments containing the reagent components described above.
【유리한 효과】 본 발명은 전립선염의 진단 방법 및 이 방법에 사용되는 키트에 관한 것이다. 보다 상세하게는 대상자 (subject)의 전립선 시료로부터 HBD (Human β defensin)-2 유전자의 발현양을 측정하는 단계를 포함하는 전립선염 진단 방법 및 HBD (human β defensin)-2의 발현양을 측정할 수 있는 프라이머， 프로브 또는 항체를 포함하는 전립선염 진단용 키트에 관한 것이다. 본 발명은 전립선 조직 또는 세포에서 HBD-2의 발현 수준 증가가 전립선염의 발생과 상관관계가 있음을 규명한 것에 기초한다. 본 발명의 방법 및 키트에 의하면 간단한 분자생물학적 분석을 통해 전립선염을 정확하고도 신속하게 진단할 수 있는 효과가 있다. Advantageous Effects The present invention relates to a method for diagnosing prostatitis and a kit for use in the method. More specifically, from the subject's prostate sample, HBD (Human β A method for diagnosing prostatitis comprising measuring the expression level of defensin) -2 gene and a kit for diagnosing prostatitis comprising a primer, a probe or an antibody capable of measuring the expression level of human β defensin (HBD) -2 will be. The present invention is based on the finding that increased expression levels of HBD-2 in prostate tissue or cells correlate with the development of prostatitis. According to the method and kit of the present invention, it is possible to accurately and quickly diagnose prostatitis through a simple molecular biological analysis.
【도면와 간단한설명】 [Drawing and brief description]
도 1은 전립선 조직 및 세포주에서 인간 β-디펜신 -2 (human β-defensin- 2;HBD-2)의 RT-PCR 이용한 검출결과를 보여준다. 레인 (lane) 1： RWPE-1 세포; 레인 2: DU-145 세포; 레인 3: PC-3 세포; 레인 4-6: 전립선 비대증 (benign prostatic hyperplasia, BPH) 샘플， ； GAPDH: 내부 대조군.  1 shows the results of RT-PCR detection of human β-defensin-2 (HBD-2) in prostate tissue and cell lines. Lane 1: RWPE-1 cells; Lane 2: DU-145 cells; Lane 3: PC-3 cells; Lanes 4-6: sample of prostatic hyperplasia (BPH); GAPDH: internal control.
도 2a 및 도 2b는 전립선 비대증 환자로부터 얻은 조직 샘플에서 HBD-2의 면역화학적 염색 결과를 보여준다.  2A and 2B show the results of immunochemical staining of HBD-2 in tissue samples obtained from patients with prostatic hyperplasia.
도 2a는 염증성 세포에 의해 둘러싸인 전립선 부분 또는 장관내 (intraluminal) 염증세포로 둘러싸인 전립선 부분 (오픈된 곡선 화살표 표시 부분)이 염증성 세포의 침투가 없는 부분 (오픈된 직선 화살표 표시 부분)에 비해서 HBD-2 발현이 보다 강하게 검출되는 것을 보여준다. 또한， 대식세포 (macrophage)를 포함하여 염증성 세포는 HBD-2의 발현이 증가되어 있음을 보여준다 (막힌 직선 화살표 표시 부분) (X 400).  FIG. 2A shows that the prostate portion surrounded by inflammatory cells or the prostate portion surrounded by intraluminal inflammatory cells (open curve arrow) shows HBD- as compared to the portion without open inflammatory cells (open line arrow). 2 shows that the expression is detected more strongly. In addition, inflammatory cells, including macrophage, show increased expression of HBD-2 (blocked straight arrow) (X400).
도 2b는 HBD-2를 발현하는 대식세포는 BPH 조직의 비-염증성 기질에 거의 침투하지 않았다 (x400).  2B shows that HBD-2 expressing macrophages hardly infiltrated non-inflammatory substrates of BPH tissue (x400).
도 3a는 LPS가 전립선 상피 세포에서 HBD-2 mRNA 발현을 유도하는 결과를 보여준다. RWPE-1 세포에서 LPS (10 mg/ )로 처리한 후에 HBD-2 mRNA 발현을 RT-PCR로 분석하였다.  3A shows the results of LPS inducing HBD-2 mRNA expression in prostate epithelial cells. HBD-2 mRNA expression was analyzed by RT-PCR after treatment with LPS (10 mg /) in RWPE-1 cells.
도 3b는 전립선 상피세포내에서 LPS가 HBD-2 단백질의 생성을 유도하는 것을 보여준다. HBD-2의 농도는 LPS (10 mg/ )으로 처리하여 배양한 RWPE-1 세포의 배양 상등액에서 ELISA를 이용하여 측정하였다. 농도는 상등액 mL당 단백질 피코그램 (picogram)으로 나타내었으며， 이는 3회의 독립적 실험의 대표값이다. 3B shows that LPS induces production of HBD-2 protein in prostate epithelial cells. The concentration of HBD-2 was measured by ELISA in the culture supernatant of RWPE-1 cells treated with LPS (10 mg /). Concentration per mL of supernatant Protein picograms are shown, representative of three independent experiments.
도 4a 내지 도 4d는 RWPE-1 세포내에서 NF-κΒ 활성화가 LPS-유도된 HBD-2 발현에 필요하다는 것을 보여주는 결과이다.  4A-4D show that NF-κΒ activation is required for LPS-induced HBD-2 expression in RWPE-1 cells.
도 4a는 RWPE-1 세포에서 LPS 자극 (10 mg/ra )에 따른 ΙκΒα 인산화를 면역블로팅에 의해 측정한 결과를 보여준다.  4a shows the results of immunoblotting of ΙκΒα phosphorylation following LPS stimulation (10 mg / ra) in RWPE-1 cells.
도 4b는 LPS-활성화된 RWPE-1 세포내에서 ΙκΒα 분해의 속도론에 대한 결과를 보여준다.  4B shows the results for the kinetics of ΙκΒα degradation in LPS-activated RWPE-1 cells.
도 4c는 LPS로 1 시간 동안 자극한 RWPE-1 세포내에서 NF-κΒ의 EMSA 결과를 보여준다 (레인 3). 레인 1은 핵 추출물이 첨가되지 않은 것이고， 레인 2는 대조군 세포이고， 레인 4는 표지 하지 않은 올리고뉴클레오타이드로 경쟁 시험한 것이다.  4C shows EMSA results of NF-κΒ in RWPE-1 cells stimulated with LPS for 1 hour (lane 3). Lane 1 is free of nuclear extracts, lane 2 is control cells and lane 4 is competition tested with unlabeled oligonucleotides.
도 4d는 RWPE-1 세포내에서 HBD-2의 LPS유도에 대한 Bayll-7082를 사용한 NF-κΒ 억제 영향을 측정한 결과를 보여준다. Bay: Bayll-7082. *： p < 0.05， 대조군과 비교함; #: p < 0.05, LPS-처리군과 비교함.  4D shows the results of measuring the effect of NF-κΒ inhibition using Bayll-7082 on LPS induction of HBD-2 in RWPE-1 cells. Bay: Bayll-7082. *: P <0.05, compared with control; #: p <0.05, compared with LPS-treated group.
【발명의 실시를 위한 형태】 [Form for implementation of invention]
이하， 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로， 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. 실시예  Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention more specifically, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . EXAMPLE
실험방법 및 재료 Experiment Method and Materials
1. 항체 및 시약 1. Antibodies and Reagents
LPS(Lipopolysaccharide)는 Sigma-Aldrich (대한민국, 서울)로부터 구입하였다. Bayll-7082은 Calbiochem으로부터 구입하였다. HBD-2(human beta defensin-2) EL ISA kit는 KOMA Biotech Inc. (Seoul, Korea)로부터 구입하였다. 항ᅳ ΙκΒα 및 항— phosph으 I κ Β α는 Cell Signal ing Technology Inc(Danvers , MA, USA)로부터 구입하였다. Lipopolysaccharide (LPS) was purchased from Sigma-Aldrich (Seoul, Korea). Bayll-7082 was purchased from Calbiochem. Human beta defensin-2 (HBD-2) EL ISA kit is available from KOMA Biotech Inc. It was purchased from (Seoul, Korea). Anti- ΙκΒα and Anti-Phosphorus I κ Β α are available from Cell Signaling Technology Inc. USA).
2. 환자 및 조직 샘플 2. Patient and tissue sample
전립선 조직 샘플은 임상적으로 전립선 비대증 (benign prostatic hyperplasia, BPH)인 3명의 환자로부터 얻었다. 모든 환자들은 연구 조사를 위해 그들의 전립선 조직을 사용하는 것에 동의하였으며， 이 연구는 중앙대학교 의과대학 심의위원회에 의해 승인되었다ᅳ 환자들은 2009년 5월 중에 중앙대학교 병원에서 전립선에 대해 경요도절제술 (transurethral resection)이 시술된 환자들이다. 외과수술후에， 각 전립선 샘플은 2개로 분리되어, 하나는 즉시 액체 질소내에서 동결시키고 다른 하나는 10% 포르말린으로 고정한 후 사용시 까지 파라핀-봉매하였다.  Prostate tissue samples were obtained from three patients clinically benign prostatic hyperplasia (BPH). All patients agreed to use their prostate tissue for research and the study was approved by the Chung-Ang University Medical Review Board. Patients were transurethral to the prostate at Chung-Ang University Hospital in May 2009. resection). After surgery, each prostate sample was separated into two, one immediately frozen in liquid nitrogen and the other fixed with 10% formalin and paraffin-sealed until use.
3. 세포주 3. Cell line
불멸화된 인간 전립선 상피세포주 (RWPE-1) 및 인간 전립선 암세포주 (PC-3 및 DU-145)은 American Type Culture Col lect ion(Manassas , VA, USA)으로부터 구입하였다. RWPE-1 세포는 0.05 mg/mi BPE( bovine pituitary extract) 및 5 ng/m-C EGF( epidermal growth factor) 첨가된 Kerat inocyte-SFM (Invitrogen Corporation, Carlsbad, CA, USA)내에서 5% C02를 포함하는 습화된 분위기하에서 배양하였다. PC-3 및 DU-145 세포는 RPMI 1640 (WelGENE, 서울， 대한민국)， 10% 열처리-불활성화시킨 FBS (fetal bovine serum) (Invitrogen Corporation) 및 1%> 페니실린-스트렙토마이신 (WelGENE)올 함유하는 성장 배지내에서 배양하였다. 세포는 80-90% 컨플루언시에서 통상적 방법으로 계대배양하였다. Immortalized human prostate epithelial cell line (RWPE-1) and human prostate cancer cell lines (PC-3 and DU-145) were purchased from American Type Culture Collect ion (Manassas, VA, USA). RWPE-1 cells contain 5% C0 2 in Kerat inocyte-SFM (Invitrogen Corporation, Carlsbad, CA, USA) supplemented with 0.05 mg / mi bovine pituitary extract (BPE) and 5 ng / mC epidermal growth factor (EGF). Incubated in a humid atmosphere. PC-3 and DU-145 cells contain RPMI 1640 (WelGENE, Seoul, South Korea), 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen Corporation) and 1%> penicillin-streptomycin (WelGENE) ol. Cultured in growth medium. Cells were passaged by conventional methods at 80-90% confluency.
4. 면역조직화학 4. Immunohistochemistry
BPH 조직에서 HBD-2의 발현은 Ultravision LP Detection System (LabVision Corporation, Fremont , CA, USA)를 사용하여 연구하였다. 간략하게 설명하면， BPH 조직을 갖는 슬라이드는 20분 이상 크실렌 (xylene)내에서 왁스를 제거하고， 100%， 95%, 90% 및 80% 에탄을 용액내에서 연속적으로 재수화 (rehydrate)시켰다. 물에서 5분간 세정한 후， 슬라이드를 0.01 M 소디엄 시트레이트 완층액에서 전처리하고 120°C에서 1분간 오토클레이브 (autoclave)하여 항원을 회수하였다. 슬라이드를 세정한 후， 내재의 퍼옥시다아제 활성은 3% ¾02로 30분간 처리하여 차단하였다. 인간 β- 디펜신 -2(HBD-2)에 대한 마우스 1차 다클론 항체 (1:50， Abeam, MA, USA)를 슬라이드 섹션에 적용하고， 상온에서 습화된 챔버내에서 2 시간 동안 인큐베이션하였다. 음성 대조군은 1차 항체를 비면역 혈청으로 교체하여 준비하였다. 슬라이드를 PBS로 세정한 후， 상온에서 2차 항체와 인큐베이션하고， PBS로 다시 세정하였다. 슬라이드를 호스래디쉬 퍼옥시다아제 (horseradish peroxidase) 컨쥬게이트된 3차 항체와 10분간 인큐베이션시키고, 디아미노벤지딘 (diaminobenzidine)과 10 분간 인큐베이션하였다. 슬라이드를 Mayer' s hematoxyl in으로 대비 염색한후에, 탈수하고 커버 슬립상에 올렸다. Expression of HBD-2 in BPH tissues was studied using the Ultravision LP Detection System (LabVision Corporation, Fremont, CA, USA). Briefly, slides with BPH tissues are waxed in xylene for at least 20 minutes, and 100%, 95%, 90% and 80% ethane is continuously in solution. Rehydrate. After washing for 5 minutes in water, the slides were pretreated in 0.01 M sodium citrate complete solution and autoclave at 120 ° C. for 1 minute to recover antigen. After washing the slides, the peroxidase activity of the intrinsic was blocked by treatment for 30 minutes at 3% ¾0 2. Mouse primary polyclonal antibody (1:50, Abeam, MA, USA) against human β-defensin-2 (HBD-2) was applied to the slide sections and incubated for 2 hours in a humidified chamber at room temperature. . Negative controls were prepared by replacing the primary antibody with non-immune serum. The slides were washed with PBS, incubated with secondary antibodies at room temperature, and washed again with PBS. Slides were incubated for 10 minutes with horseradish peroxidase conjugated tertiary antibody and for 10 minutes with diaminobenzidine. Slides were counterstained with Mayer's hematoxyl in, then dehydrated and placed on cover slips.
5. RNA분리 및 RT—PCR (Reverse Transcriptase-Polymerase Chain Reaction) 5. RNA Isolation and RT—PCR (Reverse Transcriptase-Polymerase Chain Reaction)
RNA는 RNeasy 키트 (Qiagen, Seoul , Korea)를 사용하여 분리하고 2yg의 총 腿를 Accupower RT/PCR Premix (Bioneer , Dae j eon, Korea)를 사용하여 역전사시켰다. cDNA는 다음의 프라이머 (Genotech, Dae j eon, Korea)를 사용하여 증폭하여 얻었다; 센스 (sense): 5' - CCAGCCATCAGCCATGAGGGT -3' 및 안티센스 (ant i sense): 5' - GGAGCCCITTCTGAATCCGCA -3' (255 amplicon). PCR 조건은 94°C에서 2분간 변성시킨 후 94°C에서 30초, 62°C에서 30초 및 72°C에서 30초의 1사이클올 35회 사이클을 수행하였다. 모든 실험에서 역전사를 하지 않거나 또는 RNA를 사용하지 않는 것으로 구성된 2개의 음성 대조군을 설정하였다. 내부 RT-PCR 대조군인 GAPDH ( g 1 y cer a 1 dehyde-3-phosphat e dehydrogenase)를 포함하는 PCR 생성물을 암조건에서 SYBRGreen (Roche Applied Science, Indianapolis, IN, USA)으로 15분간 염색한 후 1.5% 아가로스 젤상에서 전기영동하였다. 전기영동을 수행한 젤은 사진을 촬영하여 Bio-Rad Molecular Imager Gel Doc XR+ System (Bio-Rad Laboratories , Inc. Hercules , CA, USA)에 의해 분석하였다. 6. EL I SA( Enzyme- 1 inked immunosorbent assay) RNA was isolated using RNeasy kit (Qiagen, Seoul, Korea) and 2 yg total shock was reverse transcribed using Accupower RT / PCR Premix (Bioneer, Dae j eon, Korea). cDNA was obtained by amplification using the following primers (Genotech, Dae j eon, Korea); Sense: 5′-CCAGCCATCAGCCATGAGGGT-3 ′ and antisense: 5′-GGAGCCCITTCTGAATCCGCA-3 ′ (255 amplicon). PCR conditions were denatured at 94 ° C for 2 minutes, followed by 35 cycles of 1 cycleol of 30 seconds at 94 ° C, 30 seconds at 62 ° C and 30 seconds at 72 ° C. All negative experiments were set up with two negative controls consisting of no reverse transcription or no RNA. PCR product containing GAPDH (g 1 y cer a 1 dehyde-3-phosphate dehydrogenase), an internal RT-PCR control group, was stained with SYBRGreen (Roche Applied Science, Indianapolis, IN, USA) for 15 minutes under dark conditions and then 1.5 Electrophoresis on% agarose gel. Gels subjected to electrophoresis were photographed and analyzed by Bio-Rad Molecular Imager Gel Doc XR + System (Bio-Rad Laboratories, Inc. Hercules, CA, USA). 6. EL I SA (Enzyme-1 inked immunosorbent assay)
LPS에 의해 자극된 RWPE-1 세포의 상등액상에 존재하는 인간 β-디펜신- 2의 농도는 제조자의 지시서에 따라 HBDOiuman β -defensin)-2 EL ISA 키트 (KOMA Biotech Inc, Korea)를 사용하여 측정하였다. 최소 검출 가능한 농도는 HBD-2 재조합 펩타이드 약 8 pg/ 의 농도로 확인되었다. 키트에 포함되어 있는 연속적으로 희석된 재조합 펩타이드를 사용하여 표준 커브 (standard curve)를 제작하였다. 웰 (well)의 광학밀도 (optical density)는 마이크로플레이트 리더 (microplate reader) (TECAN Systems Inc, San Jose, CA, USA)를 사용하여 450 nm에서 측정하였다.  The concentration of human β-defensin-2 present in the supernatant of LWPE-1 cells stimulated by LPS was determined using the HBDOiuman β-defensin) -2 EL ISA kit (KOMA Biotech Inc, Korea) according to the manufacturer's instructions. Measured. The minimum detectable concentration was identified at a concentration of about 8 pg / HBD-2 recombinant peptide. A standard curve was prepared using serially diluted recombinant peptides included in the kit. The optical density of the wells was measured at 450 nm using a microplate reader (TECAN Systems Inc, San Jose, Calif., USA).
7. 면역블로팅 7. Immunoblotting
RWPE-1 세포로부터 총 단백질 추출물은 1.5% 소디엄 도데실설페이트 (sodium dodecyl sulfate, SDS), 62.5 mM Tris-HCl (pH 6.8)， 5 mM EDTA (ethylenediaminetetraacet ic acid) , 1% 2-ME(2-mercaptoethanol ) , 1 μ g/ l antipain di hydrochloride, 1 μ g/ mi chymostatin, 및 1 μ g/ leupeptin (all from Sigma-Aldr ich, Seoul , Korea)으로 이루어진 용해 완충액을 이용하여 준비하였다. 세포 용해물은 원심분리 처리하여 상등액을 분리한 후 이를 -80°C에서 저장하였다. 상피 세포 용해물을 구성하는 단백질은 10% 분리젤상에서의 SDS/PAGE에 의해 분리하고， 이를 니트로샐를로오스막 (Bi으 Rad Laboratories)으로 이동시켰다. 웰 (well)내에 로딩되는 단백질이 동등한 양인지를 확인하기 위해 젤과 니트로셀를로오스막을 각각 Coomassie Brilliant Blue(Sigma)와 Ponceau S(Sigma)을 사용하여 염색하였다. 막은 0.05% Tween 20 (Sigma) 및 3% 탈지분말유 (Sigma)를 포함하는 TBS (Tris-buf fered saline, 150 mM NaCl, 25 mM Tris, pH 7.4)내에서 상온에서 2시간 동안 인큐베이션하여 블로킹하고, 이어서 1차 항처 K래빗의 항 -phospl )-I κΒα， 래빗의 항 -Ι κΒα 및 래빗의 항— β-액틴) (Cell Signaling Technology, Inc)의 1:1000 회석과 함께 4°C에서 하룻밤 배양하였다. 블로킹 완층액내에서 1:10000의 비율로 희석된 HRP 컨쥬게이트된 고우트 (goat) 항 -래빗 IgG (Cell Signaling Technology Inc.)를 2차 항체로 사용하였고， 막 (membrane)을 상온에서 1 시간 동안 인큐베이션하였다. 블롯은 ECL (enhanced chemi i luminescence) (GE Health Care)를 기질로 사용하여 전개하였다. Total protein extracts from RWPE-1 cells consisted of 1.5% sodium dodecyl sulfate (SDS), 62.5 mM Tris-HCl (pH 6.8), 5 mM ethylenediaminetetraacetic acid (EDTA), 1% 2-ME (2). -mercaptoethanol), 1 μg / l antipain di hydrochloride, 1 μg / mi chymostatin, and 1 μg / leupeptin (all from Sigma-Aldr ich, Seoul, Korea). Cell lysates were centrifuged to separate the supernatants and then stored at -80 ° C. Proteins constituting epithelial cell lysates were separated by SDS / PAGE on 10% separation gels and transferred to nitrocelose membranes (Bi Rad Laboratories). Gels and nitrocell membranes were stained using Coomassie Brilliant Blue (Sigma) and Ponceau S (Sigma), respectively, to ensure that the proteins loaded in the wells were equal. The membrane was incubated and blocked for 2 hours at room temperature in TBS (Tris-buf fered saline, 150 mM NaCl, 25 mM Tris, pH 7.4) containing 0.05% Tween 20 (Sigma) and 3% skim powder (Sigma). Then overnight at 4 ° C with 1: 1000 dilution of anti-phospl) -I κΒα of K rabbit, anti-Ι κΒα of rabbit and anti-β-actin of rabbit (Cell Signaling Technology, Inc) Incubated. HRP conjugated goat anti-rabbit IgG (Cell Signaling Technology Inc.) diluted at a ratio of 1: 10000 in blocking supernatant was used as a secondary antibody, and the membrane was used at room temperature for 1 hour. Incubated. Blots were developed using enhanced chemi i luminescence (ECL) (GE Health Care) as substrate.
8. EMSA (Electrophoretic Mobility Shift Assay) 8.EMSA (Electrophoretic Mobility Shift Assay)
LPS(10 yg/ml)로 자극한 RWPE-1 세포 또는 자극하지 않은 RWPE-1 세포들을 원심분리하고 넁각된 PBS내에서 1회 세정하였다. 세포들을 회수하고， 세포 핵 단백질들을 Nuclear Extract Kit (Active Motif, Carlsbad, CA, USA)에 의해 추출하였다. 단백질은 DC Protein Assay kit (Bio-Rad Laboratories)에 의해 정량하였다. 어닐링 후에 NF-κΒ서열 (5' -AGTTGAGGGGACTTTCCCAGG-3' )을 함유하는 비오틴 (biotin) 3'-말단 표지된 올리고뉴클레오타이드를 DNA 프로브로 사용하였다. 결합 반응은 5 의 핵 단백질 및 표지된 프로브와 함께 총 부피 20 ^의 총 부피를 갖는 결합 완층액 (10 mM TrisHCl [ H 7.5], 50 mM KC1, 50 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 5 mM DTT, and 5% glycerol)내에서 25°C에서 15 분간 수행하였다. 경쟁적 (competitive) 분석을 위해 비표지된 야생형 프로브를 200배 과량 몰 (mole)의 양으로 결합 반응액에 첨가하였다. DNA-단백질 복합체를RWPE-1 cells stimulated with LPS (10 yg / ml) or unstimulated RWPE-1 cells were centrifuged and washed once in sensed PBS. Cells were harvested and cell nuclear proteins were extracted by Nuclear Extract Kit (Active Motif, Carlsbad, CA, USA). Proteins were quantified by the DC Protein Assay kit (Bio-Rad Laboratories). After annealing a biotin 3'-terminal labeled oligonucleotide containing NF-κΒ sequence (5'-AGTTGAGGGGACTTTCCCAGG-3 ') was used as the DNA probe. Binding reactions were performed with binding complete fluid (10 mM TrisHCl [H 7.5], 50 mM KC1, 50 mM NaCl, 1 mM MgCl 2 , 1 mM EDTA, with a total volume of 20 ^ total with nuclear protein of 5 and labeled probes). , 5 mM DTT, and 5% glycerol) at 25 ° C for 15 minutes. Unlabeled wild-type probes were added to the binding reaction in an amount of 200-fold excess mole for competitive analysis. DNA-protein complexes
0.5X Tris-borate-EDTA 완층액내에서의 4% 비 -변성 (non-denaturing) 폴리아크릴아미드젤을 이용하여 상온에서 전기영동을 행하여 분리하였다. 전기영동한 후에， 젤을 Biodyne B Pre-cut Modified Nylon Membranes (Thermo Fisher Scientific Inc, Rockford, IL, USA)에 이동시키고 Chemi luminescent Nucleic Acid Detection Module (Thermo Scientific)에 의해 분석하였다. Separation was performed by electrophoresis at room temperature using 4% non-denaturing polyacrylamide gel in 0.5X Tris-borate-EDTA complete solution. After electrophoresis, the gels were transferred to Biodyne B Pre-cut Modified Nylon Membranes (Thermo Fisher Scientific Inc, Rockford, IL, USA) and analyzed by Chemi luminescent Nucleic Acid Detection Module (Thermo Scientific).
9. 데이터 분석 9. Data Analysis
모든 실험은 분석 이전에 적어도 3회 반복하였다. HBD— 2 농도는 평균士표준편차로서 표현하였다. 통계적 유의성을 규정하기 위해 Paired Student' s t-test를 사용하였고， p < 0.05인 경우를 통계적으로 유의한 것으로 간주하였다. 실험결과  All experiments were repeated at least three times before analysis. HBD-2 concentrations are expressed as mean standard deviation. Paired Student's t-test was used to define statistical significance, and p <0.05 was considered as statistically significant. Experiment result
1. 전립선 시료내에서 HBD mRNA 및 단백질의 발현 HBD-2 raRNA의 발현은 세포주 PC_3를 제외한 테스트된 모든 샘플내에서 검사하였다. 즉， 정상 전립선 상피세포주 RWPE-1, 전립선암 세포주 DU-145 및 3개의 전립선 비대증 (BPH) 환자 샘플에서 검사하였다 (도 1). 도 1에 나타난 결과에 의하면， HBD-2가 전립선 상피세포， 즉， 정상 전립선 상피세포주 RWPE-1, 전립선암 세포주 DU-145 및 전립선 비대증 조직 등에서 항상적으로 (const itutively) 발현된다는 것을 알 수 있었다. 또한， 전립선 조직에 대한 면역조직화학 분석을 행한 결과， HBD-2 단백질은 BPH 환자로부터 채취한 전립선 조직 샘플내에서도 검출되었다 (도 2a 및 도 2b). HBD-2의 발현은 염증세포가 침투되지 않은 영역 보다 염증세포로 둘러싸인 전립선에서 보다 높은 정도로 검출되었다 (도 2a). 또한, 염증세포 예를 들어 대식세포 (macrophage)는 HBD-2의 발현 수준이 증가되었음이 나타났다. HBD-2-발현 대식세포는 비-염증성 기질 BPH조직을 거의 침투하지 않았다 (도 2b). 1. Expression of HBD mRNA and Protein in Prostate Samples Expression of HBD-2 raRNA was examined in all tested samples except cell line PC_3. That is, it was examined in a sample of normal prostate epithelial cell line RWPE-1, prostate cancer cell line DU-145 and three prostatic hyperplasia (BPH) patients (Fig. 1). According to the results shown in FIG. 1, it was found that HBD-2 is constantly expressed in prostate epithelial cells, ie, normal prostate epithelial cell line RWPE-1, prostate cancer cell line DU-145, and prostatic hyperplasia tissue. . In addition, as a result of immunohistochemical analysis of prostate tissue, HBD-2 protein was also detected in prostate tissue samples taken from BPH patients (FIGS. 2A and 2B). Expression of HBD-2 was detected to a higher extent in the prostate surrounded by inflammatory cells than in areas where inflammatory cells did not penetrate (FIG. 2A). In addition, inflammatory cells, such as macrophage, have been shown to have increased expression levels of HBD-2. HBD-2-expressing macrophages barely penetrated the non-inflammatory matrix BPH tissue (FIG. 2B).
2. RWPE-1 세포내에서 HBD— 2 mRNA 및 단백질 발현에 대한 LPS의 조절 2. Regulation of LPS on HBD-2 mRNA and Protein Expression in RWPE-1 Cells
전립선 상피세포상에서 세균 감염의 영향을 분석하기 위한 모델 시스템에서 LPS 및 RWPE-1 세포를 사용하였는데， 이는 LPS 인지 (recognition)가 가장 잘 연구된 시스템 중에 하나이고， 또한， 그람 음성세균， 예를 들어 ^^균 Escherichia coli) , 크렙시엘라 057ebs/e//a) , 장내세균 (Enterobacteria) , 프로테어스 (Proteus), 및 세라티아 (Serratia)종이 이 기관에 영향을 미치는 가장 빈번한 병원체이기 때문이다 [20].  LPS and RWPE-1 cells were used as a model system to analyze the effects of bacterial infection on prostate epithelial cells, which is one of the best studied LPS recognition systems, and is also known as Gram-negative bacteria, eg ^^ Because Escherichia coli, Krebsiella 057ebs / e // a), Enterobacteria, Proteus, and Serratia are the most frequent pathogens affecting this organ [20].
HBD-2 mRNA의 수준은 LPS( 1 ipopolysacchar ide)로 3 - 24 시간 동안 처리한 RWPE-1 세포에서 현저하게 증가하였다 (도 3a) · 또한， HBD-2 mRNA의 증가된 수준이 단백질의 트랜스레이션 (translation)의 증가에 관련되어 있는 지를 확인하기 위해， HBD-2 단백질에 대한 ELISA를 수행하였다. 도 3a에 나타난 HBD- 2 mRNA 발현 결과와 일치하게， HBD-2 단백질의 농도는 LPS로 자극된 RWPE—1 세포를 배양한 배지 내에서 시간 의존적 방식으로 크게 증가하였다 (도 3b) ·  Levels of HBD-2 mRNA were significantly increased in RWPE-1 cells treated with 1 ipopolysacchar ide (LPS) for 3-24 hours (FIG. 3A). In addition, increased levels of HBD-2 mRNA resulted in protein translation. ELISA was performed on the HBD-2 protein to determine if it was related to an increase in translation. Consistent with the results of HBD-2 mRNA expression shown in FIG. 3A, the concentration of HBD-2 protein was greatly increased in a time dependent manner in medium in which LW-stimulated RWPE-1 cells were cultured (FIG. 3B).
상기의 결과에 의해 전립선 상피세포에서 LPS가 HBD-2의 발현 및 생성을 증가시킨다는 것을 알 수 있었다. 3. NF-κΒ 활성화가 RWPE-1 세포내에서 LPS—유도된 HBD 생성에 연관되어 있다. 도 4a에서 보여지는 바와 같이， LPS는 ΙκΒα 인산화의 증가를 자극하였다. 이와 일치하게， ΙκΒα의 분해는 동일한 노출 기간 내에서 관찰되었다 (도 4b). 이러한 데이터는 LPS에의 노출이 RWPE-1 세포내에서 NF-KB 활성화를 유도한다는 것을 암시한다. NF-KB 활성화는 EMSA(electrophoretic mobility shift assay)에 의해 확인하였다. 낮은 수준의 NF-KB 컨센서스 프로브 -결합 복합체가 처리되지 않은 핵내에서 존재하였다. DNA-단백질 복합체는 LPS 자극에 의해 증가하였다 (도 4c). 표지되지 않은 NF-KB 프로브를 200배 과량의 몰량으로 첨가한 경우 DNA-단백질 복합체의 수준이 감소하였다. 이는 NF-κΒ에 대한 컨센서스 서열이 DNA-단백질 복합체의 형성에 대해 매우 중요하다는 것을 암시한다 (도 4c). The results showed that LPS increased the expression and production of HBD-2 in prostate epithelial cells. 3. NF-κΒ activation is involved in LPS-induced HBD production in RWPE-1 cells. As shown in FIG. 4A, LPS stimulated an increase in ΙκΒα phosphorylation. In agreement with this, degradation of ΙκΒα was observed within the same exposure period (FIG. 4B). These data suggest that exposure to LPS induces NF-KB activation in RWPE-1 cells. NF-KB activation was confirmed by electrophoretic mobility shift assay (EMSA). Low levels of NF-KB consensus probe-binding complexes were present in the untreated nucleus. DNA-protein complexes were increased by LPS stimulation (FIG. 4C). The addition of an unlabeled NF-KB probe in a molar amount of 200 fold reduced the level of the DNA-protein complex. This suggests that the consensus sequence for NF-κΒ is very important for the formation of DNA-protein complexes (FIG. 4C).
NF-KB 활성화가 LPS에 의해 유도되는 HBD-2의 생성에 필요한 지에 대해 알아보기 위해, NF-KB 억제자인 Bayll-7082가 LPS-유도된 HBD-2 생성에 어떠한 영향을 미치는 지를 검사하였다. Bayll-7082는 ΙκΒ 인산화를 억제하여 NF- KB의 활성화를 차단한다 [21L Bayll-7082는 LPS에 의해 유도되는 HBD-2의 생성을 억제하였는데， 이는 NF-κΒ가 LPS에 의해 유도되는 HBD-2의 생성에 관계되어 있다는 것을 암시하는 것이다 (도 4d).  To determine if NF-KB activation is required for the production of LBD-induced HBD-2, we examined how NF-KB inhibitor Bayll-7082 affects LPS-induced HBD-2 production. Bayll-7082 inhibits the activation of NF-KB by inhibiting ΙκΒ phosphorylation [21L Bayll-7082 inhibited the production of HBD-2 induced by LPS, which is HBD-2 in which NF-κΒ is induced by LPS It is implied that it is related to the generation of (Fig. 4D).
상기 결과들은 그람 음성 세균의 세포막 성분인 LPS에 의해 NF-KB 경로의 활성화를 거쳐 HBD-2의 발현이 상향 조절된다는 것과， 전립선 상피에서 미생물의 감염에 대한 숙주 방어 면역반응이 일어날 수 있다는 것을 제시하는 것이다. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바， 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며， 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서， 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.  These results suggest that expression of HBD-2 is upregulated through activation of the NF-KB pathway by LPS, a cell membrane component of Gram-negative bacteria, and that host defense immune responses against microbial infections in prostate epithelium can occur. It is. Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
참조 문헌 Reference
1. Chen X， Niyonsaba F, Ushio H, et al . Antimicrobial peptides human sd wti nn i 2l Chen X, Niyonsaba F, Ushio H, et al. Antimicrobial peptides human s d w ti n n i 2l
.wt 4^ .wt 4 ^
In 1: I n 1 :
TOieunsn<fO. J C Hf utw tssueslinr1ili -- ,,· g. 3cca J. Ga T KR Mrr PBnzTO i eunsn <f O. JCH f utw tssues li nr 1ili -,,. G. 3cca J. Ga T KR Mrr PBnz
. .
rtsatorecretnoo oilr ! f inciucnf w 4ll--. rtsa t orecre t noo o ilr! fi ci n w f ucn 4 ll -.
0¾ S. fill" 0¾ S. fill "
pyeabtermiil (d hres>f1in— 12. Feng P, Li TL, Guan ZX, Franklin RB, Costello IX. Effect of zinc on prostatic tumor igeni city in nude mice. Ann NY Acad Sci 2003: 1010: 316- 20. pyeab t erm iil ( d h res > f 1i n— 12.Feng P, Li TL, Guan ZX, Franklin RB, Costello IX. Effect of zinc on prostatic tumor igeni city in nude mice. Ann NY Acad Sci 2003: 1010: 316-20.
13. Wong PF, AbuBakar S. LNCaP prostate cancer eel Is are insentitive to zinc- induced senescence. J Trace Elem Med Biol 2008: 22： 242-47.  13. Wong PF, AbuBakar S. LNCaP prostate cancer eel Is are insentitive to zinc-induced senescence. J Trace Elem Med Biol 2008: 22: 242-47.
14. Reese JH, McNeal JE, Golenberg SL, Redwine EA, Sellers RG. Distribution of lactoferr in in the normal and inflamed human prostate: an i mmunoh i s t ochem i c a 1 study. Prostate 1992： 20: 73ᅳ 85.  14. Reese JH, McNeal JE, Golenberg SL, Redwine EA, Sellers RG. Distribution of lactoferr in in the normal and inflamed human prostate: an i mmunoh i s t ochem i c a 1 study. Prostate 1992 ： 20: 73 ᅳ 85.
15. Wehkamp J, St ange EF. Paneth eel Is and the innate immune response. Curr Op in Gastroenterol 2006: 22： 644-50.  15. Wehkamp J, St ange EF. Paneth eel Is and the innate immune response. Curr Op in Gastroenterol 2006: 22: 644-50.
16. Sansonett i PJ . War and peace at mucosal surfaces. Nat Rev I誦 unol 2003： 3： 710-20.  16. Sansonett i PJ. War and peace at mucosal surfaces. Nat Rev I 誦 unol 2003 ： 3 ： 710-20.
17. Zaslof f M. Antimicrobial peptides in health and disease N Engl J Med 2002： 347： 1199-200.  17. Zaslof f M. Antimicrobial peptides in health and disease N Engl J Med 2002: 347: 1199-200.
18. Zhang G, Ghosh S. Toll—like receptor-mediated NF- Β activation: a phylogenetically conserved paradigm in innate immunity. J CI in Invest 2001： 107： 13-9.  18. Zhang G, Ghosh S. Toll—like receptor-mediated NF-β activation: a phylogenetically conserved paradigm in innate immunity. J CI in Invest 2001 ： 107 ： 13-9.
19. Wang T, Zhang X， Li JJ. The role of NF-kappaB in the regulation of cell stress responses. Int Immunopharmacol 2002： 2: 1509-20.  19. Wang T, Zhang X, Li JJ. The role of NF-kappa B in the regulation of cell stress responses. Int Immunopharmacol 2002: 2: 1509-20.
20. Domingue Sr. GJ, Hel lstrom WJ . Prostatitis. CI in Microbiol Rev 1998： 11： 604-13.  20. Domingue Sr. GJ, Hel lstrom WJ. Prostatitis. CI in Microbiol Rev 1998 ： 11 ： 604-13.
21. Mori N, Yamada Y, Ikeda S, et al . Bay 11-7082 inhibits transcript ion factor NF- Β and induces apoptosis of HTLV-1- infected T-cel 1 lines and primary adult T-cel 1 leukemia cells. Blood 2002： 100: 1828-34.  21. Mori N, Yamada Y, Ikeda S, et al. Bay 11-7082 inhibits transcript ion factor NF- Β and induces apoptosis of HTLV-1- infected T-cel 1 lines and primary adult T-cel 1 leukemia cells. Blood 2002: 100: 1828-34.
22. Kumar A, Zhang J, Yu F_S X. Tollᅳ like receptor 2ᅳ mediated expression of -defensin-2 in human corneal epithelial eel Is. Microbes Infect 2006： 8: 380-9.  22. Kumar A, Zhang J, Yu F_S X. Toll receptor like receptor 2ted mediated expression of -defensin-2 in human corneal epithelial eel Is. Microbes Infect 2006: 8: 380-9.
23. Gombart AF, 0' Kelly J, Saito T, Koeff ler HP. Regulation of the CAMP gene by 1,25(0H)2D3 in various tissues. J Steroid Bi ochem Mol Biol 23. Gombart AF, 0 'Kelly J, Saito T, Koeff ler HP. Regulation of the CAMP gene by 1,25 (0H) 2D3 in various tissues. J Steroid Bi ochem Mol Biol
pp,ee ededaed Whka Wham Kt a.K an Apmitmkl NFB—-- 0017211:: pp, ee ededaed Whka Wham Kt aK an Apm i tmk l NFB —-- 00 1 721 1 ::
,,, Qs0uG. Alii¾cos Ika M C Cii nn A l t In ArmE).. ,,, Qs0uG. A lii ¾cos I ka MCC ii nn A lt I n Arm E) ..
Coentll00676. D 241770::1 Coent ll 00676.D 241770 :: 1
l hi .0070355712 2::- l hi .0070355712 2 :: -

Claims

【청구의 범위】 [Range of request]
【청구항 1】  [Claim 1]
대상자 (subject )의 전립선 시료로부터 HBD (Human β defensin)-2 유전자의 발현양을 측정하는 단계를 포함하는 전립선염 진단 방법 .  A method for diagnosing prostatitis, comprising measuring the expression level of HBD (Human β defensin) -2 gene from a subject's prostate sample.
【청구항 2】 [Claim 2]
제 1 항에 있어서 , 상기 HBD-2 유전자의 발현양의 측정은 HBD-2 유전자의 mRNA 양 또는 단백질 양의 측정 인 것을 특징으로 하는 방법 .  The method of claim 1, wherein the measurement of the amount of expression of the HBD-2 gene is a measurement of the amount of mRNA or protein of the HBD-2 gene.
【청구항 3] [Claim 3]
제 2 항에 있어서， 상기 HBD-2 유전자의 발현양의 측정은 HBD-2 유전자의 mRNA를 RT—PCR (reverse transcr ipt ion ― polymerase chain react ion)하는 단계를 포함하는 것을 특징으로 하는 방법 .  The method of claim 2, wherein the measurement of the amount of expression of the HBD-2 gene comprises the step of reverse transcript ion-polymerase chain react ion (RTR-PCR) of the mRNA of the HBD-2 gene.
【청구항 4】 [Claim 4]
제 2 항에 있어서， 상기 HBD-2 유전자 발현양의 측정은 HBD-2 유전자의 단백질을 면역분석 ( i隱 unoassay)하는 단계를 포함하는 것을 특징으로 하는 방법 .  The method of claim 2, wherein the measurement of the amount of HBD-2 gene expression comprises immunoassay (i 을 unoassay) of the protein of the HBD-2 gene.
【청구항 5】 [Claim 5]
제 1 항 내지 제 4 항 중 어느 한 항에 있어서， 상기 HBD-2 유전자는 정상 전립선 시료에서의 발현 수준에 비해 전립선염 시료에서의 발현 수준이 증가 되어 있는 것을 특징으로 하는 방법 .  The method according to any one of claims 1 to 4, wherein the HBD-2 gene has an increased expression level in the prostatitis sample compared to the expression level in the normal prostate sample.
【청구항 6】 [Claim 6]
제 1 항 내지 제 4 항 중 어느 한 항에 있어서， 상기 전립선 시료는 전립선의 상피 조직 또는 상피 세포인 것을 특징으로 하는 방법 .  The method according to any one of claims 1 to 4, wherein the prostate sample is epithelial tissue or epithelial cells of the prostate gland.
【청구항 7】 (a) HBD (human β defensin)-2 유전자 서열에 특이적으로 결합하는 프라이머 또는 프로브， 또는 (b) HBD-2 단백질에 특이적으로 결합하는 항체를 포함하는 인간의 전립선염 진단용 키트. [Claim 7] A kit for diagnosing prostatitis in humans comprising (a) a primer or probe specifically binding to a human β defensin (HBD) gene sequence, or (b) an antibody specifically binding to a HBD-2 protein.
【청구항 8] [Claim 8]
제 7 항에 있어서， 상기 프라이머 또는 프로브는 서열목록 제 1 서열 또는 서열목록 제 2 서열에 개시된 뉴클레오타이드 서열을 갖는 것을 특징으로 하는 키트.  8. The kit of claim 7, wherein the primer or probe has a nucleotide sequence disclosed in SEQ ID NO: 1 or SEQ ID NO: 2.
PCT/KR2011/000452 2010-01-21 2011-01-21 Diagnostic method and diagnosing kit for prostatitis WO2011090351A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2010-0005561 2010-01-21
KR20100005561A KR101151715B1 (en) 2010-01-21 2010-01-21 Method for Diagnosis of Prostatitis and Kit for the Same

Publications (2)

Publication Number Publication Date
WO2011090351A2 true WO2011090351A2 (en) 2011-07-28
WO2011090351A3 WO2011090351A3 (en) 2011-12-29

Family

ID=44307421

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/000452 WO2011090351A2 (en) 2010-01-21 2011-01-21 Diagnostic method and diagnosing kit for prostatitis

Country Status (2)

Country Link
KR (1) KR101151715B1 (en)
WO (1) WO2011090351A2 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6174664B1 (en) * 1997-02-05 2001-01-16 University Of Pittsburgh Screening method for inflammatory diseases using neutrophil defensins and lactoferrin
US20040048861A1 (en) * 2000-02-05 2004-03-11 Guy Bemis Compositions useful as inhibitors of ERK

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6174664B1 (en) * 1997-02-05 2001-01-16 University Of Pittsburgh Screening method for inflammatory diseases using neutrophil defensins and lactoferrin
US20040048861A1 (en) * 2000-02-05 2004-03-11 Guy Bemis Compositions useful as inhibitors of ERK

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALIREZA ABDOLRASOULI ET AL.: 'Persistent urethritis and prostatitis due to Trichomonas vaginalis: A case report' CAN J INFECT DIS MED MICROBIOL vol. 18, no. 5, September 2007, pages 308 - 310 *
HAE JONG KIM ET AL.: 'Expression of human betta-defensin-2 in the prostate' BJUI vol. 107, no. 1, 23 June 2010, pages 144 - 149 *

Also Published As

Publication number Publication date
KR20110085660A (en) 2011-07-27
WO2011090351A3 (en) 2011-12-29
KR101151715B1 (en) 2012-06-15

Similar Documents

Publication Publication Date Title
JP2012526550A (en) Gastric cancer detection marker
JP2019528063A (en) Novel immunoprobe based method for assessing organ damage status through a body fluid based cell free DNA (cfDNA) assay
KR102100588B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
Rahman et al. Elevated troponin: Diagnostic gold or fool's gold?
US20150132764A1 (en) Bag3 as biochemical serum and tissue marker
EP2493496B1 (en) Use of gstp1
US20110039276A1 (en) Identifying organ damage
Mahavadi et al. Inhibition of MLC 20 phosphorylation downstream of Ca 2+ and RhoA: a novel mechanism involving phosphorylation of myosin phosphatase interacting protein (M-RIP) by PKG and stimulation of MLC phosphatase activity
JP6361943B2 (en) Pancreatic cancer diagnostic kit comprising an antibody that specifically binds to complement factor B protein and an antibody that specifically binds to sugar chain antigen 19-9 protein
KR101200194B1 (en) Use of SOCS6 as a hepatocellular carcinomar diagnostic marker
WO2016072464A1 (en) Arteriosclerosis and cancer detection method using deoxyhypusine synthase gene as indicator
WO2011090351A2 (en) Diagnostic method and diagnosing kit for prostatitis
KR101270761B1 (en) Transaldolase, a marker for diagnosing radiation exposure, a composition for diagnosing radiation exposure to measure the level of expression of the marker, a kit for diagnosing radiation exposure comprising the composition, and a method for diagnosing radiation exposure using the marker
EP3155427B1 (en) Methodologies for measuring isopeptidase activity in biological samples in a high throughput manner
US20140357517A1 (en) Radiation exposure diagnostic marker igfbp-5, composition for radiation exposure diagnosis by measuring the expression level of the marker, radiation exposure diagnostic kit comprising the composition, and method for diagnosing radiation exposure using the marker
KR101365206B1 (en) Orai1 as a marker for diagnosing cardiomyopathy
CN103797369A (en) Method for measuring anti-WT1 antibody
KR20200001068A (en) Biomaker composition for diagnosing atrophy
KR102428182B1 (en) How to diagnose heart muscle damage
KR20100127498A (en) Diagnosis of coloncarcinoma using ndrg2
KR20110068695A (en) Biomarkers indicative of ovarian carcinoma and diagnosis using the same
KR101232228B1 (en) Phosphoglycerate kinase1, a marker for diagnosing radiation exposure, a composition for diagnosing radiation exposure to measure the level of expression of the marker, a kit for diagnosing radiation exposure comprising the composition, and a method for diagnosing radiation exposure using the marker
US8088574B2 (en) Poly(A) polymerase
Jonnavithula et al. A Fluorogenic-Based Assay to Measure Chaperone-Mediated Autophagic Activity in Cells and Tissues
WO2011105826A2 (en) Method using camp expression measurement to diagnose prostate inflammation, and diagnostic kit

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11734900

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11734900

Country of ref document: EP

Kind code of ref document: A2