WO2006013561A2 - Compositions and methods for diagnosing and treating post traumatic stress disorder - Google Patents

Compositions and methods for diagnosing and treating post traumatic stress disorder Download PDF

Info

Publication number
WO2006013561A2
WO2006013561A2 PCT/IL2005/000824 IL2005000824W WO2006013561A2 WO 2006013561 A2 WO2006013561 A2 WO 2006013561A2 IL 2005000824 W IL2005000824 W IL 2005000824W WO 2006013561 A2 WO2006013561 A2 WO 2006013561A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
ptsd
group
kit
expression
Prior art date
Application number
PCT/IL2005/000824
Other languages
French (fr)
Other versions
WO2006013561A3 (en
Inventor
Ronnen Segman
Arieh Shalev
Tania Goltser
Nir Friedman
Noa Shefi
Naftali Kaminski
Original Assignee
Yissum Research Development Company Of The Hebrew University Of Jerusalem
Tel Hashomer Medical Research Iinfrastructure And Services Ltd.
Hadasit Medical Research Services And Development Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Company Of The Hebrew University Of Jerusalem, Tel Hashomer Medical Research Iinfrastructure And Services Ltd., Hadasit Medical Research Services And Development Ltd. filed Critical Yissum Research Development Company Of The Hebrew University Of Jerusalem
Publication of WO2006013561A2 publication Critical patent/WO2006013561A2/en
Publication of WO2006013561A3 publication Critical patent/WO2006013561A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to specific gene expression patterns in PBMC of acute and chronic PTSD affected individuals and, more particularly, to methods of predicting and diagnosing PTSD.
  • Post-traumatic stress disorder is a common mental disorder with a lifetime prevalence of 9-14 % (Breslau N. 2001. J. Clin. Psychiatry. 62 Suppl 17: 16-22; Kessler RC et al., 1995. Arch. Gen. Psychiatry 52: 1048-1060; Yehuda, R. 2002. N. Engl. J. Med. 346: 108-14).
  • PTSD results from a maladaptive response to life threatening events such as wars, natural disasters, domestic violence or sexual abuses; when such traumatic events cause psychological bruises beyond the usual corrective ability of the affected individual, PTSD develops.
  • PTSD is characterized by three specific groups of symptoms: intrusive behaviors (including flashbacks and intense physiologic distress), avoidance behaviors (including avoidance of reminders of the trauma and numbing of responsiveness), and hyperarousal (including insomnia and an exaggerated startle response).
  • intrusive behaviors including flashbacks and intense physiologic distress
  • avoidance behaviors including avoidance of reminders of the trauma and numbing of responsiveness
  • hyperarousal including insomnia and an exaggerated startle response.
  • Many trauma survivors exhibit PTSD symptoms at the early aftermath of traumatic events (e.g., 94 % of rape victims), with marked variability in terms of severity and persistence of each of the symptom clusters.
  • Twin studies have suggested that each of the clusters of symptoms possesses a distinct genetic basis and represent discrete biological dimensions (True WR, et al. 1993. Arch. Gen. Psychiatry, 50: 257-264).
  • PTSD While early symptoms are often transient, a significant number of survivors remain highly symptomatic, exhibiting the full persisting clinical disorder.
  • the diagnosis of acute PTSD is made if the intrusion, avoidance and hyperarousal cause significant clinical impairments which last for more than a month. On the other hand, if such symptoms last for a period of 2-30 days, a diagnosis of acute stress disorder is made.
  • Chronic PTSD is diagnosed if sufficiently severe symptoms in all 3 clusters are still apparent three or more months after trauma (DSM-IV, American Psychiatric Association).
  • PTSD are associated with activation of immune genes (Aloe L, et al., 1994. Proc Natl
  • PBMC peripheral blood monocyte cells
  • kits for determining predisposition of a subject to develop PTSD comprising at least 10 and no more than 574 polynucleotides wherein each of the polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
  • an agent for the manufacture of a kit for determining predisposition to develop PTSD comprising at least 10 and no more than 574 polynucleotides wherein each of the polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
  • kits for diagnosing PTSD in a subject comprising at least 10 and no more than 408 polynucleotides wherein each of the polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523,
  • an agent for the manufacture of a kit for diagnosing PTSD comprising at least 10 and no more than 408 polynucleotide sequences wherein each of the polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474
  • a microarray comprising at least 10 and no more than 904 oligonucleotides wherein each of the oligonucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-904.
  • a method of diagnosing PTSD in a subject comprising obtaining a cell sample from the subject and detecting in the cell sample the level of expression of at least 10 and no more than 408 polynucleotide sequences wherein each of the polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397
  • a method of determining predisposition of a subject to develop PTSD comprising obtaining a cell sample from the subject and detecting in the cell sample the level of expression of at least 10 and no more than 574 polynucleotide sequences wherein each of the polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 1-574.
  • a method of preventing PTSD in an individual predisposed to PTSD comprising regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 thereby preventing PTSD in the individual.
  • an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 for the manufacture of a medicament identified for preventing PTSD.
  • a method of treating PTSD in an individual suffering from PTSD comprising regulating an expression level of at least one gene selected from the group consisting of
  • each of the polynucleotides is selected from the group consisting of an oligonucleotide molecule, a cDNA molecule, a genomic molecule and an RNA molecule. According to still further features in the described preferred embodiments each of the polynucleotides is at least 10 and no more than 50 nucleic acids in length.
  • each of the polynucleotides is bound to a solid support.
  • the kit further comprising at least one reagent suitable for detecting hybridization of the polynucleotides and at least one RNA transcript.
  • the kit further comprising packaging materials packaging the at least one reagent and instructions of using the kit in determining predisposition of the subject to develop PTSD.
  • the kit further comprising packaging materials packaging the at least one reagent and instructions of using the kit in diagnosing PTSD in the subject.
  • each of the oligonucleotides is at least 10 and no more than 40 nucleic acids in length.
  • the cell sample is derived from a blood cell sample.
  • the subject has experienced a traumatic event.
  • the traumatic event is caused by a war, a natural disaster, a domestic violence and/or a sexual abuse.
  • detecting is effected at least one month following the traumatic event.
  • detecting is effected within 1-4 months following the traumatic event. According to still further features in the described preferred embodiments detecting is effected within 0.15-24 hours following the traumatic event.
  • detecting is effected within 45-200 minutes following the traumatic event.
  • regulating is upregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:2-5, 7-
  • upregulating is effected by at least one approach selected from the group consisting of: (a) expressing in cells of the individual an exogenous polynucleotide encoding the at least one gene; (b) increasing expression of the at least one gene in the individual; (c) increasing endogenous activity of the at least one gene product in the individual; (d) introducing an exogenous polypeptide including at least a functional portion of the at least one gene product to the individual; (e) administering cells expressing the at least one gene into the individual.
  • upregulating is effected by an agent selected from the group consisting of: (a) an exogenous polynucleotide encoding the at least one gene; (b) an agent capable of increasing expression of the at least one gene; (c) an agent capable of increasing endogenous activity of the at least one gene product; (d) an exogenous polypeptide including at least a functional portion of the at least one gene product; (e) cells expressing the at least one gene.
  • an agent selected from the group consisting of: (a) an exogenous polynucleotide encoding the at least one gene; (b) an agent capable of increasing expression of the at least one gene; (c) an agent capable of increasing endogenous activity of the at least one gene product; (d) an exogenous polypeptide including at least a functional portion of the at least one gene product; (e) cells expressing the at least one gene.
  • regulating is downregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 1, 6, 14, 17, 22, 24, 25, 32, 33, 43, 54, 59, 61, 69, 70, 72, 74, 76, 88, 97, 105, 112, 114, 120, 121, 122, 125, 135, 136, 137, 140, 143, 150, 156, 158, 160, 163, 167, 180, 187, 191, 199, 205, 222, 235, 251, 265, 267, 304, 318, 319, 326, 327, 328, 339, 354, 356, 368, 369, 374, 375, 382, 385, 398, 401, 402, 406, 409, 412, 413, 414, 423, 424, 426, 439, 441, 469, 472, 474, 478, 480
  • downregulating is effected by an agent selected from the group consisting of: (a) a molecule which binds the at least one gene and/or a gene product thereof; (b) an enzyme which cleaves the at least one gene product; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoded by the at least one gene; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoded by the at least one gene; (e) a DNAzyme which specifically cleaves an mRNA transcript or DNA sequence of the at least one gene; (f) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoded by the at least one gene; (g) a non-functional analogue of at least a catalytic or binding portion of the at least one gene product; (h) a molecule which prevents the at least one gene product activation
  • introducing is effected via systemic administration of the agent.
  • regulating is upregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:7, 10, 12, 18, 20, 35, 62, 79, 81, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320 ,331, 342, 344, 348, 352, 372, 376, 377, 378 ,383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 475, 483, 504, 505, 523, 526, 531, 559, 561, 563, 565, 570, 575-581, 585- 591, 593, 5
  • regulating is downregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:17, 88, 327, 474, 530, 582-584, 592, 594-596, 603, 606, 613, 614, 618, 620, 621, 624-626, 629, 630, 634, 637, 638, 641, 642, 644-646, 649, 653-655, 663, 665, 669-671, 673, 678, 680, 681, 683-685, 688, 689, 691, 704, 705, 709-711, 716, 717, 720, 721, 728, 729, 732, 733, 735, 736, 741, 743, 745, 753, 756, 758, 764, 771, 774, 776, 779, 782, 786, 787, 789, 791, 792
  • the agent is formulated for systemic administration.
  • the present invention successfully addresses the shortcomings of the presently known configurations by providing methods of diagnosing and treating PTSD.
  • FIGs. la-h illustrate changes in expression profiles of genes following trauma.
  • Figures la-c show unsupervised hierarchical clustering of expression profiles of 4512 active genes in peripheral blood monocyte cells (PBMCs) drawn from trauma survivors.
  • Figure Ia all subjects;
  • Figure Ib one hour following a trauma;
  • Figure Ic four months following a trauma.
  • Columns correspond to samples and rows correspond to genes;
  • Control M4 subjects who did not meet any formal PTSD criterion at one and four months following a trauma.
  • Figure Id-f are overabundance plots depicting the number of genes differentiating PTSD from control samples.
  • Figure Id all subjects; Figure Ie - one hour following a trauma; Figure If - four months following a trauma.
  • Observed plot observed abundance of genes separating PTSD and control samples;
  • Expected by chance average number of separating genes, accepted under the null-hypothesis.
  • Figures lg-h are supervised expression profiles depicting the confidence of the classification algorithm along with the expression signature of most significant (p ⁇ 0.05) separating genes. Note the correct classification of 8 out of 9 samples drawn four months following a trauma ( Figure Ig), and 9 out of 11 samples drawn at the ER ( Figure Ih).
  • FIGs. 2a-l depict the correlation between the level of gene expression at four month following a trauma and the continuous Impact of Event Scale (IES) scores.
  • the expression level of various genes was determined in blood samples drawn at four months following a trauma, and was correlated with IES scores which were assessed four months following trauma exposure among all 24 survivors, regardless of the clinical designation above or bellow the threshold for formal PTSD diagnosis. Shown are the IES scores ( Figures 2a, d, g, and i), the level of gene expression ( Figures 2b, e, h, and k) and the Pearson correlation (p ⁇ 0.05) between the IES scores and the level of gene expression ( Figures 2c, f, i, and 1) of 18 available M4 samples exhibiting significant correlations.
  • FIGs. 3a-l depict the correlation between the level of gene expression as determined immediately following a trauma and the continuous Impact of Event Scale (IES) scores.
  • IES Event Scale
  • FIGs. 3a, d, g, and i Shown are the IES scores ( Figures 3a, d, g, and i), the level of gene expression ( Figures 3b, e, h, and k) and the Pearson correlation (p ⁇ 0.05) between the IES scores and the level of gene expression ( Figures 3c, f, i, and 1) of 15 available ER samples exhibiting significant correlations.
  • the significance of the number of correlated genes (p-value) and Pearson correlations were performed as described in Figures 2a-l. Note the significant correlation of the total IES scores (Figure 3c), avoidance (Figure 3f), intrusive memories (Figure 3i), and increased autonomic arousal (Figure 31) with the level of gene expression.
  • FIG. 4a-c illustrate functional groups among informative genes of transcripts differentiating consistent phenotype transcripts.
  • Figure 4a detailed expression profiles of several functional groups among acute PTSD (ER), chronic PTSD (M4), or subjects which did not meet any formal PTSD criterion immediately following a trauma (Control ER) or four months following a trauma (Control M4);
  • Figure 4b averaged over - or under - expression following trauma; Note the marked overall decreased expression of genes coding for transcription enhancers, regulators of protein biosynthesis, protein degradation and cell proliferation following trauma.
  • Figure 4c the frequency of gene ontology annotation among genes differentiating PTSD from control subjects (PTSD vs. Control) as compared with the total active genes on the chip (background). Note the significant increased representation (p ⁇ 0.0005) of genes involved in RNA metabolism or processing and nucleotide metabolism among the genes differentiating PTSD from control subjects.
  • FIGs. 5a-c illustrate the expression profile of genes co-expressed in neural and endocrine tissues following trauma.
  • Figure 5a detailed expression profiles of genes known to be co-expressed in neural and neuroenocrine tissues among subjects who had a definitive clinical diagnosis at both one and four months following a trauma;
  • Figure 5b - averaged over - or under - expression following trauma of genes known to be co- expressed in areas mediating stress reactivity;
  • Figure 5c the frequency of genes known to be co-expressed in areas mediating stress reactivity among the genes differentiating PTSD from control subjects (PTSD vs. Control) or the total active genes on the chip (background).
  • the present invention is of genes differentially expressed in PTSD affected subjects which can be used in determining predisposition to and/or diagnosing PTSD. Specifically, the present invention can be used in preventing and/or treating PTSD by regulating the expression level of the PTSD differentially expressed genes.
  • Post-traumatic stress disorder is a common mental disorder affecting individuals who experienced a life-threatening traumatic event. At the early aftermath of a traumatic event, many trauma survivors exhibit characteristic symptoms of intrusion, avoidance, and hyperarousal.
  • PTSD is usually treated with psychological interventions and psychotropic drugs aimed at reducing symptoms of anxiety and depression.
  • anti-depressant and anti anxiety drugs include serotonin reuptake inhibitors (e.g., fluoxetine, paroxetine, sertraline), atypical antidepressant drugs (e.g. trazodone, nefazodone) and anticonvulsant agents (e.g., gabapentin).
  • serotonin reuptake inhibitors e.g., fluoxetine, paroxetine, sertraline
  • atypical antidepressant drugs e.g. trazodone, nefazodone
  • anticonvulsant agents e.g., gabapentin
  • PTSD refers to post traumatic stress disorder, an anxiety disorder developing following serious traumatic events and characterized by symptoms of intrusion (i.e., re-experiencing or "flash-backs" of the trauma), avoidance (i.e., numbness, diminished emotions and lack of involvement with reality) and hyperarousal (i.e., being constantly threatened by the trauma, irritable or explosive, and having trouble in concentrating or remembering current information).
  • determining predisposition refers to determining susceptibility to develop a disorder.
  • a subject with a predisposition to develop a disorder is more likely to develop the disorder than a non-predisposed subject.
  • the term "subject” includes both young and old human beings of both sexes. Preferably, this term encompasses individuals who experienced a serious traumatic event and are therefore at risk of developing PTSD. Examples include, but are not limited to rape victims, subjects who experienced wars, terror attacks, motor vehicle accidents, natural disasters such as earthquakes, and the like. According to this aspect of the present invention the term “subject” also encompasses individuals who are at risk of being exposed to a traumatic event due to involvement in life-threatening assignments. Examples include, but are not limited to, soldiers, policemen and the like.
  • the method according to this aspect of the present invention is effected by detecting in a cell sample of the subject the level of expression of at least 10 and no more than 574 polynucleotide sequences, wherein each of the polynucleotide sequences is at least 80 % identical to a specific polynucleotide of the set of polynucleotides set forth by
  • the method is preferably effected by detecting the expression level of at least 10 and no more than 127 polynucleotide sequences corresponding to the set of polynucleotides including SEQ ID NOs:4, 7, 24, 27, 28, 29, 36, 37, 42, 46, 51, 53, 62, 64,
  • the phrase "at least 80 % identical" refers to homologous polynucleotide sequences which are at least 80 %, more preferably, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, more preferably at least 99 %, most preferably, 100 % identical to at least one of the polynucleotides of the present invention as determined using the BlastN software of the National Center of Biotechnology Information (NCBI) using default parameters.
  • NCBI National Center of Biotechnology Information
  • the phrase "level of expression” refers to the degree of gene expression and/or gene product activity in a specific tissue or cell sample.
  • up-regulation or down-regulation of various genes can affect the level of the gene product (i.e., RNA and/or protein) in a specific tissue or cell sample.
  • detecting the level of expression of the polynucleotide sequences of the present invention is effected using RNA or protein molecules which are extracted from a cell sample of the subject.
  • RNA or protein molecules from cell samples (e.g., skin, blood, or bone marrow samples) are well known in the art.
  • RNA or protein molecules are preferably characterized for the expression and/or activity level of various RNA and/or protein molecules using methods known in the arts.
  • Northern Blot analysis This method involves the detection of a particular RNA in a mixture of RNAs.
  • An RNA sample is denatured by treatment with an agent (e.g., formaldehyde) that prevents hydrogen bonding between base pairs, ensuring that all the RNA molecules have an unfolded, linear conformation.
  • the individual RNA molecules are then separated according to size by gel electrophoresis and transferred to a nitrocellulose or a nylon-based membrane to which the denatured RNAs adhere.
  • the membrane is then exposed to labeled DNA probes.
  • Probes may be labeled using radio ⁇ isotopes or enzyme linked nucleotides. Detection may be using autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of particular RNA molecules and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the gel during electrophoresis.
  • RNA molecules are purified from the cells and converted into complementary DNA (cDNA) using a reverse transcriptase enzyme (such as an MMLV-
  • PCR amplification reaction is carried out in a PCR machine.
  • Those of skills in the art are capable of selecting the length and sequence of the gene specific primers and the PCR conditions ⁇ i.e., annealing temperatures, number of cycles and the like) which are suitable for detecting specific
  • RNA molecules RNA molecules. It will be appreciated that a semi-quantitative RT-PCR reaction can be employed by adjusting the number of PCR cycles and comparing the amplification product to known controls.
  • RNA in situ hybridization stain DNA or RNA probes are attached to the RNA molecules present in the cells.
  • the cells are first fixed to microscopic slides to preserve the cellular structure and to prevent the RNA molecules from being degraded and then are subjected to hybridization buffer containing the labeled probe.
  • the hybridization buffer includes reagents such as formamide and salts (e.g., sodium chloride and sodium citrate) which enable specific hybridization of the DNA or RNA probes with their target mRNA molecules in situ while avoiding non-specific binding of probe.
  • formamide and salts e.g., sodium chloride and sodium citrate
  • RT-PCR reverse transcriptase polymerase chain reaction
  • Pathol Res Pract. 1994, 190: 1017-25 the RT-PCR reaction is performed on fixed cells by incorporating labeled nucleotides to the PCR reaction.
  • the reaction is carried on using a specific in situ RT-PCR apparatus such as the laser-capture microdissection PixCell I LCM system available from Arcturus Engineering (Mountainview, CA).
  • Oligonucleotide microarray In this method oligonucleotide probes capable of specifically hybridizing with the polynucleotides of the present invention are attached to a solid surface (e.g., a glass wafer). Each oligonucleotide probe is of approximately 20- 25 nucleic acids in length.
  • a specific cell sample e.g., blood cells
  • RNA is extracted from the cell sample using methods known in the art (using e.g., a TRIZOL solution, Gibco BRL, USA).
  • Hybridization can take place using either labeled oligonucleotide probes (e.g., 5'- biotinylated probes) or labeled fragments of complementary DNA (cDNA) or RNA (cRNA).
  • labeled oligonucleotide probes e.g., 5'- biotinylated probes
  • cDNA complementary DNA
  • cRNA RNA
  • double stranded cDNA is prepared from the RNA using reverse transcriptase (RT) (e.g., Superscript II RT), DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, MD, USA).
  • RT reverse transcriptase
  • DNA ligase DNA polymerase I
  • the double stranded cDNA is subjected to an in vitro transcription reaction in the presence of biotinylated nucleotides using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo, Diagnostics, Affymetix Santa Clara CA).
  • the labeled cRNA can be fragmented by incubating the RNA in 40 mM Tris Acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate for 35 minutes at 94 °C.
  • the microarray is washed and the hybridization signal is scanned using a confocal laser fluorescence scanner which measures fluorescence intensity emitted by the labeled cRNA bound to the probe arrays.
  • a confocal laser fluorescence scanner which measures fluorescence intensity emitted by the labeled cRNA bound to the probe arrays.
  • each gene on the array is represented by a series of different oligonucleotide probes, of which, each probe pair consists of a perfect match oligonucleotide and a mismatch oligonucleotide.
  • Enzyme linked immunosorbent assay This method involves fixation of a sample (e.g., fixed cells or a proteinaceous solution) containing a protein substrate to a surface such as a well of a microtiter plate. A substrate specific antibody coupled to an enzyme is applied and allowed to bind to the substrate.
  • Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody.
  • Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced. A substrate standard is generally employed to improve quantitative accuracy.
  • Western blot This method involves separation of a substrate from other protein by means of an acrylamide gel followed by transfer of the substrate to a membrane (e.g., nylon or PVDF). Presence of the substrate is then detected by antibodies specific to the substrate, which are in turn detected by antibody binding reagents.
  • Antibody binding reagents may be, for example, protein A, or other antibodies. Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.
  • Radio-immunoassay In one version, this method involves precipitation of the desired protein (i.e., the substrate) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I 125 ) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of substrate.
  • a specific antibody and radiolabeled antibody binding protein e.g., protein A labeled with I 125
  • a labeled substrate and an unlabelled antibody binding protein are employed.
  • a sample containing an unknown amount of substrate is added in varying amounts.
  • the decrease in precipitated counts from the labeled substrate is proportional to the amount of substrate in the added sample.
  • Fluorescence activated cell sorting This method involves detection of a substrate in situ in cells by substrate specific antibodies.
  • the substrate specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.
  • Immunohistochemical analysis This method involves detection of a substrate in situ in fixed cells by substrate specific antibodies.
  • the substrate specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain.
  • In situ activity assay According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.
  • In vitro activity assays In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non- denaturing acrylamide gel (i.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.
  • the cell sample used by the present invention can be any cell sample obtained from the subject or subject tissues. Examples include, but are not limited to blood cells, skin cells, bone marrow cells and the like. Methods of obtaining blood, bone marrow and/or epithelial cell samples from an individual are well known in the art.
  • the cell sample is a PBMC sample.
  • a sample can be obtained by drawing ten ml of blood by venipuncture (using EDTA as an anticoagulant) and separating the PBMCs from the blood sample using Histopaque solution gradient (Sigma-Aldrich, USA).
  • predisposition of a subject to develop PTSD can be detected at any time (e.g., prior to participation in a life-threatening assignment or following a traumatic event).
  • the predisposition of a subject to develop PTSD is detected in the cell sample of the subject shortly after a traumatic event, i.e., within 0.15-24 hours of a traumatic event, more preferably, within 0.3-22 hours, more preferably, within 0.5-18 hours, more preferably, within 0.5-10 hours, more preferably, within 0.5-5 hours, more preferably, within 45-200 minutes of a traumatic event.
  • the expression level of the polynucleotide sequences of the present invention can be correlated with the level of expression of PTSD affected individuals as shown in Table 2 and Figures Ia, b, e, and g, and Example 2 of the Examples section which follows and a differential expression of at least some or preferably all of the 574 genes described above is indicative of increased predisposition risk of the individual to develop PTSD.
  • the teachings of the present invention can be used to determine if an individual is predisposed to PTSD. Briefly, 45-200 minutes following a traumatic event a blood sample is obtained from the trauma survivor and PBMCs are isolated using, for example, the Histopaque solution gradient (Sigma-Aldrich, USA). Isolated PBMCs are immediately subjected to RNA extraction using e.g., a TRIZOL solution (Gibco BRL, USA), following which double stranded cDNA is prepared using e.g., Superscript II RT, DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, MD, USA).
  • a blood sample is obtained from the trauma survivor and PBMCs are isolated using, for example, the Histopaque solution gradient (Sigma-Aldrich, USA). Isolated PBMCs are immediately subjected to RNA extraction using e.g., a TRIZOL solution (Gib
  • labeled cRNA e.g., using biotin
  • cRNA is prepared in vitro from the double stranded cDNA [using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo)], and further fragmented as described above for 35 minutes at 94 0 C.
  • Hybridization is performed on an array of approximately 120-130 oligonucleotides, each of approximately 20-25 nucleic acids in length, which are capable of specifically hybridizing to the polynucleotides listed in Table 2 which exhibit a p-value of less than 0.047.
  • the arrays are washed to remove access of unbound cRNA probes and the hybridization signals are scanned using for example, the GeneArray scanner G2500A (Hewlett Packard).
  • the scanned images are analyzed using e.g., the Microarray Suite software No. 5 and the level of gene expression is determined in arbitrary units.
  • the observed expression pattern is then compared to the expression pattern of PTSD affected individuals as illustrated in Table 2 and a differential expression of at least some or preferably all of the 574 genes described above is indicative of increased predisposition risk of the individual to develop PTSD.
  • the reagents utilized by the method of determining predisposition to develop PTSD according to the present invention and which are described hereinabove can form a part of a kit.
  • kits for determining predisposition of a subject to develop PTSD includes at least 10 and no more than 574 polynucleotides, each of which can specifically bind at least one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
  • the polynucleotides used by the kit of the present invention can be naturally occurring or synthetic polynucleotides such as oligonucleotides, RNA molecules, genomic DNA molecules, cDNA molecules and/or cRNA molecules.
  • the polynucleotides used by the kit of present invention are of at least 10 and no more than 50 nucleic acids in length, more preferably, at least 15 and no more than 45, more preferably, between 15-40, more preferably, between 20-35, more preferably, between
  • polynucleotides can be bound to a solid support e.g., a glass wafer in a specific order, i.e., in the form of a microarray.
  • oligonucleotides of an array can be synthesized directly on the solid support using well known prior art approaches (Seo TS, et al., 2004, Proc. Natl. Acad. Sci. USA, 101: 5488-93.).
  • the oligonucleotides are attached to the support in a location specific manner such that each specific oligonucleotide has a specific address on the support ⁇ i.e., an addressable location) which denotes the identity ⁇ i.e., the sequence) of that specific oligonucleotide.
  • the kit includes a microarray of 10-574 oligonucleotides, each of 20-25 nucleic acids in length, which correspond to the 574 polynucleotide sequences described hereinabove and which are listed in Table 2.
  • a kit includes 120-130 oligonucleotides corresponding to the polynucleotide sequences exhibiting a p-value of less than 0.047 as listed in Table 2 and described hereinabove.
  • Table 1 Gene expression level in M4 samples
  • Table 1 Differentially expressed genes in PTSD subjects at 4 months following a trauma are presented ( ⁇ Affymetrix ID NO.>_at_ ⁇ GeneBank Accession No.>) along with the normalized gene expression values in each study subject and the overall regulation of gene expression (Expres), i.e., upregulation (Up) or Downregulation (Down) in PTSD subjects as compared with control subjects. P- values represent the significance of the changes in gene expression between PTSD subjects and controls.
  • Table 2 Differentially expressed genes in PTSD subjects immediately following a trauma are presented ( ⁇ Affymetrix ID NO>_at_ ⁇ GeneBank Accession No.>) along with the normalized gene expression values in each study stubject and the overall regulation of gene expression (Expres), i.e., Upregulation (Up) or Downregulation (Down) in PTSD subjects as compared with control subjects. P-values represent the significance of the changes in gene expression between PTSD subjects and controls.
  • Table 3 Description of PTSD differentiating gene
  • Table 3 Differentially expressed genes in PTSD at the ER and four months following a trauma are presented ( ⁇ Affymetrix ID NO.>_at_ ⁇ GeneBank Accession No.>) along with the gene description.
  • the kit further includes at least one reagent as described hereinabove which is suitable for hybridization of the polynucleotides and at least one RNA transcript.
  • reagents include, but are not limited to formam ⁇ de, sodium chloride, and sodium citrate.
  • the kit further comprising packaging material packaging at least one reagent and a notification in or on the packaging material. Such a notification identifies the kit for use in determining predisposition to PTSD in the subject.
  • the kit also includes the appropriate instructions for use and labels indicating FDA approval for use in vitro.
  • the method and kit of determining predisposition to develop PTSD can be used to determine suitability of individuals who experienced a life threatening traumatic event and exhibit symptoms of acute stress disorder to an anti-PTSD treatment. This is of particular importance since current anti-PTSD treatment regimens include antidepressant, anxiolytic or antipsychotic agents which may often result in severe side effects such as sedation, tiredness, movement problems, weight gain, excessive salivation and dizziness. As a result, in some cases such a treatment is employed on individuals which are unlikely to develop chronic PTSD. On the other hand, in other cases, such a treatment is withheld from individuals which are at risk of developing chronic PTSD but are mis-diagnosed.
  • a method of diagnosing PTSD in a subject refers to determining the existence of a disease, which generally involves the evaluation of a patient's medical history, clinical symptoms and laboratory test results.
  • Methods of diagnosing PTSD are known in the art and include, for example, the Clinician Administered PTSD Scale (CAPS, Blake DD, et al. 1990; Behavior Therapist 13:187 -188), a structured clinical interview following the DSM IV diagnostic criteria for PTSD [Diagnostic and Statistical Manual of Mental Disorders - Fourth Edition (DSM-IV), The American Psychiatric Association, Washington D.C., 1994].
  • PTSD symptoms can be assessed using the Revised Impact of Events Scale (IES; Horowitz, M., et al., 1979; Psychosom. Med. 41: 209-218; Weiss DS and Marmar CR. The Impact of Event Scale-Revised. In Wilson JP, Keane TM Eds. Assessing Psychological Trauma and PTSD. New York, Guilford Press 1997:399- 411).
  • the diagnosis of PTSD is made if the symptoms of arousal, intrusion and avoidance which are described hereinabove last for more than one month. It will be appreciated that in cases where such symptoms last for less than a month, the diagnosis of acute stress disorder is made.
  • the method is effected by detecting in a cell sample of the subject the expression level of at least 10 and no more than 408 polynucleotide sequences, each of which being at least 80 % identical to at least one specific polynucleotide from the set of polynucleotides set forth by SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 5
  • the method is preferably effected by detecting the expression level of at least 10 and no more than 273 polynucleotides of a set including SEQ ID NOs: 17, 582, 583, 584, 595, 596, 606, 613, 614, 620 ,624, 626, 629, 634, 637, 638, 642, 644, 645, 646, 653, 655, 663, 669, 670, 671, 678, 680, 681, 684, 685, 688, 689, 710, 711, 717, 721, 728, 735, 736, 741, 743, 753, 756, 327, 771, 774, 779, 782, 786, 787, 789, 791, 792, 794, 795, 808, 811, 814,
  • detecting the level of expression is preferably performed within a time period of 1-4 months following a traumatic event, more preferably, 2-4 months, more preferably, 3-4 months, most preferably, 4 months following a traumatic event.
  • the method according to this aspect of the present invention can be used to diagnose PTSD in an individual which has experienced a traumatic event such as a motor car accident or act of terror. Briefly, four months following the traumatic event, a blood sample is drawn from the individual and the expression pattern of approximately 273 polynucleotide sequences which are listed in Table 1 and exhibit a p-value of less than
  • 0.016 is determined for RNA molecules obtained from PBMCs, essentially as described hereinabove. The observed expression pattern is then compared to the expression pattern of PTSD affected individuals as illustrated in Table 1. Differential expression of at least some and preferably all of the 408 gene transcripts described above is indicative of positive PTSD diagnosis in the individual.
  • Such a kit includes at least 10 and no more than 408 polynucleotides as described hereinabove.
  • preventing refers to avoiding the progression of chronic PTSD.
  • the phrase "an individual predisposed to PTSD” refers to any individual as described hereinabove which is likely to develop chronic PTSD. It will be appreciated that the phrase “an individual predisposed to PTSD” encompasses also an individual which is identified as predisposed to PTSD according to the teachings of the present invention.
  • the method is effected by regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 thereby preventing PTSD in the individual.
  • regulating refers to upregulating (i.e., increasing) or downregulating (i.e., inhibiting or decreasing) of the expression and/or activity of at least one gene as mentioned hereinabove.
  • regulating is upregulating the expression level and/or an activity of at least one gene and/or gene product thereof selected from the group consisting of SEQ ID NOs: 2-5, 7-13, 15, 16, 18- 21, 23, 26-31, 34-42, 44-53, 55-58, 60, 62-68, 71, 73, 75, 77-87, 89-96, 98-104, 106-111, 113, 115-119, 123, 124, 126-134, 138, 139, 141, 142, 144-149, 151-155, 157, 159, 161, 162, 164-166, 168-179, 181-186, 188-190, 192-198, 200-204, 206-221, 223-234, 236- 250, 252-264, 266, 268-303, 305-317, 320-325, 329-338, 340-353, 355, 357-367, 370- 373, 376-381, 383, 384,
  • Upregulation of the downregulated gene of the present invention can be effected at the genomic level (i.e., activation of transcription via promoters, enhancers, regulatory elements), at the transcript level (i.e., correct splicing, polyadenylation, activation of translation) or at the protein level (i.e., post-translational modifications, interaction with substrates and the like).
  • An agent capable of upregulating expression level of the downregulated gene of the present invention may be an exogenous polynucleotide sequence designed and constructed to express at least a functional portion of the downregulated gene protein.
  • a polynucleotide sequence encoding the downregulated gene of the present invention [(e.g., GenBank Accession number AF065482 (SEQ ID NO:7) or AB020658 (SEQ ID NO: 12)] is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
  • a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
  • nucleic acid construct of the present invention can also utilize sequences which are homologous to the downregulated gene of the present invention, i.e., at least 80 % identical as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals —9.
  • Constitutive promoters suitable for use with the present invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).
  • Inducible promoters suitable for use with the present invention include for example the tetracycline-inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
  • the nucleic acid construct (also referred to herein as an "expression vector") of the present invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N. Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
  • Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation of the downregulated gene of the present invention.
  • Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
  • Termination and polyadenylation signals that are suitable for the present invention include those derived from SV40.
  • the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • the expression vector of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
  • IRS internal ribosome entry site
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
  • SV40 vectors include pSVT7 and pMT2.
  • Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5.
  • exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms.
  • viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the type of vector used by the present invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
  • Recombinant viral vectors are useful for in vivo expression of the downregulated gene of the present invention since they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
  • upregulation of the downregulated gene of the present invention can be also effected by administration of cells expressing the downregulated gene of the present invention into the individual.
  • Cells expressing the downregulated gene of the present invention can be any suitable cells, such as bone marrow stem cells, mesenchymal stem cells, lymphocyte cells, neural stem cells, and/or endocrine stem cells which are derived from the individuals and are transfected ex vivo with an expression vector containing the polynucleotide designed to express the downregulated gene of the present invention as described hereinabove.
  • Administration of the cells expressing the downregulated gene of the present invention can be effected using any suitable route such as intravenous, intra peritoneal, and intra-spinal.
  • Cells expressing the downregulated gene of the present invention can be derived from either autologous sources such as self bone marrow cells or from allogeneic sources such as bone marrow or other cells derived from non-autologous sources. Since non- autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non- autologous cells. These include either suppressing the recipient immune system or encapsulating the non-autologous cells or tissues in immunoisolating, semipermeable membranes before transplantation. Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludagj H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64).
  • microcapsules Methods of preparing microcapsules are known in the arts and include for example those disclosed by Lu MZ, et al., Cell encapsulation with alginate and alpha- phenoxycinnamylidene-acetylated poly(allylamine). Biotechnol Bioeng. 2000, 70: 479- 83, Chang TM and Prakash S. Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms. MoI Biotechnol. 2001, 17: 249-60, and Lu MZ, et al., A novel cell encapsulation method using photosensitive poly(allylamine alpha- cyanocinnamylideneacetate). J Microencapsul. 2000, 17: 245-51.
  • microcapsules are prepared by complexing modified collagen with a ter-polymer shell of 2-hydroxyethyl methylacrylate (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA), resulting in a capsule thickness of 2-5 ⁇ m.
  • HEMA 2-hydroxyethyl methylacrylate
  • MAA methacrylic acid
  • MMA methyl methacrylate
  • Such microcapsules can be further encapsulated with additional 2-5 ⁇ m ter-polymer shells in order to impart a negatively charged smooth surface and to minimize plasma protein absorption (Chia, S.M. et al. Multi-layered microcapsules for cell encapsulation Biomaterials. 200223: 849-56).
  • microcapsules are based on alginate, a marine polysaccharide (Sambanis, A. Encapsulated islets in diabetes treatment. Diabetes Thechnol. Ther. 2003, 5: 665-8) or its derivatives.
  • microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guanidine) hydrochloride in the presence of calcium chloride.
  • An agent capable of upregulating the downregulated gene of the present invention may also be any compound which is capable of increasing the transcription, translation and/or activity of an endogenous DNA, mRNA or protein encoded by the downregulated gene of the present invention and thus increasing endogenous activity of the downregulated gene of the present invention.
  • An agent capable of upregulating the downregulated gene of the present invention may also be an exogenous polypeptide including at least a functional portion (as described hereinabove) of the downregulated gene of the present invention.
  • regulating is downregulating an expression level and/or an activity of at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 1, 6, 14, 17, 22, 24, 25, 32, 33, 43, 54, 59, 61, 69, 70, 72, 74, 76, 88, 97, 105, 112, 114, 120, 121, 122, 125,
  • Downregulation of the upregulated gene of the present invention can be effected on the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation (e.g., antisense, siRNA, Ribozyme, DNAzyme), or on the protein level using e.g., antagonists, enzymes that cleave the polypeptide and the like.
  • an agent capable of downregulating the upregulated gene of the present invention is an antibody or antibody fragment capable of specifically binding the upregulated gene of the present invention.
  • the antibody specifically binds at least one epitope of the upregulated gene of the present invention.
  • epitope refers to any antigenic determinant on an antigen to which the paratope of an antibody binds.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • antibody as used in this invention includes intact molecules as well as functional fragments thereof, such as Fab, F(ab')2, and Fv that are capable of binding to macrophages.
  • These functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of
  • Antibody fragments according to the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.
  • Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
  • antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5 S fragment denoted F(ab')2.
  • This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage ⁇ of disulfide linkages, to produce 3.5S Fab' monovalent fragments.
  • a thiol reducing agent optionally a blocking group for the sulfhydryl groups resulting from cleavage ⁇ of disulfide linkages
  • an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly.
  • Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Nat'l Acad. Sci. USA 69:2659-62 (1972O].
  • the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde.
  • the Fv fragments comprise VH and VL chains connected by a peptide linker.
  • These single-chain antigen binding proteins are prepared by constructing a structural gene comprising DNA sequences encoding the VH and VL domains connected by an oligonucleotide. The structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
  • CDR peptides (“minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)].
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et ah, Nature, 321:522-525 (1986); Riechmann et al, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
  • Fc immunoglobulin constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co- workers [Jones et al, Nature, 321:522-525 (1986); Riechmann et al, Nature 332:323-327 (1988); Verhoeyen et al, Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. MoI. Biol., 227:381 (1991); Marks et al, J. MoI. Biol., 222:581 (1991)]. The techniques of Cole et a ⁇ . and Boerner et al.
  • human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
  • RNA interference is a two step process.
  • the first step which is termed as the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA), probably by the action of Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which processes (cleaves) dsRNA (introduced directly or via a transgene or a virus) in an ATP- dependent manner.
  • nt nucleotide
  • siRNA small interfering RNAs
  • RNA 19-21 bp duplexes (siRNA), each with 2-nucleotide 3' overhangs [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); and Bernstein Nature 409:363-366 (2001)].
  • the siRNA duplexes bind to a nuclease complex to from the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • An ATP-dependent unwinding of the siRNA duplex is required for activation of the RISC.
  • the active RISC targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); Hammond et al. (2001) Nat. Rev. Gen. 2:110-119 (2001); and Sharp Genes. Dev. 15:485-90 (2001)].
  • each RISC contains a single siRNA and an RNase [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)].
  • RNAi molecules suitable for use with the present invention can be effected as follows. First, the mRNA sequence of the upregulated gene of the present invention is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites.
  • UTRs untranslated regions
  • UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl, T. 2001, ChemBiochem. 2:239-245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5' UTR mediated about 90 % decrease in cellular GAPDH mRNA and completely abolished protein level (www.ambion.com/techlib/tn/91/912.html).
  • potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov/BLAST/). Putative target sites which exhibit significant homology to other coding sequences are filtered out. Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction.
  • Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
  • Another agent capable of downregulating the upregulated gene of the present invention is a DNAzyme molecule capable of specifically cleaving an mRNA transcript or DNA sequence of the upregulated gene of the present invention. DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences (Breaker, R.R. and Joyce, G. Chemistry and Biology 1995;2:655; Santoro, S.W. & Joyce, G.F.
  • DNAzymes complementary to bcr-abl oncogenes were successful in inhibiting the oncogenes expression in leukemia cells, and lessening relapse rates in autologous bone marrow transplant in cases of CML and ALL.
  • Downregulation of the upregulated gene of the present invention can also be effected by using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding the upregulated gene of the present invention.
  • the first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells
  • the second aspect is design of an oligonucleotide which specifically binds the designated mRNA within cells in a way which inhibits translation thereof.
  • the prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, for example, Lucas J MoI Med 76: 75-6 (1998); Kronenwett et al. Blood 91: 852-62 (1998); Rajur et al.
  • antisense oligonucleotides suitable for the treatment of cancer have been successfully used [Holmund et ah, Curr Opin MoI Ther 1:372-85 (1999)], while treatment of hematological malignancies via antisense oligonucleotides targeting c-myb gene, p53 and Bcl-2 had entered clinical trials and had been shown to be tolerated by patients [Gerwitz Curr Opin MoI Ther 1:297-306 (1999)].
  • Another agent capable of downregulating the upregulated gene of the present invention is a ribozyme molecule capable of specifically cleaving an mRNA transcript encoding the upregulated gene of the present invention.
  • Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)].
  • the possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications.
  • ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders [Welch et al, Clin Diagn Virol. 10:163-71 (1998)]. Most notably, several ribozyme gene therapy protocols for HIV patients are already in Phase 1 trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials. ANGIOZYME was the first chemically synthesized ribozyme to be studied in human clinical trials. ANGIOZYME specifically inhibits formation of the VEGF-r (Vascular
  • Endothelial Growth Factor receptor a key component in the angiogenesis pathway.
  • HEPTAZYME Hepatitis C Virus
  • Another agent capable of downregulating the upregulated gene of the present invention would be any molecule which binds to and/or cleaves the upregulated gene of the present invention. Such molecules can be antagonists or inhibitory peptides of the upregulated gene of the present invention.
  • a non-functional analogue of at least a catalytic or binding portion of the upregulated gene of the present invention can be also used as a suitable downregulating agent.
  • Another agent which can be used along with the present invention to downregulate the upregulated gene of the present invention is a molecule which prevents activation or substrate binding of the upregulated gene of the present invention.
  • upregulation or downregulation of specific genes is associated with the existence of chronic PTSD (see Example 2 of the Examples section which follows) downregulation or upregulation, respectively, thereof can be utilized to treat individuals suffering from chronic PTSD.
  • treating refers to inhibiting or arresting the development of a disease, disorder or condition and/or causing the reduction, remission, or regression of a disease, disorder or condition in an individual suffering from, or diagnosed with, the disease, disorder or condition.
  • Those of skill in the art will be aware of various methodologies and assays which can be used to assess the development of a disease, disorder or condition, and similarly, various methodologies and assays which can be used to assess the reduction, remission or regression of a disease, disorder or condition.
  • the phrase “individual suffering from PTSD” refers to an individual which experienced a traumatic event as described hereinabove, and exhibits the full phenotype of PTSD as evaluated following at least one month of the trauma.
  • the phrase "individual suffering from PTSD” encompasses also individual who is diagnosed with PTSD according to the teachings of the present invention which are described hereinabove.
  • the method comprising regulating an expression level of at least one gene selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 thereby treating PTSD in the individual.
  • the term "regulating" refers to upregulating (as described above) the expression level and/or an activity of at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 7, 10, 12, 18, 20, 35, 62, 79, 81, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 331, 342, 344, 348, 352, 372, 376, 377, 378 ,383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 475, 483, 504, 505, 523, 526, 531, 559, 561, 563, 565, 570, 575-581, 585-591
  • the term "regulating" is downregulating (as described above) the expression level and/or an activity of at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:17, 88, 327, 474, 530, 582-584, 592, 594-596, 603, 606, 613, 614, 618, 620, 621, 624-626, 629, 630, 634, 637, 638, 641, 642, 644-646, 649, 653-655, 663, 665, 669-671, 673, 678, 680, 681, 683-685, 688, 689, 691, 704, 705, 709-711, 716, 717, 720, 721, 728, 729, 732, 733, 735, 736, 741, 743, 745, 753, 756, 758, 764, 771, 774, 776, 779, 782, 786, 787, 789
  • an expression vector e.g., a viral vector
  • a polynucleotide sequence encoding the downregulated gene of the present invention e.g., SEQ ID NO:26 which can be used in preventing PTSD and SEQ ID NO: 7 which can be used in treating PTSD
  • suitable promoter sequences to enable expression in brain cells is introduced into the individual via, e.g., intravenous administration.
  • Expression of such a vector in the brain is expected to upregulate the expression level and/or activity of the downregulated gene in such cells and thus to prevent and/or reduce the symptoms of PTSD (e.g., hallucinatory experiences).
  • Dosage of such an expression vector should be calibrated using cell culture experiments and animal models. Success of treatment is preferably evaluated by determining the individual mental status using for example the Clinician Administered PTSD Scale and the Revised Impact of Events Scale.
  • the prevention and/or treatment of PTSD can be also accomplished using for example, an siRNA molecule.
  • a suitable siRNA molecule which can be used to prevent or treat PTSD is the 5'- uguuccacaucgccugcuuca -3' (SEQ ID NO:905) or the 5'- caucgugauucuccagcucaa -3' (SEQ ID NO:906) which can specifically cleave the transcript of zyxin (SEQ ID NO:1) or ELA2, a neutrophil specific elastase 2 (SEQ ID NO: 17), respectively.
  • Such an siRNA molecule can be administered to the individual using intravenous administration.
  • dosage and duration of treatment can vary between individuals, depending on the individual general health status and severity of PTSD symptoms.
  • Each of the upregulating or downregulating agents described hereinabove or the expression vector encoding the downregulated gene of the present invention can be administered to the individual per se or as part of a pharmaceutical composition which also includes a physiologically acceptable carrier.
  • the purpose of a pharmaceutical composition is to facilitate administration of the active ingredient to an organism.
  • a pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the upregulating or downregulating agent or the expression vector encoding the downregulated gene of the present invention which are accountable for the biological effect.
  • pharmaceutically acceptable carrier refers to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.
  • compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • Pharmaceutical compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • the compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • the pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (the upregulating or downregulating agent or the expression vector encoding the downregulated gene) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., avoidance, intrusion and arousal) or prevent the consistence full-PTSD phenotype in the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models [such as those described in Kaufer, 1998 (Supra)] to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).
  • Dosage amount and interval may be adjusted individually to provide plasma levels of the active ingredient are sufficient to prevent and/or treat PTSD (minimal effective concentration, MEC).
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • the amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
  • Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
  • the term "about” refers to ⁇ 10 %.
  • Study subjects Study subjects were individuals who survived a trauma and were admitted to the emergency room immediately following a traumatic event (mean time between incident and arrival was 45 ⁇ 130 minutes). Trauma survivors were evaluated for the presence of acute and chronic PTSD at one and four months following a trauma event according to the DSM IV diagnostic criteria [Diagnostic and Statistical Manual of
  • inclusion criteria included subjects at the ages of 18-65, who met the DSM IV diagnostic criterion at one and four months following a trauma.
  • the control group included subjects who experience the trauma but did not meet any of the DSM IV diagnostic criterion following one month.
  • Exclusion criteria were the presence of a head, burn or serious physical injury, the presence or history of alcohol or illicit drugs abuse, psychiatric diagnoses other than depressive or anxiety disorders, or a medical or neurological illness that could confound the assessments.
  • PTSD evaluation - PTSD status at one and four months was determined using the Clinician Administered PTSD Scale (CAPS, Blake DD, et al. 1990; Behavior Therapist 13:187 -188), a structured clinical interview following the DSM IV diagnostic criteria for PTSD.
  • the co-occurrence of other mental disorders was ascertained by the Structured Clinical Interview for DSM IV Mental Disorders (SCID, Spitzer RL, et al., 1994; Biometric Research Department, New York State Psychiatric Institute). Trauma severity was assessed using a trauma severity scale (Shalev et al., 1998; American Journal of Psychiatry, 155:630-637) addressing the severity of the event in terms of threat to own life, and exposure to others dead or wounded or other undesirable sights.
  • CID Structured Clinical Interview for DSM IV Mental Disorders
  • Trauma severity was assessed using a trauma severity scale (Shalev et al., 1998; American Journal of Psychiatry, 155:630-637) addressing the severity of
  • PTSD symptom severity was assessed using the Revised Impact of Events Scale (IES; Horowitz, M., et al., 1979; Psychosom. Med. 41: 209-218; Weiss DS and Marmar CR. The Impact of Event Scale-Revised. In Wilson JP, Keane TM Eds. Assessing Psychological Trauma and PTSD. New York, Guilford Press 1997:399-411), by scoring three symptom clusters of PTSD: re-experiencing, avoidance and hyper arousal, or the total IES score summarizing all PTSD symptoms.
  • IES Revised Impact of Events Scale
  • Table 4 hereinbelow, out of the twenty-four trauma survivors, eight subjects exhibited persistent full diagnostic criteria at both one and four months after trauma (PTSD - consistent phenotype subjects) and six subjects met no formal clinical criterion for PTSD at any time (control - consistent phenotype subjects). Five subjects exhibited partial intermediate PTSD clinical criteria at one month and full criteria at four months following a trauma, and five other subjects exhibited partial intermediate PTSD clinical criteria at one month which were resolved at four month (i.e., partial phenotype subjects).
  • Table 4 Clinical diagnosis of PTSD following one (acute PTSD, Ml) or four months (chronic PTSD, M4) after trauma.
  • Y yes, full blown acute (one month) or chronic (four m diagnostic criteria for PTSD;
  • Pa partial, sub-threshold criteria for acute (one month) or chronic (four months) PTSD;
  • gene expression analysis was performed in blood samples taken immediately or four months following a trauma, and the expression pattern was correlated with the presence of acute or chronic PTSD, as follows.
  • Sample preparation and microarray hybridization Ten ml of blood were drawn by venipuncture from each subject at the ER and four months following exposure to trauma, using EDTA as anticoagulant. Blood samples were kept at room temperature for up to one hour until processing. Peripheral Blood Monocyte Cells (PMBCs) were separated using Histopaque solution gradient (Sigma-Aldrich, USA), immediately transferred to TRIZOL solution (Gibco BRL, USA) and total RNA was extracted according to the array manufacturer's instructions (Affymetrix, Santa Clara, CA).
  • PMBCs Peripheral Blood Monocyte Cells
  • RNA was purified using RNeasy Mini kit (Qiagen, Germany), precipitated at -20 °C overnight using 7.5 M ammonium acetate (0.4 times of the cRNA volume) (Sigma) and absolute ethanol (2.5 times of the total volume), and washed.
  • the expression value (average difference) for each gene was determined by calculating the average of differences of intensity (perfect match intensity minus mismatch intensity) between the probe pairs. Removal of the batch effect from the array was performed by calculating the average gene expression of each gene within each group and normalizing each expression measurement with the average expression of its group.
  • the expression analysis files created by GENECHIP 3.1 software were transferred to a database (Microsoft Access) and linked to Internet genome databases (e.g., NHLBI, Swiss Prot, and GeneCards).
  • Mean intensity for each sample was defined as the mean of average differences of individual samples from all subjects. Fold changes were determined by dividing the mean intensity of each sample by the mean intensity derived from all samples. All values below 20 were brought to 20 and all values above 10,000 were brought to 10,000. Genes were identified as active if exhibited at least one value between 50 to 7500, one present call by Microarray Analysis Suite 5.0, and exhibited more than 2-fold change from average value in at least one sample.
  • SPOTFIRE PRO 3.0 spotfire, Goteborg, Sweden
  • Clustering Un-supervised clustering was performed using DoublePCluster, an agglomerative hierarchical bi-clustering approach based on similarity in expression profiles. The similarity is measured with a generative probabilistic model identifying an optimal distribution model of the expression values in each of the clusters.
  • standard hierarchical clustering was performed using the GENE CLUSTER and TREEVIEW programs cluster softwares as well a newly developed cluster analysis algorithm (Eisen MB, et al., 1998; Proc. Natl. Acad. Sci. USA, 95: 14863-14868; Friedman N. PCluster: Probabilistic Agglomerative Clustering of Gene Expression Profile. Technical report 2003-80 School of Computer Science & Engineering, Hebrew University, 2003).
  • Differentially expressed signatures The significance of the number of differentially expressed signatures was determined using a randomized permutation test to compute the probability of selecting that many genes under the null hypothesis of random class assignment.
  • ScoreGenes analysis package http://compbio.cs.huii.ac.il/scoregenes/) by calculating for each p-value the accumulated number of genes that were scored with this p-value or better. The significance of the abundance plot was determined using a randomize permutation test with 1000 random reshufflings of labels.
  • Prediction of class assignment - Prediction of the label of a new sample was performed using the Naive Bayesian Classifier method (Duda RO, Hart PE. "Pattern Classification and Scene Analysis", John Wiley & Sons, New York, 1973).
  • the probability of gene expression value in each group and the probability of the observed pattern (for selected genes) are computed and the log-odds ratio between the two probabilities is calculated.
  • the sign of the log-odds defines the predicted class, and the magnitude represents the confidence in the prediction.
  • Leave-one-out cross validation (LOOCV) - The leave-one-out cross validation procedure [Ben-Dor, 2000 (Supra)] was used to evaluate the performance of the classifier on unseen samples.
  • PTSD symptoms include avoidance, re-experiencing, and hyper arousal, each manifesting with a variable intensity among survivors of trauma (Shalev AY., et al.,
  • Total IES score correlates with trauma severity but not the other personal and demographic variables - To identify factors affecting the overall PTSD symptoms, the
  • Table 7 Comparison by personal and demographic variables and pearson correlations with total month four Impact of Event Scale (IES) score among all trauma survivors.
  • NS not- significant using 2-tailed t test (p > 0.1).
  • transcripts co-expressed in neuroendocrine tissues Analysis of transcript expression in normal brain and endocrine tissues was performed by obtaining annotations from OMIM and UniGene and comparing with the U95 microarray transcripts using the Affymetrix netaffex query system. Each transcript was annotated with a tissue or process in which is expressed.
  • transcripts differentiating consistent phenotype groups of PTSD and controls were classified according to functional groups. As is shown in Figure 4a transcripts encoding for proteins which are involved in transcriptional activation, cell cycle and proliferation were downregulated among PTSD affected subjects. Noteworthy, similar results were obtained for transcripts differentiating spectral PTSD symptoms subjects from the controls (not shown). In addition, as is shown in Figure 4b, distinct expression signatures for transcripts involved in immune activation, signal transduction and apoptosis were observed.
  • PBMCs are known to be perturbed following acute psychological stress (Aloe L, et al., 1994. Proc. Natl. Acad. Sci. U. S. A. 91: 10440-4), in part through neuroendocrine and sympathetic modulation (McEwen BS. 1998. N. Engl. J. Med. 338: 171-9). Long-term alterations in sympathetic (Southwick SM., et al., 1999. Biol. Psychiatry. 46: 1192-204) and HPA reactivity (Yehuda, R. 2002. N. Engl. J. Med.
  • the current practice is based on grouping trauma survivors into those with or without clinical PTSD, by applying a severity threshold on the conglomerate score of the three PTSD symptom clusters (DSM-IV), with a consequent inherent loss of data (Andreasen NC. 1997. Science. 1997. 275: 1586-93; Radant A., et al., 2001. Psychiatry Res. 102: 203-15).
  • DSM-IV severity threshold on the conglomerate score of the three PTSD symptom clusters
  • the results presented in the present invention demonstrate that gene expression signatures in PBMCs contain information that is highly correlated with continuous symptom severity measures among all trauma survivors regardless of threshold clinical designation, and for each of the three key biological dimensions that compose PTSD.
  • initial PBMCs gene expression signatures are informative of later clinical course, and could have a significant potential for guiding early detection and thus early intervention among survivors of trauma.
  • gene expression patterns in cancer tissues are indicative of a patient's prognosis (van de Vijver MJ, et al. 2002. N. Engl. J. Med. 347: 1999-2009; Rosenwald A, et al., 2002. N. Engl. J. Med. 346: 1937-47)
  • these data suggest that such information exists in the much more accessible peripheral blood.
  • expression signatures among PBMCs in response to extreme psychological stress may reflect in part genomic predisposition to develop PTSD, beyond the putative participation of immune cells in this neuropsychiatric disorder.
  • Genes showing expression differences in lymphocytes from two patients with bipolar disorder have recently been shown to constitute promising candidates for search of causative genomic polymorphisms associated with risk for the disorder, suggesting that peripheral expression differences contain pathogenetically relevant information for the neuropsychiatric process (Kakiuchi C, et al., 2003. Nat. Genet. 35: 171-5).
  • Indirect support for this notion can be found in the increased proportion of genes co-expressed in brain and endocrine tissues, as well as specific genes related to neural transduction of stress among the informative transcripts observed in PBMCs.
  • results presented in the present invention demonstrate a general reduction in PBMCs' expression of transcription activators among psychologically affected trauma survivors in response to stress. This decrease may explain much of the differences in gene expression signatures observed between the PTSD and control subjects. It remains to be established if some of the robust differences among PBMCs in gene transcripts related to transcriptional activation, intracellular signaling pathways, cell cycle, and apoptosis, might be indicative of parallel changes occurring among cell populations more relevant to central stress reactivity. Genomic variation may drive related transcriptional reactivity among glial cells that share closer embryonal derivation to leukocytes or even among neuronal cells. Reduced hippocampal volumes have been described among PTSD patients (Gilbertson MW, et al. 2002. Nat.
  • Neurosci. 11: 1242-7 Altered neuroendocrine reactivity, signal transduction, and cellular proliferation and demise among neural and glial cells, have been implicated in hippocampal volume depletion [Kakiuchi, 2003 (Supra); Gilbertson, 2002 (Supra); Kim JJ, and Diamond DM. 2002. Nat. Rev. Neurosci. 6: 453-62], as well as in fear avoidance formation (Schafe GE, et al., 2001. Trends Neurosci. 24: 540-546) and memory consolidation (McEwen BS. 2001. Ann. N. Y. Acad. Sci.
  • Kessler RC Sonega A, Bromet E, Hughes M, Nelson CB. Posttraumatic stress disorder in the national comorbidity survey. Arch Gen Psychiatry 1995; 52:1048-1060. Yehuda, R. "Post-traumatic stress disorder.” N Engl J Med 2002; 346(2): 108-14.
  • Nisenbaum LK The ultimate chip shot: can microarray technology deliver for neuroscience? Genes Brain Behav. 2002;l(l):27-34. Barlow C, Lockhart DJ. DNA arrays and neurobiology— what's new and what's next?
  • Chrousos GP The hypothalamic-pituitary-adrenal axis and immune-mediated inflammation. N Engl J Med. 1995; 332(20): 1351-62.
  • Andreasen NC Linking mind and brain in the study of mental illnesses: a project for a scientific psychopathology. Science. 1997; 14;275(5306):1586-93.
  • Eisen MB Spellman PT
  • Brown PO Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 1998; 95(25): 14863-14868.
  • File name/ date of creation/ byte size/ operating system/machine format all files are text files — operation program is therefore any text editor, including MS_word).
  • the 28215 Sequence listing.txt file includes the sequence listing of SEQ ID

Abstract

The present invention is of genes differentially expressed in post traumatic stress disorder (PTSD) affected subjects which can be used in determining predisposition to and/or diagnosing PTSD. Specifically, the present invention can be used in preventing and/or treating PTSD by regulating the expression level of the PTSD differentially expressed genes.

Description

COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING POST
TRAUMATIC STRESS DISORDER
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to specific gene expression patterns in PBMC of acute and chronic PTSD affected individuals and, more particularly, to methods of predicting and diagnosing PTSD.
Post-traumatic stress disorder (PTSD) is a common mental disorder with a lifetime prevalence of 9-14 % (Breslau N. 2001. J. Clin. Psychiatry. 62 Suppl 17: 16-22; Kessler RC et al., 1995. Arch. Gen. Psychiatry 52: 1048-1060; Yehuda, R. 2002. N. Engl. J. Med. 346: 108-14). PTSD results from a maladaptive response to life threatening events such as wars, natural disasters, domestic violence or sexual abuses; when such traumatic events cause psychological bruises beyond the usual corrective ability of the affected individual, PTSD develops.
PTSD is characterized by three specific groups of symptoms: intrusive behaviors (including flashbacks and intense physiologic distress), avoidance behaviors (including avoidance of reminders of the trauma and numbing of responsiveness), and hyperarousal (including insomnia and an exaggerated startle response). Many trauma survivors exhibit PTSD symptoms at the early aftermath of traumatic events (e.g., 94 % of rape victims), with marked variability in terms of severity and persistence of each of the symptom clusters. Twin studies have suggested that each of the clusters of symptoms possesses a distinct genetic basis and represent discrete biological dimensions (True WR, et al. 1993. Arch. Gen. Psychiatry, 50: 257-264). While early symptoms are often transient, a significant number of survivors remain highly symptomatic, exhibiting the full persisting clinical disorder. The diagnosis of acute PTSD is made if the intrusion, avoidance and hyperarousal cause significant clinical impairments which last for more than a month. On the other hand, if such symptoms last for a period of 2-30 days, a diagnosis of acute stress disorder is made. Chronic PTSD is diagnosed if sufficiently severe symptoms in all 3 clusters are still apparent three or more months after trauma (DSM-IV, American Psychiatric Association).
Although early treatment of acute stress disorder might prevent the full phenotype of chronic PTSD (Bryant RA, et al., 1999. Am. J. Psychiatry, 156: 1780-1786) there are currently limited tools of predicting the development of chronic PTSD among trauma survivors.
Several studies have focused on the biological basis underlying PTSD. Imaging studies revealed shrinkage of the hippocampus and dysfunction of the prefrontal cortex in
PTSD affected individuals. On the other hand, studies utilizing animal models have identified changes in the expression patterns of cholinergic (Kaufer D, et al., 1998.
Nature, 393: 373-7) and neuroendocrine (Liberzon I, et al., 1999. J. Neuroendocrinol.
11:11-7; Fujikawa T, et al., 2000. Brain Res. 874: 186-93) genes in the brains of the stressed animals. However, since direct sampling of the human brain is not possible, the molecular mechanisms underlying PTSD in humans are yet unclear.
Immunological studies have found that acute psychological stress, as well as
PTSD, are associated with activation of immune genes (Aloe L, et al., 1994. Proc Natl
Acad Sci USA. 91: 10440-4; Miller RJ, et al., 2001. Cytokine, 13: 253-5). In addition, studies conducted in animal models revealed specific gene expression signatures in peripheral blood monocyte cells (PBMC) derived from animals exhibiting CNS disorders which generate an immune response, such as multiple sclerosis, stroke and seizures.
While reducing the present invention to practice, the present inventors have uncovered through laborious experimentation differentially expressed genes in PBMCs derived from trauma survivors which can be used as markers in predicting and diagnosing
PTSD.
SUMMARY OF THE INVENTION
According to one aspect of the present invention there is provided a kit for determining predisposition of a subject to develop PTSD comprising at least 10 and no more than 574 polynucleotides wherein each of the polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
According to another aspect of the present invention there is provided use of an agent for the manufacture of a kit for determining predisposition to develop PTSD, the agent comprising at least 10 and no more than 574 polynucleotides wherein each of the polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
According to yet another aspect of the present invention there is provided a kit for diagnosing PTSD in a subject comprising at least 10 and no more than 408 polynucleotides wherein each of the polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904.
According to still another aspect of the present invention there is provided use of an agent for the manufacture of a kit for diagnosing PTSD, the agent comprising at least 10 and no more than 408 polynucleotide sequences wherein each of the polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570, and 575-904.
According to an additional aspect of the present invention there is provided a microarray comprising at least 10 and no more than 904 oligonucleotides wherein each of the oligonucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-904.
According to yet an additional aspect of the present invention there is provided a method of diagnosing PTSD in a subject comprising obtaining a cell sample from the subject and detecting in the cell sample the level of expression of at least 10 and no more than 408 polynucleotide sequences wherein each of the polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570, and 575-904.
According to still an additional aspect of the present invention there is provided a method of determining predisposition of a subject to develop PTSD comprising obtaining a cell sample from the subject and detecting in the cell sample the level of expression of at least 10 and no more than 574 polynucleotide sequences wherein each of the polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 1-574.
According to a further aspect of the present invention there is provided a method of preventing PTSD in an individual predisposed to PTSD, the method comprising regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 thereby preventing PTSD in the individual.
According to yet a further aspect of the present invention there is provided use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 as a pharmaceutical.
According to still a further aspect of the present invention there is provided use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 for the manufacture of a medicament identified for preventing PTSD.
According to still a further aspect of the present invention there is provided a method of treating PTSD in an individual suffering from PTSD, the method comprising regulating an expression level of at least one gene selected from the group consisting of
SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154,
159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260,
275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383,
389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 thereby treating PTSD in the individual. According to still a further aspect of the present invention there is provided use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 as a pharmaceutical.
According to still a further aspect of the present invention there is provided use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128,
129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252,
253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352,
372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505,
523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 for the manufacture of a medicament identified for the treatment of PTSD.
According to further features in preferred embodiments of the invention described below, each of the polynucleotides is selected from the group consisting of an oligonucleotide molecule, a cDNA molecule, a genomic molecule and an RNA molecule. According to still further features in the described preferred embodiments each of the polynucleotides is at least 10 and no more than 50 nucleic acids in length.
According to still further features in the described preferred embodiments each of the polynucleotides is bound to a solid support.
According to still further features in the described preferred embodiments the kit further comprising at least one reagent suitable for detecting hybridization of the polynucleotides and at least one RNA transcript.
According to still further features in the described preferred embodiments the kit further comprising packaging materials packaging the at least one reagent and instructions of using the kit in determining predisposition of the subject to develop PTSD.
According to still further features in the described preferred embodiments the kit further comprising packaging materials packaging the at least one reagent and instructions of using the kit in diagnosing PTSD in the subject.
According to still further features in the described preferred embodiments each of the oligonucleotides is at least 10 and no more than 40 nucleic acids in length.
According to still further features in the described preferred embodiments the cell sample is derived from a blood cell sample.
According to still further features in the described preferred embodiments the subject has experienced a traumatic event.
According to still further features in the described preferred embodiments the traumatic event is caused by a war, a natural disaster, a domestic violence and/or a sexual abuse.
According to still further features in the described preferred embodiments detecting is effected at least one month following the traumatic event.
According to still further features in the described preferred embodiments detecting is effected within 1-4 months following the traumatic event. According to still further features in the described preferred embodiments detecting is effected within 0.15-24 hours following the traumatic event.
According to still further features in the described preferred embodiments detecting is effected within 45-200 minutes following the traumatic event.
According to still further features in the described preferred embodiments regulating is upregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:2-5, 7-
13, 15, 16, 18-21, 23, 26-31, 34-42, 44-53, 55-58, 60, 62-68, 71, 73, 75, 77-87, 89-96, 98-
104, 106-111, 113, 115-119, 123, 124, 126-134, 138, 139, 141, 142, 144-149, 151-155,
157, 159, 161, 162, 164-166, 168-179, 181-186, 188-190, 192-198, 200-204, 206-221, 223-234, 236-250, 252-264, 266, 268-303, 305-317, 320-325, 329-338, 340-353, 355,
357-367, 370-373, 376-381, 383, 384, 386-397, 399, 400, 403-405, 407, 408, 410, 411,
415-422, 425, 427-438, 440, 442-468, 470, 471, 473, 475-477, 479, 481-490, 492-494,
496, 497, 499, 500, 503-509, 511-527, 529, 531-546, 548, 550, 552, 553, 558-561, 563-
567, and 570-574. According to still further features in the described preferred embodiments upregulating is effected by at least one approach selected from the group consisting of: (a) expressing in cells of the individual an exogenous polynucleotide encoding the at least one gene; (b) increasing expression of the at least one gene in the individual; (c) increasing endogenous activity of the at least one gene product in the individual; (d) introducing an exogenous polypeptide including at least a functional portion of the at least one gene product to the individual; (e) administering cells expressing the at least one gene into the individual.
According to still further features in the described preferred embodiments upregulating is effected by an agent selected from the group consisting of: (a) an exogenous polynucleotide encoding the at least one gene; (b) an agent capable of increasing expression of the at least one gene; (c) an agent capable of increasing endogenous activity of the at least one gene product; (d) an exogenous polypeptide including at least a functional portion of the at least one gene product; (e) cells expressing the at least one gene. According to still further features in the described preferred embodiments regulating is downregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 1, 6, 14, 17, 22, 24, 25, 32, 33, 43, 54, 59, 61, 69, 70, 72, 74, 76, 88, 97, 105, 112, 114, 120, 121, 122, 125, 135, 136, 137, 140, 143, 150, 156, 158, 160, 163, 167, 180, 187, 191, 199, 205, 222, 235, 251, 265, 267, 304, 318, 319, 326, 327, 328, 339, 354, 356, 368, 369, 374, 375, 382, 385, 398, 401, 402, 406, 409, 412, 413, 414, 423, 424, 426, 439, 441, 469, 472, 474, 478, 480, 491, 495, 498, 501, 502, 510, 528, 530, 547, 549, 551, 554-557, 562, 568, and 569.
According to still further features in the described preferred embodiments downregulating is effected by an agent selected from the group consisting of: (a) a molecule which binds the at least one gene and/or a gene product thereof; (b) an enzyme which cleaves the at least one gene product; (c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoded by the at least one gene; (d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoded by the at least one gene; (e) a DNAzyme which specifically cleaves an mRNA transcript or DNA sequence of the at least one gene; (f) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoded by the at least one gene; (g) a non-functional analogue of at least a catalytic or binding portion of the at least one gene product; (h) a molecule which prevents the at least one gene product activation or substrate binding.
According to still further features in the described preferred embodiments introducing is effected via systemic administration of the agent.
According to still further features in the described preferred embodiments regulating is upregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:7, 10, 12, 18, 20, 35, 62, 79, 81, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320 ,331, 342, 344, 348, 352, 372, 376, 377, 378 ,383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 475, 483, 504, 505, 523, 526, 531, 559, 561, 563, 565, 570, 575-581, 585- 591, 593, 597-602, 604, 605, 607-612, 615-617, 619, 622, 623, 627, 628, 631-633, 635, 636, 639, 640, 643, 647, 648, 650, 651, 652, 656-662, 664, 666-668, 672, 674-677, 679, 682, 686, 687, 690, 692-703, 706-708, 712-715, 718, 719, 722-727, 730-731, 734, 737- 740, 742, 744, 746-752, 754, 755, 757, 759-763, 765-770, 772, 773, 775, 777, 778, 780, 781, 783-785, 788, 790, 793, 796-807, 810, 812, 813, 817, 818, 821, 822, 824-827, 830, 832-837, 843, 844, 846-849, 851-853, 856-859, 861-864, 866-869, 872-876, 878, 880- 884, 889, 891, 893, 895, 899, and 900.
According to still further features in the described preferred embodiments regulating is downregulating an expression level and/or an activity of the at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:17, 88, 327, 474, 530, 582-584, 592, 594-596, 603, 606, 613, 614, 618, 620, 621, 624-626, 629, 630, 634, 637, 638, 641, 642, 644-646, 649, 653-655, 663, 665, 669-671, 673, 678, 680, 681, 683-685, 688, 689, 691, 704, 705, 709-711, 716, 717, 720, 721, 728, 729, 732, 733, 735, 736, 741, 743, 745, 753, 756, 758, 764, 771, 774, 776, 779, 782, 786, 787, 789, 791, 792, 794, 795, 808, 809, 811, 814-816, 819, 820, 823, 828, 829, 831, 838- 842, 845, 850, 854, 855, 860, 865, 870, 871, 877, 879, 885-888, 890, 892, 894, 896-898, and 901-904.
According to still further features in the described preferred embodiments the agent is formulated for systemic administration.
The present invention successfully addresses the shortcomings of the presently known configurations by providing methods of diagnosing and treating PTSD.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice. In the drawings:
FIGs. la-h illustrate changes in expression profiles of genes following trauma. Figures la-c show unsupervised hierarchical clustering of expression profiles of 4512 active genes in peripheral blood monocyte cells (PBMCs) drawn from trauma survivors. Figure Ia - all subjects; Figure Ib - one hour following a trauma; Figure Ic - four months following a trauma. Columns correspond to samples and rows correspond to genes; ER = emergency room (approximately one hour following trauma), M4 = four months following trauma, PTSD = acute and chronic post traumatic stress disorder; Control M4 = subjects who did not meet any formal PTSD criterion at one and four months following a trauma. Figure Id-f are overabundance plots depicting the number of genes differentiating PTSD from control samples. Figure Id — all subjects; Figure Ie - one hour following a trauma; Figure If - four months following a trauma. Observed plot = observed abundance of genes separating PTSD and control samples; Expected by chance = average number of separating genes, accepted under the null-hypothesis. The overabundance plot was generated by taking the average of 1000 simulations (of raw data consisting of 4512 active genes) with random labeling of subjects; 2 SD's = two standard deviations (95 %) of the random simulation results. Note that the observed overabundance plot of separating genes in the ER, M4 or the combined set of samples is more than two standard deviations than expected by chance (Figure Ie, f or d, respectively). Figures lg-h — are supervised expression profiles depicting the confidence of the classification algorithm along with the expression signature of most significant (p < 0.05) separating genes. Note the correct classification of 8 out of 9 samples drawn four months following a trauma (Figure Ig), and 9 out of 11 samples drawn at the ER (Figure Ih).
FIGs. 2a-l depict the correlation between the level of gene expression at four month following a trauma and the continuous Impact of Event Scale (IES) scores. The expression level of various genes was determined in blood samples drawn at four months following a trauma, and was correlated with IES scores which were assessed four months following trauma exposure among all 24 survivors, regardless of the clinical designation above or bellow the threshold for formal PTSD diagnosis. Shown are the IES scores (Figures 2a, d, g, and i), the level of gene expression (Figures 2b, e, h, and k) and the Pearson correlation (p < 0.05) between the IES scores and the level of gene expression (Figures 2c, f, i, and 1) of 18 available M4 samples exhibiting significant correlations. The significance of the number of correlated genes (p-value) was estimated using a random simulation test in which 1000 simulations with random permutation of the IES scores were performed. Red line - Curve showing the Pearson correlation of each of the 4512 active genes with the subject score, when the genes are sorted in a decreasing order of correlation. Dark gray line - Curve showing the expected sorted Pearson correlations in 1000 simulations with random reshuffling of subjects' scores. Dashed line - threshold denoting genes with significant correlation (p < 0.05). Note the significant correlation of the total IES scores (Figure 2c), avoidance (Figure 2f), intrusive memories (Figure 2i), and increased autonomic arousal (Figure 21) with the level of gene expression.
FIGs. 3a-l depict the correlation between the level of gene expression as determined immediately following a trauma and the continuous Impact of Event Scale (IES) scores. Gene expression level which was determined in blood samples drawn at the ER (i.e., within an hour following a trauma) was correlated with IES scores which were assessed four months following a trauma in all 24 survivors, regardless of the clinical designation above or bellow the threshold for formal PTSD diagnosis. Shown are the IES scores (Figures 3a, d, g, and i), the level of gene expression (Figures 3b, e, h, and k) and the Pearson correlation (p < 0.05) between the IES scores and the level of gene expression (Figures 3c, f, i, and 1) of 15 available ER samples exhibiting significant correlations. The significance of the number of correlated genes (p-value) and Pearson correlations were performed as described in Figures 2a-l. Note the significant correlation of the total IES scores (Figure 3c), avoidance (Figure 3f), intrusive memories (Figure 3i), and increased autonomic arousal (Figure 31) with the level of gene expression. FIGs. 4a-c illustrate functional groups among informative genes of transcripts differentiating consistent phenotype transcripts. Figure 4a - detailed expression profiles of several functional groups among acute PTSD (ER), chronic PTSD (M4), or subjects which did not meet any formal PTSD criterion immediately following a trauma (Control ER) or four months following a trauma (Control M4); Figure 4b — averaged over - or under - expression following trauma; Note the marked overall decreased expression of genes coding for transcription enhancers, regulators of protein biosynthesis, protein degradation and cell proliferation following trauma. Figure 4c - the frequency of gene ontology annotation among genes differentiating PTSD from control subjects (PTSD vs. Control) as compared with the total active genes on the chip (background). Note the significant increased representation (p < 0.0005) of genes involved in RNA metabolism or processing and nucleotide metabolism among the genes differentiating PTSD from control subjects.
FIGs. 5a-c illustrate the expression profile of genes co-expressed in neural and endocrine tissues following trauma. Figure 5a - detailed expression profiles of genes known to be co-expressed in neural and neuroenocrine tissues among subjects who had a definitive clinical diagnosis at both one and four months following a trauma; Figure 5b - averaged over - or under - expression following trauma of genes known to be co- expressed in areas mediating stress reactivity; Figure 5c — the frequency of genes known to be co-expressed in areas mediating stress reactivity among the genes differentiating PTSD from control subjects (PTSD vs. Control) or the total active genes on the chip (background). Note the significant increased representation (p < 0.005) of genes known to be co-expressed in the HPA axis, amygdala and hippocampus among the genes differentiating PTSD from control subjects. Annotations were determined using OMIM and UniGene data-bases.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is of genes differentially expressed in PTSD affected subjects which can be used in determining predisposition to and/or diagnosing PTSD. Specifically, the present invention can be used in preventing and/or treating PTSD by regulating the expression level of the PTSD differentially expressed genes.
The principles and operation of the methods and kits of diagnosing and treating PTSD according to the present invention may be better understood with reference to the drawings and accompanying descriptions.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting. Post-traumatic stress disorder (PTSD) is a common mental disorder affecting individuals who experienced a life-threatening traumatic event. At the early aftermath of a traumatic event, many trauma survivors exhibit characteristic symptoms of intrusion, avoidance, and hyperarousal. The severity and persistence of such symptoms is highly variable; while in most cases such symptoms are transient (i.e., the diagnosis of acute stress disorder), a significant number of trauma survivors remain highly symptomatic, exhibiting the full persisting clinical phenotype of PTSD for long periods of time.
PTSD is usually treated with psychological interventions and psychotropic drugs aimed at reducing symptoms of anxiety and depression. These include anti-depressant and anti anxiety drugs including serotonin reuptake inhibitors (e.g., fluoxetine, paroxetine, sertraline), atypical antidepressant drugs (e.g. trazodone, nefazodone) and anticonvulsant agents (e.g., gabapentin). Treatment with these drugs often results in variable side effects such as increased anxiety, sedation, tiredness, weight gain, gastrointestinal problems, sexual dysfunction, and dizziness.
Prior studies have suggested that early treatment of acute stress disorder might prevent the development of chronic PTSD [Bryant, 1999 (Supra)]. However, although desirable, there are currently limited tools for predicting the development of chronic PTSD among trauma survivors. Thus, it is currently not possible to predict which trauma survivor is prone to developing PTSD and as such should be treated within the first three months following trauma. While reducing the present invention to practice, the present inventors have uncovered 904 genes (as shown in Table 3) which are differentially expressed (over or under expressed) in peripheral blood monocyte cells (PBMCs) of PTSD affected individuals with respect to trauma survivors who remain unaffected and established that such genes can be used in determining predisposition to or diagnosing PTSD. As is shown in Table 2, Figures Ib, e and g and further in Example 2 of the
Examples section which follows, the present inventors have uncovered 574 genes (SEQ ID NOs: 1-574) which are differentially expressed immediately following a traumatic event in subjects who later develop PTSD, and that such an expression pattern can be used in determining predisposition to develop PTSD. Thus, according to one aspect of the present invention there is provided a method of determining predisposition of a subject to develop PTSD.
As used herein, the term "PTSD" refers to post traumatic stress disorder, an anxiety disorder developing following serious traumatic events and characterized by symptoms of intrusion (i.e., re-experiencing or "flash-backs" of the trauma), avoidance (i.e., numbness, diminished emotions and lack of involvement with reality) and hyperarousal (i.e., being constantly threatened by the trauma, irritable or explosive, and having trouble in concentrating or remembering current information).
The phrase "determining predisposition" used herein refers to determining susceptibility to develop a disorder. A subject with a predisposition to develop a disorder is more likely to develop the disorder than a non-predisposed subject.
As used herein, the term "subject" includes both young and old human beings of both sexes. Preferably, this term encompasses individuals who experienced a serious traumatic event and are therefore at risk of developing PTSD. Examples include, but are not limited to rape victims, subjects who experienced wars, terror attacks, motor vehicle accidents, natural disasters such as earthquakes, and the like. According to this aspect of the present invention the term "subject" also encompasses individuals who are at risk of being exposed to a traumatic event due to involvement in life-threatening assignments. Examples include, but are not limited to, soldiers, policemen and the like.
The method according to this aspect of the present invention is effected by detecting in a cell sample of the subject the level of expression of at least 10 and no more than 574 polynucleotide sequences, wherein each of the polynucleotide sequences is at least 80 % identical to a specific polynucleotide of the set of polynucleotides set forth by
SEQ ID NOs: 1-574.
Since as is shown in Table 2, a portion of the 574 polynucleotides exhibit highly significant differential expression in PTSD subjects immediately following a traumatic event, the method is preferably effected by detecting the expression level of at least 10 and no more than 127 polynucleotide sequences corresponding to the set of polynucleotides including SEQ ID NOs:4, 7, 24, 27, 28, 29, 36, 37, 42, 46, 51, 53, 62, 64,
69, 77, 79, 81, 85, 87, 92, 102, 107, 119, 124, 146, 147, 169, 171, 173, 184, 185, 188, 191, 195, 197, 207, 210, 211, 214, 219, 220, 227, 228, 234, 239, 254, 256, 269, 272, 276, 284, 302, 303, 320, 327, 348, 350, 352, 356, 359, 366, 384, 386, 389, 410, 427, 432, 444, 445, 447, 458, 459, 476, 479, 482, 483, 486, 488, 503, 507, 518, 522, 523, 534, 538, 541, 547, 552, 555, 560, 561, 283, 61, 357, 67, 361, 258, 481, 149, 467, 363, 179, 56, 230, 106, 100, 163, 464, 299, 528, 502, 274, 1, 392, 311, 472, 434, 573, 544, 420, 298, 154, 26, 279, 59, and 41, more preferably, at least 10 and no more than 118 polynucleotides of a set including SEQ ID NOs: 4, 7, 24, 27, 28, 29, 36, 37, 42, 46, 51, 53, 62, 64, 69, 77, 79, 81, 85, 87, 92, 102, 107, 119, 124, 146, 147, 169, 171, 173, 184, 185, 188, 191, 195, 197, 207, 210, 211, 214, 219, 220, 227, 228, 234, 239, 254, 256, 269, 272, 276, 284, 302, 303, 320, 327, 348, 350, 352, 356, 359, 366, 384, 386, 389, 410, 427, 432, 444, 445, 447, 458, 459, 476, 479, 482, 483, 486, 488, 503, 507, 518, 522, 523, 534, 538, 541, 547, 552, 555, 560, 561, 283, 61, 357, 67, 361, 258, 481, 149, 467, 363, 179, 56, 230, 106, 100, 163, 464, 299, 528, 502, 274, 1, 392, 311, 472, and 434, most preferably, at least 10 and no more than 98 polynucleotides of a set including SEQ ID NOs: 4, 7, 24, 27, 28, 29, 36, 37, 42, 46, 51, 53, 62, 64, 69, 77, 79, 81, 85, 87, 92, 102, 107, 119, 124, 146, 147, 169, 171, 173, 184, 185, 188, 191, 195, 197, 207, 210, 211, 214, 219, 220, 227, 228, 234, 239, 254, 256, 269, 272, 276, 284, 302, 303, 320, 327, 348, 350, 352, 356, 359, 366, 384, 386, 389, 410, 427, 432, 444, 445, 447, 458, 459, 476, 479, 482, 483, 486, 488, 503, 507, 518, 522, 523, 534, 538, 541, 547, 552, 555, 560, 561, 283, 61, 357, 67, 361, and 258.
The phrase "at least 80 % identical" refers to homologous polynucleotide sequences which are at least 80 %, more preferably, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, more preferably at least 99 %, most preferably, 100 % identical to at least one of the polynucleotides of the present invention as determined using the BlastN software of the National Center of Biotechnology Information (NCBI) using default parameters.
As used herein, the phrase "level of expression" refers to the degree of gene expression and/or gene product activity in a specific tissue or cell sample. For example, up-regulation or down-regulation of various genes can affect the level of the gene product (i.e., RNA and/or protein) in a specific tissue or cell sample. According to preferred embodiments of the present invention, detecting the level of expression of the polynucleotide sequences of the present invention is effected using RNA or protein molecules which are extracted from a cell sample of the subject.
Methods of extracting RNA or protein molecules from cell samples (e.g., skin, blood, or bone marrow samples) are well known in the art.
Once obtained, the RNA or protein molecules are preferably characterized for the expression and/or activity level of various RNA and/or protein molecules using methods known in the arts.
Northern Blot analysis: This method involves the detection of a particular RNA in a mixture of RNAs. An RNA sample is denatured by treatment with an agent (e.g., formaldehyde) that prevents hydrogen bonding between base pairs, ensuring that all the RNA molecules have an unfolded, linear conformation. The individual RNA molecules are then separated according to size by gel electrophoresis and transferred to a nitrocellulose or a nylon-based membrane to which the denatured RNAs adhere. The membrane is then exposed to labeled DNA probes. Probes may be labeled using radio¬ isotopes or enzyme linked nucleotides. Detection may be using autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of particular RNA molecules and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the gel during electrophoresis.
RT-PCR analysis: This method uses PCR amplification of relatively rare RNAs molecules. First, RNA molecules are purified from the cells and converted into complementary DNA (cDNA) using a reverse transcriptase enzyme (such as an MMLV-
RT) and primers such as, oligo dT, random hexamers or gene specific primers. Then by applying gene specific primers and Taq DNA polymerase, a PCR amplification reaction is carried out in a PCR machine. Those of skills in the art are capable of selecting the length and sequence of the gene specific primers and the PCR conditions {i.e., annealing temperatures, number of cycles and the like) which are suitable for detecting specific
RNA molecules. It will be appreciated that a semi-quantitative RT-PCR reaction can be employed by adjusting the number of PCR cycles and comparing the amplification product to known controls.
RNA in situ hybridization stain: In this method DNA or RNA probes are attached to the RNA molecules present in the cells. Generally, the cells are first fixed to microscopic slides to preserve the cellular structure and to prevent the RNA molecules from being degraded and then are subjected to hybridization buffer containing the labeled probe. The hybridization buffer includes reagents such as formamide and salts (e.g., sodium chloride and sodium citrate) which enable specific hybridization of the DNA or RNA probes with their target mRNA molecules in situ while avoiding non-specific binding of probe. Those of skills in the art are capable of adjusting the hybridization conditions (i.e., temperature, concentration of salts and formamide and the like) to specific probes and types of cells. Following hybridization, any unbound probe is washed off and the slide is subjected to either a photographic emulsion which reveals signals generated using radio-labeled probes or to a colorimetric reaction which reveals signals generated using enzyme-linked labeled probes. In situ RT-PCR stain: This method is described in Nuovo GJ, et al. [Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am J Surg Pathol. 1993, 17: 683-90] and Komminoth P, et al. [Evaluation of methods for hepatitis C virus detection in archival liver biopsies. Comparison of histology, immunohistochemistry, in situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Pathol Res Pract. 1994, 190: 1017-25]. Briefly, the RT-PCR reaction is performed on fixed cells by incorporating labeled nucleotides to the PCR reaction. The reaction is carried on using a specific in situ RT-PCR apparatus such as the laser-capture microdissection PixCell I LCM system available from Arcturus Engineering (Mountainview, CA). Oligonucleotide microarray — In this method oligonucleotide probes capable of specifically hybridizing with the polynucleotides of the present invention are attached to a solid surface (e.g., a glass wafer). Each oligonucleotide probe is of approximately 20- 25 nucleic acids in length. To detect the expression pattern of the polynucleotides of the present invention in a specific cell sample (e.g., blood cells), RNA is extracted from the cell sample using methods known in the art (using e.g., a TRIZOL solution, Gibco BRL, USA). Hybridization can take place using either labeled oligonucleotide probes (e.g., 5'- biotinylated probes) or labeled fragments of complementary DNA (cDNA) or RNA (cRNA). Briefly, double stranded cDNA is prepared from the RNA using reverse transcriptase (RT) (e.g., Superscript II RT), DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, MD, USA). To prepare labeled cRNA, the double stranded cDNA is subjected to an in vitro transcription reaction in the presence of biotinylated nucleotides using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo, Diagnostics, Affymetix Santa Clara CA). For efficient hybridization the labeled cRNA can be fragmented by incubating the RNA in 40 mM Tris Acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate for 35 minutes at 94 °C. Following hybridization, the microarray is washed and the hybridization signal is scanned using a confocal laser fluorescence scanner which measures fluorescence intensity emitted by the labeled cRNA bound to the probe arrays. For example, in the Affymetrix microarray (Affymetrix®, Santa Clara, CA) each gene on the array is represented by a series of different oligonucleotide probes, of which, each probe pair consists of a perfect match oligonucleotide and a mismatch oligonucleotide. While the perfect match probe has a sequence exactly complimentary to the particular gene, thus enabling the measurement of the level of expression of the particular gene, the mismatch probe differs from the perfect match probe by a single base substitution at the center base position. The hybridization signal is scanned using the Agilent scanner, and the Microarray Suite software subtracts the non-specific signal resulting from the mismatch probe from the signal resulting from the perfect match probe. Enzyme linked immunosorbent assay (ELISA): This method involves fixation of a sample (e.g., fixed cells or a proteinaceous solution) containing a protein substrate to a surface such as a well of a microtiter plate. A substrate specific antibody coupled to an enzyme is applied and allowed to bind to the substrate. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody. Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced. A substrate standard is generally employed to improve quantitative accuracy.
Western blot: This method involves separation of a substrate from other protein by means of an acrylamide gel followed by transfer of the substrate to a membrane (e.g., nylon or PVDF). Presence of the substrate is then detected by antibodies specific to the substrate, which are in turn detected by antibody binding reagents. Antibody binding reagents may be, for example, protein A, or other antibodies. Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.
Radio-immunoassay (RIA): In one version, this method involves precipitation of the desired protein (i.e., the substrate) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I125) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of substrate.
In an alternate version of the RIA, a labeled substrate and an unlabelled antibody binding protein are employed. A sample containing an unknown amount of substrate is added in varying amounts. The decrease in precipitated counts from the labeled substrate is proportional to the amount of substrate in the added sample.
Fluorescence activated cell sorting (FACS): This method involves detection of a substrate in situ in cells by substrate specific antibodies. The substrate specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.
Immunohistochemical analysis: This method involves detection of a substrate in situ in fixed cells by substrate specific antibodies. The substrate specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain. In situ activity assay: According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.
In vitro activity assays: In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non- denaturing acrylamide gel (i.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.
The cell sample used by the present invention can be any cell sample obtained from the subject or subject tissues. Examples include, but are not limited to blood cells, skin cells, bone marrow cells and the like. Methods of obtaining blood, bone marrow and/or epithelial cell samples from an individual are well known in the art.
Preferably, the cell sample is a PBMC sample. As is shown in Example 1 of the Examples section which follows, such a sample can be obtained by drawing ten ml of blood by venipuncture (using EDTA as an anticoagulant) and separating the PBMCs from the blood sample using Histopaque solution gradient (Sigma-Aldrich, USA).
As is mentioned before, predisposition of a subject to develop PTSD can be detected at any time (e.g., prior to participation in a life-threatening assignment or following a traumatic event). Preferably, the predisposition of a subject to develop PTSD is detected in the cell sample of the subject shortly after a traumatic event, i.e., within 0.15-24 hours of a traumatic event, more preferably, within 0.3-22 hours, more preferably, within 0.5-18 hours, more preferably, within 0.5-10 hours, more preferably, within 0.5-5 hours, more preferably, within 45-200 minutes of a traumatic event.
Once determined, the expression level of the polynucleotide sequences of the present invention can be correlated with the level of expression of PTSD affected individuals as shown in Table 2 and Figures Ia, b, e, and g, and Example 2 of the Examples section which follows and a differential expression of at least some or preferably all of the 574 genes described above is indicative of increased predisposition risk of the individual to develop PTSD.
Thus, the teachings of the present invention can be used to determine if an individual is predisposed to PTSD. Briefly, 45-200 minutes following a traumatic event a blood sample is obtained from the trauma survivor and PBMCs are isolated using, for example, the Histopaque solution gradient (Sigma-Aldrich, USA). Isolated PBMCs are immediately subjected to RNA extraction using e.g., a TRIZOL solution (Gibco BRL, USA), following which double stranded cDNA is prepared using e.g., Superscript II RT, DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, MD, USA). Prior to hybridization, labeled cRNA (e.g., using biotin) is prepared in vitro from the double stranded cDNA [using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo)], and further fragmented as described above for 35 minutes at 94 0C. Hybridization is performed on an array of approximately 120-130 oligonucleotides, each of approximately 20-25 nucleic acids in length, which are capable of specifically hybridizing to the polynucleotides listed in Table 2 which exhibit a p-value of less than 0.047. Following hybridization, the arrays are washed to remove access of unbound cRNA probes and the hybridization signals are scanned using for example, the GeneArray scanner G2500A (Hewlett Packard). The scanned images are analyzed using e.g., the Microarray Suite software No. 5 and the level of gene expression is determined in arbitrary units. The observed expression pattern is then compared to the expression pattern of PTSD affected individuals as illustrated in Table 2 and a differential expression of at least some or preferably all of the 574 genes described above is indicative of increased predisposition risk of the individual to develop PTSD. It will be appreciated that the reagents utilized by the method of determining predisposition to develop PTSD according to the present invention and which are described hereinabove can form a part of a kit.
Thus, according to another aspect of the present invention there is provided a kit for determining predisposition of a subject to develop PTSD. The kit includes at least 10 and no more than 574 polynucleotides, each of which can specifically bind at least one polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
The polynucleotides used by the kit of the present invention can be naturally occurring or synthetic polynucleotides such as oligonucleotides, RNA molecules, genomic DNA molecules, cDNA molecules and/or cRNA molecules. Preferably, the polynucleotides used by the kit of present invention are of at least 10 and no more than 50 nucleic acids in length, more preferably, at least 15 and no more than 45, more preferably, between 15-40, more preferably, between 20-35, more preferably, between
20-30, most preferably, between 20-25 nucleic acids in length. It will be appreciated that such polynucleotides can be bound to a solid support e.g., a glass wafer in a specific order, i.e., in the form of a microarray. Alternatively, oligonucleotides of an array can be synthesized directly on the solid support using well known prior art approaches (Seo TS, et al., 2004, Proc. Natl. Acad. Sci. USA, 101: 5488-93.). In any case, the oligonucleotides are attached to the support in a location specific manner such that each specific oligonucleotide has a specific address on the support {i.e., an addressable location) which denotes the identity {i.e., the sequence) of that specific oligonucleotide.
According to preferred embodiments of the present invention the kit includes a microarray of 10-574 oligonucleotides, each of 20-25 nucleic acids in length, which correspond to the 574 polynucleotide sequences described hereinabove and which are listed in Table 2. Preferably, such a kit includes 120-130 oligonucleotides corresponding to the polynucleotide sequences exhibiting a p-value of less than 0.047 as listed in Table 2 and described hereinabove. Table 1 Gene expression level in M4 samples
Figure imgf000024_0001
Figure imgf000025_0001
Figure imgf000026_0001
Figure imgf000027_0001
Figure imgf000028_0001
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Table 1: Differentially expressed genes in PTSD subjects at 4 months following a trauma are presented (<Affymetrix ID NO.>_at_<GeneBank Accession No.>) along with the normalized gene expression values in each study subject and the overall regulation of gene expression (Expres), i.e., upregulation (Up) or Downregulation (Down) in PTSD subjects as compared with control subjects. P- values represent the significance of the changes in gene expression between PTSD subjects and controls.
Table 2 Gene expression level in ER samples
Figure imgf000032_0001
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
Figure imgf000036_0001
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Table 2: Differentially expressed genes in PTSD subjects immediately following a trauma are presented (<Affymetrix ID NO>_at_<GeneBank Accession No.>) along with the normalized gene expression values in each study stubject and the overall regulation of gene expression (Expres), i.e., Upregulation (Up) or Downregulation (Down) in PTSD subjects as compared with control subjects. P-values represent the significance of the changes in gene expression between PTSD subjects and controls. Table 3 Description of PTSD differentiating gene
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000049_0001
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001
Figure imgf000053_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0001
Figure imgf000075_0001
Figure imgf000076_0001
Table 3: Differentially expressed genes in PTSD at the ER and four months following a trauma are presented (<Affymetrix ID NO.>_at_<GeneBank Accession No.>) along with the gene description.
Preferably, the kit further includes at least one reagent as described hereinabove which is suitable for hybridization of the polynucleotides and at least one RNA transcript. Examples include, but are not limited to formamϊde, sodium chloride, and sodium citrate. According to preferred embodiments the kit further comprising packaging material packaging at least one reagent and a notification in or on the packaging material. Such a notification identifies the kit for use in determining predisposition to PTSD in the subject.
The kit also includes the appropriate instructions for use and labels indicating FDA approval for use in vitro.
The method and kit of determining predisposition to develop PTSD can be used to determine suitability of individuals who experienced a life threatening traumatic event and exhibit symptoms of acute stress disorder to an anti-PTSD treatment. This is of particular importance since current anti-PTSD treatment regimens include antidepressant, anxiolytic or antipsychotic agents which may often result in severe side effects such as sedation, tiredness, movement problems, weight gain, excessive salivation and dizziness. As a result, in some cases such a treatment is employed on individuals which are unlikely to develop chronic PTSD. On the other hand, in other cases, such a treatment is withheld from individuals which are at risk of developing chronic PTSD but are mis-diagnosed.
As is shown in Figures Ic, f and h, Table 1 and in Examples 1 and 2 of the
Examples section which follows, subjects with the full, consistent - PTSD - phenotype exhibit distinct signatures of gene expression which are significantly different from those of subjects who did not meet the criteria of PTSD at one and four months following a traumatic event.
Thus, according to another aspect of the present invention there is provided a method of diagnosing PTSD in a subject. The term "diagnosing" refers to determining the existence of a disease, which generally involves the evaluation of a patient's medical history, clinical symptoms and laboratory test results. Methods of diagnosing PTSD are known in the art and include, for example, the Clinician Administered PTSD Scale (CAPS, Blake DD, et al. 1990; Behavior Therapist 13:187 -188), a structured clinical interview following the DSM IV diagnostic criteria for PTSD [Diagnostic and Statistical Manual of Mental Disorders - Fourth Edition (DSM-IV), The American Psychiatric Association, Washington D.C., 1994]. In addition, the severity of PTSD symptoms can be assessed using the Revised Impact of Events Scale (IES; Horowitz, M., et al., 1979; Psychosom. Med. 41: 209-218; Weiss DS and Marmar CR. The Impact of Event Scale-Revised. In Wilson JP, Keane TM Eds. Assessing Psychological Trauma and PTSD. New York, Guilford Press 1997:399- 411). The diagnosis of PTSD is made if the symptoms of arousal, intrusion and avoidance which are described hereinabove last for more than one month. It will be appreciated that in cases where such symptoms last for less than a month, the diagnosis of acute stress disorder is made. The method is effected by detecting in a cell sample of the subject the expression level of at least 10 and no more than 408 polynucleotide sequences, each of which being at least 80 % identical to at least one specific polynucleotide from the set of polynucleotides set forth by SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570, and 575-904.
Since as is shown in Table 1, a portion of the 408 polynucleotides exhibit a smaller p-value, i.e., a more significant differential expression in PTSD subjects, the method is preferably effected by detecting the expression level of at least 10 and no more than 273 polynucleotides of a set including SEQ ID NOs: 17, 582, 583, 584, 595, 596, 606, 613, 614, 620 ,624, 626, 629, 634, 637, 638, 642, 644, 645, 646, 653, 655, 663, 669, 670, 671, 678, 680, 681, 684, 685, 688, 689, 710, 711, 717, 721, 728, 735, 736, 741, 743, 753, 756, 327, 771, 774, 779, 782, 786, 787, 789, 791, 792, 794, 795, 808, 811, 814, 820, 823, 829, 831, 838, 839, 840, 842, 845, 474, 850, 854, 855, 860, 870, 877, 879, 530, 886, 887, 888, 890, 892, 896, 897, 901, 902, 903, 904, 575, 7, 578, 579, 12, 580, 581, 585, 586, 587, 35, 589, 591, 593, 599, 601, 602, 62, 605, 607, 608, 610, 611, 81, 615, 616, 619, 623, 93, 627, 628, 631, 633, 636, 107, 640, 643, 647, 648, 650, 652, 129, 656, 657, 658, 139, 662, 154, 164, 672, 169, 170, 675, 676, 174, 185, 186, 686, 194, 687, 690, 692, 694, 696, 699, 214, 700, 221, 701, 702, 703, 236, 706, 707, 708, 712, 713, 714, 718, 248, 252, 253, 255, 257, 724, 725, 727, 275, 277, 278, 734, 283, 737, 740, 296, 744, 747, 748, 750, 752, 754, 755, 320, 757, 759, 760, 761, 762, 763, 767, 769, 770, 772, 342, 344, 775, 777, 348, 785, 788, 790, 376, 377, 793, 796, 797, 798, 799, 394, 801, 397, 802, 803, 805, 806, 807, 810, 813, 817, 821, 822, 824, 825, 826, 442, 827, 452, 830, 833, 834, 836, 837, 846, 848, 475, 849, 851 ,483, 857, 859, 861, 862, 505, 867, 868, 872, 873, 874, 875, 876, 878, 881, 882, 526, 531, 884, 889, 891, 893, 895, 561, 563, 565, 900, and 570.
As is mentioned above, the diagnosis of PTSD is made if the characteristic symptoms of arousal, avoidance and intrusion last for more than one month. Thus, according to preferred embodiments of the present invention detecting the level of expression is preferably performed within a time period of 1-4 months following a traumatic event, more preferably, 2-4 months, more preferably, 3-4 months, most preferably, 4 months following a traumatic event.
Thus, the method according to this aspect of the present invention can be used to diagnose PTSD in an individual which has experienced a traumatic event such as a motor car accident or act of terror. Briefly, four months following the traumatic event, a blood sample is drawn from the individual and the expression pattern of approximately 273 polynucleotide sequences which are listed in Table 1 and exhibit a p-value of less than
0.016 is determined for RNA molecules obtained from PBMCs, essentially as described hereinabove. The observed expression pattern is then compared to the expression pattern of PTSD affected individuals as illustrated in Table 1. Differential expression of at least some and preferably all of the 408 gene transcripts described above is indicative of positive PTSD diagnosis in the individual.
It will be appreciated that the reagents utilized by the method of diagnosing PTSD according to the present invention and which are described hereinabove can form a part of a kit.
Such a kit includes at least 10 and no more than 408 polynucleotides as described hereinabove.
It will be appreciated that since upregulation or downregulation of specific genes is associated with increased predisposition to develop PTSD, downregulation or upregulation, respectively, thereof can be utilized to prevent chronic PTSD. Thus, according to another aspect of the present invention there is provided a method of preventing PTSD in an individual predisposed to PTSD.
The term "preventing" as used herein refers to avoiding the progression of chronic PTSD. As used herein, the phrase "an individual predisposed to PTSD" refers to any individual as described hereinabove which is likely to develop chronic PTSD. It will be appreciated that the phrase "an individual predisposed to PTSD" encompasses also an individual which is identified as predisposed to PTSD according to the teachings of the present invention. The method is effected by regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 thereby preventing PTSD in the individual.
As used herein, the term "regulating" refers to upregulating (i.e., increasing) or downregulating (i.e., inhibiting or decreasing) of the expression and/or activity of at least one gene as mentioned hereinabove.
According to preferred embodiments of the present invention regulating is upregulating the expression level and/or an activity of at least one gene and/or gene product thereof selected from the group consisting of SEQ ID NOs: 2-5, 7-13, 15, 16, 18- 21, 23, 26-31, 34-42, 44-53, 55-58, 60, 62-68, 71, 73, 75, 77-87, 89-96, 98-104, 106-111, 113, 115-119, 123, 124, 126-134, 138, 139, 141, 142, 144-149, 151-155, 157, 159, 161, 162, 164-166, 168-179, 181-186, 188-190, 192-198, 200-204, 206-221, 223-234, 236- 250, 252-264, 266, 268-303, 305-317, 320-325, 329-338, 340-353, 355, 357-367, 370- 373, 376-381, 383, 384, 386-397, 399, 400, 403-405, 407, 408, 410, 411, 415-422, 425, 427-438, 440, 442-468, 470, 471, 473, 475-477, 479, 481-490, 492-494, 496, 497, 499, 500, 503-509, 511-527, 529, 531-546, 548, 550, 552, 553, 558-561, 563-567, and 570- 574, which is referred to as a "downregulated gene of the present invention" hereinafter.
Upregulation of the downregulated gene of the present invention can be effected at the genomic level (i.e., activation of transcription via promoters, enhancers, regulatory elements), at the transcript level (i.e., correct splicing, polyadenylation, activation of translation) or at the protein level (i.e., post-translational modifications, interaction with substrates and the like).
Following is a list of agents capable of upregulating the expression level and/or activity of the downregulated gene of the present invention.
An agent capable of upregulating expression level of the downregulated gene of the present invention may be an exogenous polynucleotide sequence designed and constructed to express at least a functional portion of the downregulated gene protein.
The phrase "functional portion" as used herein refers to part of the protein product of the downregulated gene of the present invention which exhibits functional properties of the protein such as binding to a substrate. To express the exogenous downregulated gene of the present invention in mammalian cells, a polynucleotide sequence encoding the downregulated gene of the present invention [(e.g., GenBank Accession number AF065482 (SEQ ID NO:7) or AB020658 (SEQ ID NO: 12)] is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
It will be appreciated that the nucleic acid construct of the present invention can also utilize sequences which are homologous to the downregulated gene of the present invention, i.e., at least 80 % identical as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals —9.
Constitutive promoters suitable for use with the present invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters suitable for use with the present invention include for example the tetracycline-inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
The nucleic acid construct (also referred to herein as an "expression vector") of the present invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.
Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for the present invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N. Y. 1983, which is incorporated herein by reference.
In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation of the downregulated gene of the present invention. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for the present invention include those derived from SV40. In addition to the elements already described, the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
The expression vector of the present invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by the present invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
Recombinant viral vectors are useful for in vivo expression of the downregulated gene of the present invention since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses. It will be appreciated that upregulation of the downregulated gene of the present invention can be also effected by administration of cells expressing the downregulated gene of the present invention into the individual.
Cells expressing the downregulated gene of the present invention can be any suitable cells, such as bone marrow stem cells, mesenchymal stem cells, lymphocyte cells, neural stem cells, and/or endocrine stem cells which are derived from the individuals and are transfected ex vivo with an expression vector containing the polynucleotide designed to express the downregulated gene of the present invention as described hereinabove.
Administration of the cells expressing the downregulated gene of the present invention can be effected using any suitable route such as intravenous, intra peritoneal, and intra-spinal.
Cells expressing the downregulated gene of the present invention can be derived from either autologous sources such as self bone marrow cells or from allogeneic sources such as bone marrow or other cells derived from non-autologous sources. Since non- autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non- autologous cells. These include either suppressing the recipient immune system or encapsulating the non-autologous cells or tissues in immunoisolating, semipermeable membranes before transplantation. Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludagj H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64).
Methods of preparing microcapsules are known in the arts and include for example those disclosed by Lu MZ, et al., Cell encapsulation with alginate and alpha- phenoxycinnamylidene-acetylated poly(allylamine). Biotechnol Bioeng. 2000, 70: 479- 83, Chang TM and Prakash S. Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms. MoI Biotechnol. 2001, 17: 249-60, and Lu MZ, et al., A novel cell encapsulation method using photosensitive poly(allylamine alpha- cyanocinnamylideneacetate). J Microencapsul. 2000, 17: 245-51.
For example, microcapsules are prepared by complexing modified collagen with a ter-polymer shell of 2-hydroxyethyl methylacrylate (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA), resulting in a capsule thickness of 2-5 μm. Such microcapsules can be further encapsulated with additional 2-5 μm ter-polymer shells in order to impart a negatively charged smooth surface and to minimize plasma protein absorption (Chia, S.M. et al. Multi-layered microcapsules for cell encapsulation Biomaterials. 200223: 849-56).
Other microcapsules are based on alginate, a marine polysaccharide (Sambanis, A. Encapsulated islets in diabetes treatment. Diabetes Thechnol. Ther. 2003, 5: 665-8) or its derivatives. For example, microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guanidine) hydrochloride in the presence of calcium chloride.
It will be appreciated that cell encapsulation is improved when smaller capsules are used. Thus, the quality control, mechanical stability, diffusion properties, and in vitro activities of encapsulated cells improved when the capsule size was reduced from 1 mm to 400 μm (Canaple L. et al., Improving cell encapsulation through size control. J Biomater Sci Polym Ed. 2002; 13: 783-96). Moreover, nanoporous biocapsules with well-controlled pore size as small as 7 nm, tailored surface chemistries and precise microarchitectures were found to successfully immunoisolate microenvironments for cells (Williams D. Small is beautiful: microparticle and nanoparticle technology in medical devices. Med Device Technol. 1999, 10: 6-9; Desai, T.A. Microfabrication technology for pancreatic cell encapsulation. Expert Opin Biol Ther. 2002, 2: 633-46).
An agent capable of upregulating the downregulated gene of the present invention may also be any compound which is capable of increasing the transcription, translation and/or activity of an endogenous DNA, mRNA or protein encoded by the downregulated gene of the present invention and thus increasing endogenous activity of the downregulated gene of the present invention.
An agent capable of upregulating the downregulated gene of the present invention may also be an exogenous polypeptide including at least a functional portion (as described hereinabove) of the downregulated gene of the present invention.
According to preferred embodiments of the present invention regulating is downregulating an expression level and/or an activity of at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 1, 6, 14, 17, 22, 24, 25, 32, 33, 43, 54, 59, 61, 69, 70, 72, 74, 76, 88, 97, 105, 112, 114, 120, 121, 122, 125,
135, 136, 137, 140, 143, 150, 156, 158, 160, 163, 167, 180, 187, 191, 199, 205, 222, 235,
251, 265, 267, 304, 318, 319, 326, 327, 328, 339, 354, 356, 368, 369, 374, 375, 382, 385,
398, 401, 402, 406, 409, 412, 413, 414, 423, 424, 426, 439, 441, 469, 472, 474, 478, 480,
491, 495, 498, 501, 502, 510, 528, 530, 547, 549, 551, 554-557, 562, 568, and 569, which is referred to as an "upregulated gene of the present invention" hereinafter.
Downregulation of the upregulated gene of the present invention can be effected on the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation (e.g., antisense, siRNA, Ribozyme, DNAzyme), or on the protein level using e.g., antagonists, enzymes that cleave the polypeptide and the like.
Following is a list of agents capable of downregulating expression level and/or activity of the upregulated gene of the present invention.
One example, of an agent capable of downregulating the upregulated gene of the present invention is an antibody or antibody fragment capable of specifically binding the upregulated gene of the present invention. Preferably, the antibody specifically binds at least one epitope of the upregulated gene of the present invention. As used herein, the term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds.
Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
The term "antibody" as used in this invention includes intact molecules as well as functional fragments thereof, such as Fab, F(ab')2, and Fv that are capable of binding to macrophages. These functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (5) Single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
Methods of producing polyclonal and monoclonal antibodies as well as fragments thereof are well known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).
Antibody fragments according to the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment. Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. For example, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5 S fragment denoted F(ab')2. This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage δδ of disulfide linkages, to produce 3.5S Fab' monovalent fragments. Alternatively, an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly. These methods are described, for example, by Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647, and references contained therein, which patents are hereby incorporated by reference in their entirety. See also Porter, R. R. [Biochem. J. 73: 119-126 (1959)]. Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody. Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Nat'l Acad. Sci. USA 69:2659-62 (1972O]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise VH and VL chains connected by a peptide linker. These single-chain antigen binding proteins (sFv) are prepared by constructing a structural gene comprising DNA sequences encoding the VH and VL domains connected by an oligonucleotide. The structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains. Methods for producing sFvs are described, for example, by [Whitlow and Filpula, Methods 2: 97-105 (1991); Bird et al, Science 242:423-426 (1988); Pack et al, Bio/Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety.
Another form of an antibody fragment is a peptide coding for a single complementarity-determining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)].
Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et ah, Nature, 321:522-525 (1986); Riechmann et al, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co- workers [Jones et al, Nature, 321:522-525 (1986); Riechmann et al, Nature 332:323-327 (1988); Verhoeyen et al, Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. MoI. Biol., 227:381 (1991); Marks et al, J. MoI. Biol., 222:581 (1991)]. The techniques of Cole et a\. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al, J. Immunol., 147(l):86-95 (1991)]. Similarly, human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al, Bio/Technology 10,: 779-783 (1992); Lonberg et al, Nature 368: 856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al, Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, 65-93 (1995).
Another agent capable of downregulating the upregulated gene of the present invention is a small interfering RNA (siRNA) molecule. RNA interference is a two step process. The first step, which is termed as the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA), probably by the action of Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which processes (cleaves) dsRNA (introduced directly or via a transgene or a virus) in an ATP- dependent manner. Successive cleavage events degrade the RNA to 19-21 bp duplexes (siRNA), each with 2-nucleotide 3' overhangs [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); and Bernstein Nature 409:363-366 (2001)].
In the effector step, the siRNA duplexes bind to a nuclease complex to from the RNA-induced silencing complex (RISC). An ATP-dependent unwinding of the siRNA duplex is required for activation of the RISC. The active RISC then targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); Hammond et al. (2001) Nat. Rev. Gen. 2:110-119 (2001); and Sharp Genes. Dev. 15:485-90 (2001)]. Although the mechanism of cleavage is still to be elucidated, research indicates that each RISC contains a single siRNA and an RNase [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)].
Because of the remarkable potency of RNAi, an amplification step within the RNAi pathway has been suggested. Amplification could occur by copying of the input dsRNAs which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC [Hammond et al. Nat. Rev. Gen. 2:110-119 (2001), Sharp Genes. Dev. 15:485-90 (2001); Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)]. For more information on RNAi see the following reviews Tuschl ChemBiochem. 2:239-245 (2001); Cullen Nat. Immunol. 3:597-599 (2002); and Brantl Biochem. Biophys. Act. 1575:15-25 (2002). Synthesis of RNAi molecules suitable for use with the present invention can be effected as follows. First, the mRNA sequence of the upregulated gene of the present invention is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl, T. 2001, ChemBiochem. 2:239-245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5' UTR mediated about 90 % decrease in cellular GAPDH mRNA and completely abolished protein level (www.ambion.com/techlib/tn/91/912.html).
Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov/BLAST/). Putative target sites which exhibit significant homology to other coding sequences are filtered out. Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene. Another agent capable of downregulating the upregulated gene of the present invention is a DNAzyme molecule capable of specifically cleaving an mRNA transcript or DNA sequence of the upregulated gene of the present invention. DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences (Breaker, R.R. and Joyce, G. Chemistry and Biology 1995;2:655; Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 1997;943:4262). A general model (the "10-23" model) for the DNAzyme has been proposed. "10-23" DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 199; for rev of DNAzymes see Khachigian, LM [Curr Opin MoI Ther 4:119-21 (2002)].
Examples of construction and amplification of synthetic, engineered DNAzymes recognizing single and double-stranded target cleavage sites have been disclosed in U.S. Pat. No. 6,326,174 to Joyce et al. DNAzymes of similar design directed against the human Urokinase receptor were recently observed to inhibit Urokinase receptor expression, and successfully inhibit colon cancer cell metastasis in vivo (Itoh et al, 20002, Abstract 409, Ann Meeting Am Soc Gen Ther. www.asgt.org). In another application, DNAzymes complementary to bcr-abl oncogenes were successful in inhibiting the oncogenes expression in leukemia cells, and lessening relapse rates in autologous bone marrow transplant in cases of CML and ALL. Downregulation of the upregulated gene of the present invention can also be effected by using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding the upregulated gene of the present invention.
Design of antisense molecules which can be used to efficiently downregulate the upregulated gene of the present invention must be effected while considering two aspects important to the antisense approach. The first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells, while the second aspect is design of an oligonucleotide which specifically binds the designated mRNA within cells in a way which inhibits translation thereof. The prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, for example, Luft J MoI Med 76: 75-6 (1998); Kronenwett et al. Blood 91: 852-62 (1998); Rajur et al. Bioconjug Chem 8: 935-40 (1997); Lavigne et al. Biochem Biophys Res Commun 237: 566-71 (1997) and Aoki et al (1997) Biochem Biophys Res Commun 231: 540-5 (1997)].
In addition, algorithms for identifying those sequences with the highest predicted binding affinity for their target mRNA based on a thermodynamic cycle that accounts for the energetics of structural alterations in both the target mRNA and the oligonucleotide are also available [see, for example, Walton et al. Biotechnol Bioeng 65: 1-9 (1999)]. Such algorithms have been successfully used to implement an antisense approach in cells. For example, the algorithm developed by Walton et al. enabled scientists to successfully design antisense oligonucleotides for rabbit beta-globin (RBG) and mouse tumor necrosis factor-alpha (TNF alpha) transcripts. The same research group has more recently reported that the antisense activity of rationally selected oligonucleotides against three model target mRNAs (human lactate dehydrogenase A and B and rat gpl30) in cell culture as evaluated by a kinetic PCR technique proved effective in almost all cases, including tests against three different targets in two cell types with phosphodiester and phosphorothioate oligonucleotide chemistries.
In addition, several approaches for designing and predicting efficiency of specific oligonucleotides using an in vitro system were also published (Matveeva et al., Nature Biotechnology 16: 1374 - 1375 (1998)].
Several clinical trials have demonstrated safety, feasibility and activity of antisense oligonucleotides. For example, antisense oligonucleotides suitable for the treatment of cancer have been successfully used [Holmund et ah, Curr Opin MoI Ther 1:372-85 (1999)], while treatment of hematological malignancies via antisense oligonucleotides targeting c-myb gene, p53 and Bcl-2 had entered clinical trials and had been shown to be tolerated by patients [Gerwitz Curr Opin MoI Ther 1:297-306 (1999)].
More recently, antisense-mediated suppression of human heparanase gene expression has been reported to inhibit pleural dissemination of human cancer cells in a mouse model [Uno et al., Cancer Res 61:7855-60 (2001)].
Thus, the current consensus is that recent developments in the field of antisense technology which, as described above, have led to the generation of highly accurate antisense design algorithms and a wide variety of oligonucleotide delivery systems, enable an ordinarily skilled artisan to design and implement antisense approaches suitable for downregulating expression of known sequences without having to resort to undue trial and error experimentation.
Another agent capable of downregulating the upregulated gene of the present invention is a ribozyme molecule capable of specifically cleaving an mRNA transcript encoding the upregulated gene of the present invention. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)]. The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders [Welch et al, Clin Diagn Virol. 10:163-71 (1998)]. Most notably, several ribozyme gene therapy protocols for HIV patients are already in Phase 1 trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials. ANGIOZYME was the first chemically synthesized ribozyme to be studied in human clinical trials. ANGIOZYME specifically inhibits formation of the VEGF-r (Vascular
Endothelial Growth Factor receptor), a key component in the angiogenesis pathway.
Ribozyme Pharmaceuticals, Inc., as well as other firms have demonstrated the importance of anti-angiogenesis therapeutics in animal models. HEPTAZYME, a ribozyme designed to selectively destroy Hepatitis C Virus (HCV) RNA, was found effective in decreasing
Hepatitis C viral RNA in cell culture assays (Ribozyme Pharmaceuticals, Incorporated -
WEB home page).
Another agent capable of downregulating the upregulated gene of the present invention would be any molecule which binds to and/or cleaves the upregulated gene of the present invention. Such molecules can be antagonists or inhibitory peptides of the upregulated gene of the present invention.
It will be appreciated that a non-functional analogue of at least a catalytic or binding portion of the upregulated gene of the present invention can be also used as a suitable downregulating agent. Another agent which can be used along with the present invention to downregulate the upregulated gene of the present invention is a molecule which prevents activation or substrate binding of the upregulated gene of the present invention.
It will be appreciated that since upregulation or downregulation of specific genes is associated with the existence of chronic PTSD (see Example 2 of the Examples section which follows) downregulation or upregulation, respectively, thereof can be utilized to treat individuals suffering from chronic PTSD.
Thus, according to another aspect of the present invention there is provided a method of treating PTSD in an individual suffering from PTSD.
The phrase "treating" refers to inhibiting or arresting the development of a disease, disorder or condition and/or causing the reduction, remission, or regression of a disease, disorder or condition in an individual suffering from, or diagnosed with, the disease, disorder or condition. Those of skill in the art will be aware of various methodologies and assays which can be used to assess the development of a disease, disorder or condition, and similarly, various methodologies and assays which can be used to assess the reduction, remission or regression of a disease, disorder or condition. As used herein, the phrase "individual suffering from PTSD" refers to an individual which experienced a traumatic event as described hereinabove, and exhibits the full phenotype of PTSD as evaluated following at least one month of the trauma. The phrase "individual suffering from PTSD" encompasses also individual who is diagnosed with PTSD according to the teachings of the present invention which are described hereinabove.
The method comprising regulating an expression level of at least one gene selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 thereby treating PTSD in the individual.
According to preferred embodiments of the present invention the term "regulating" refers to upregulating (as described above) the expression level and/or an activity of at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 7, 10, 12, 18, 20, 35, 62, 79, 81, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 331, 342, 344, 348, 352, 372, 376, 377, 378 ,383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 475, 483, 504, 505, 523, 526, 531, 559, 561, 563, 565, 570, 575-581, 585-591, 593, 597-602, 604, 605, 607-612, 615-617, 619, 622, 623, 627, 628, 631-633, 635, 636, 639, 640, 643, 647, 648, 650, 651, 652, 656-662, 664, 666-668, 672, 674-677, 679, 682, 686, 687, 690, 692-703, 706-708, 712-715, 718, 719, 722-727, 730-731, 734, 737-740, 742, 744, 746-752, 754, 755, 757, 759-763, 765- 770, 772, 773, 775, 777, 778, 780, 781, 783-785, 788, 790, 793, 796-807, 810, 812, 813, 817, 818, 821, 822, 824-827, 830, 832-837, 843, 844, 846-849, 851-853, 856-859, 861- 864, 866-869, 872-876, 878, 880-884, 889, 891, 893, 895, 899, and 900.
According to preferred embodiments of the present invention the term "regulating" is downregulating (as described above) the expression level and/or an activity of at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:17, 88, 327, 474, 530, 582-584, 592, 594-596, 603, 606, 613, 614, 618, 620, 621, 624-626, 629, 630, 634, 637, 638, 641, 642, 644-646, 649, 653-655, 663, 665, 669-671, 673, 678, 680, 681, 683-685, 688, 689, 691, 704, 705, 709-711, 716, 717, 720, 721, 728, 729, 732, 733, 735, 736, 741, 743, 745, 753, 756, 758, 764, 771, 774, 776, 779, 782, 786, 787, 789, 791, 792, 794, 795, 808, 809, 811, 814-816, 819, 820, 823, 828, 829, 831, 838-842, 845, 850, 854, 855, 860, 865, 870, 871, 877, 879, 885-888, 890, 892, 894, 896-898, and 901-904.
Thus, the teachings of the present invention can be used to prevent and/or treat PTSD in an individual which experienced a life-threatening traumatic event. For example, an expression vector (e.g., a viral vector) including a polynucleotide sequence encoding the downregulated gene of the present invention (e.g., SEQ ID NO:26 which can be used in preventing PTSD and SEQ ID NO: 7 which can be used in treating PTSD) and the suitable promoter sequences to enable expression in brain cells is introduced into the individual via, e.g., intravenous administration. Expression of such a vector in the brain is expected to upregulate the expression level and/or activity of the downregulated gene in such cells and thus to prevent and/or reduce the symptoms of PTSD (e.g., hallucinatory experiences). Dosage of such an expression vector should be calibrated using cell culture experiments and animal models. Success of treatment is preferably evaluated by determining the individual mental status using for example the Clinician Administered PTSD Scale and the Revised Impact of Events Scale.
Alternatively, the prevention and/or treatment of PTSD can be also accomplished using for example, an siRNA molecule. For example, a suitable siRNA molecule which can be used to prevent or treat PTSD is the 5'- uguuccacaucgccugcuuca -3' (SEQ ID NO:905) or the 5'- caucgugauucuccagcucaa -3' (SEQ ID NO:906) which can specifically cleave the transcript of zyxin (SEQ ID NO:1) or ELA2, a neutrophil specific elastase 2 (SEQ ID NO: 17), respectively. Such an siRNA molecule can be administered to the individual using intravenous administration. It will be appreciated that dosage and duration of treatment can vary between individuals, depending on the individual general health status and severity of PTSD symptoms. Each of the upregulating or downregulating agents described hereinabove or the expression vector encoding the downregulated gene of the present invention can be administered to the individual per se or as part of a pharmaceutical composition which also includes a physiologically acceptable carrier. The purpose of a pharmaceutical composition is to facilitate administration of the active ingredient to an organism. As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
Herein the term "active ingredient" refers to the upregulating or downregulating agent or the expression vector encoding the downregulated gene of the present invention which are accountable for the biological effect.
Hereinafter, the phrases "physiologically acceptable carrier" and
"pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.
Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.
Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient. Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use. The pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (the upregulating or downregulating agent or the expression vector encoding the downregulated gene) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., avoidance, intrusion and arousal) or prevent the consistence full-PTSD phenotype in the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models [such as those described in Kaufer, 1998 (Supra)] to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l). Dosage amount and interval may be adjusted individually to provide plasma levels of the active ingredient are sufficient to prevent and/or treat PTSD (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved. The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above. As used herein the term "about" refers to ± 10 %.
Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.
EXAMPLES
Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., Ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (Eds.) "Genome Analysis: A Laboratory Manual Series", VoIs. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., Ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., Ed. (1994); Stites et al. (Eds.), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (Eds.), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., Ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., Eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. L, Ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
EXAMPLE 1 EVALUATION OF POST TRAUMATIC STRESS DISORDER (PTSD) IN TRAUMA
SURVIVORS
Trauma survivors were evaluated for the presence of acute, chronic and consistent post traumatic stress disorder (PTSD), as follows. Clinical and Statistical Methods
Study subjects — Study subjects were individuals who survived a trauma and were admitted to the emergency room immediately following a traumatic event (mean time between incident and arrival was 45 ± 130 minutes). Trauma survivors were evaluated for the presence of acute and chronic PTSD at one and four months following a trauma event according to the DSM IV diagnostic criteria [Diagnostic and Statistical Manual of
Mental Disorders - Fourth Edition (DSM-IV), The American Psychiatric Association,
Washington D.C., 1994]. The study's recruitment and follow-up procedures were essentially as described elsewhere (Freedman SA, et al., 1999. Br. J. Psychiatry; 174: 353-359). Briefly, inclusion criteria included subjects at the ages of 18-65, who met the DSM IV diagnostic criterion at one and four months following a trauma. The control group included subjects who experience the trauma but did not meet any of the DSM IV diagnostic criterion following one month. Exclusion criteria were the presence of a head, burn or serious physical injury, the presence or history of alcohol or illicit drugs abuse, psychiatric diagnoses other than depressive or anxiety disorders, or a medical or neurological illness that could confound the assessments.
PTSD evaluation - PTSD status at one and four months was determined using the Clinician Administered PTSD Scale (CAPS, Blake DD, et al. 1990; Behavior Therapist 13:187 -188), a structured clinical interview following the DSM IV diagnostic criteria for PTSD. The co-occurrence of other mental disorders was ascertained by the Structured Clinical Interview for DSM IV Mental Disorders (SCID, Spitzer RL, et al., 1994; Biometric Research Department, New York State Psychiatric Institute). Trauma severity was assessed using a trauma severity scale (Shalev et al., 1998; American Journal of Psychiatry, 155:630-637) addressing the severity of the event in terms of threat to own life, and exposure to others dead or wounded or other horrific sights. PTSD symptom severity was assessed using the Revised Impact of Events Scale (IES; Horowitz, M., et al., 1979; Psychosom. Med. 41: 209-218; Weiss DS and Marmar CR. The Impact of Event Scale-Revised. In Wilson JP, Keane TM Eds. Assessing Psychological Trauma and PTSD. New York, Guilford Press 1997:399-411), by scoring three symptom clusters of PTSD: re-experiencing, avoidance and hyper arousal, or the total IES score summarizing all PTSD symptoms.
Clinical and Statistical Results
Evaluation of PTSD in trauma survivors - Survivors of life threatening events that did not sustain serious physical injury, were followed at the time of admittance to a general hospital emergency room (ER) shortly after trauma, as well as one and four months following the trauma. Trauma survivors were evaluated for the diagnosis of PTSD using the avoidance, intrusion and arousal clusters of symptoms. As is shown in Table 4, hereinbelow, out of the twenty-four trauma survivors, eight subjects exhibited persistent full diagnostic criteria at both one and four months after trauma (PTSD - consistent phenotype subjects) and six subjects met no formal clinical criterion for PTSD at any time (control - consistent phenotype subjects). Five subjects exhibited partial intermediate PTSD clinical criteria at one month and full criteria at four months following a trauma, and five other subjects exhibited partial intermediate PTSD clinical criteria at one month which were resolved at four month (i.e., partial phenotype subjects).
Table 4
O <1
Figure imgf000108_0001
Table 4: Clinical diagnosis of PTSD following one (acute PTSD, Ml) or four months (chronic PTSD, M4) after trauma. Y = yes, full blown acute (one month) or chronic (four m diagnostic criteria for PTSD; Pa = partial, sub-threshold criteria for acute (one month) or chronic (four months) PTSD; Gender: 1 = male, 2 = female; Ethnic origin: 1 = Ashkena Jewish, 3 = Jewish of mixed origin; Co-morbid current or past psychiatric diagnoses: 4 = major depressive disorder, 30 = obsessive compulsive disorder, 40 = body dysmorphic disc motor vehicle accident, 2 = other; PBMC Samples: ER = samples taken at the emergency room within one hour following a trauma, M4 = samples taken four months following a trε
Development of full consistent PTSD phenotype following trauma is independent of personal and demographic variables - The personal and demographic variables of the full consistent PTSD subjects were compared with those of subjects who met no clinical criterion of PTSD at any time. As is shown in Table 5, hereinbelow, the type of trauma, trauma severity scores, age, gender, ethnic origin and psychiatric co¬ morbidity were not significantly different between the two groups. Moreover, multiple logistic regression analysis of age, gender, ethnic origin, trauma severity and co morbid psychiatric diagnoses, with PTSD status at Ml and M4 (eight consistent PTSD vs. six consistent controls, excluding those who had partial PTSD criteria at Ml) as the dependent variable, revealed that none of these variables contributed to PTSD status (not shown).
Table 5
Comparison of personal and demographic variables of full consistent PTSD and Controls
Figure imgf000109_0001
Table 5: Comparison of personal and demographic variables, among subjects with full consistent PTSD at one and four months after trauma vs. controls lacking any formal PTSD criterion at any time after trauma. Subjects with partial PTSD at one month are not included. NS = not-significant using 2- tailed t test (p > 0.1). PTSD status at four months following trauma is independent of personal and demographic variables - Further evaluation of the effect of the personal and demographic variables on the PTSD status at four months following a trauma revealed that the mean age at trauma among M4 PTSD subjects was higher than among M4 controls subjects (35 vs. 26 years, p = 0.05, Table 6, hereinbelow). Similarly, the mean trauma severity score of M4 PTSD subjects was higher than among M4 control subjects (18.15 vs. 13.55, p = 0.086, Table 6). Other parameters such as gender, ethnic origin and co-morbidity with psychiatric diagnoses exhibited no significant differences between M4 PTSD and M4 control subjects (Table 6, hereinbelow). Moreover, multiple logistic regression analysis of age, gender, ethnic origin, trauma severity and co-morbidity, with PTSD status at M4 as the dependent variable, revealed that none of these variables contributed the PTSD status at four months following a trauma.
Table 6
Comparison of personal and demographic variables of PTSD at four months and controls
Figure imgf000111_0001
Table 6: Comparison of personal and demographic variables among subjects exhibiting foil PTSD criteria at month 4 after trauma vs. controls exhibiting no formal criteria by month four (including those expressing a partial clinical PTSD phenotype at one month). NS = not-significant using 2-tailed t test (p > 0.1).
Thus, these results demonstrate that personal and demographic variable such as gender, ethnic origin, type of trauma, and co-morbidity with other psychiatric diagnoses do not affect the presence of PTSD. In addition, these results suggest that an older age at the time of trauma and the trauma severity might contribute to the development of PTSD.
EXAMPLE 2
IDENTIFICATION OF DIFFERENTIALLY EXPRESSED GENES FOLLOWING
TRAUMA
In order to determine gene expression patterns associated with PTSD, gene expression analysis was performed in blood samples taken immediately or four months following a trauma, and the expression pattern was correlated with the presence of acute or chronic PTSD, as follows.
Materials and Methods
Sample preparation and microarray hybridization - Ten ml of blood were drawn by venipuncture from each subject at the ER and four months following exposure to trauma, using EDTA as anticoagulant. Blood samples were kept at room temperature for up to one hour until processing. Peripheral Blood Monocyte Cells (PMBCs) were separated using Histopaque solution gradient (Sigma-Aldrich, USA), immediately transferred to TRIZOL solution (Gibco BRL, USA) and total RNA was extracted according to the array manufacturer's instructions (Affymetrix, Santa Clara, CA). Total RNA was purified using Phase Lock Gel Light tubes (Eppendorf, USA) and the quality of the RNA was assessed by agarose gel electrophorsis (visual absence of degradation of the 28S and 18S RNA) and by spectrophotometry. Double-stranded cDNA was synthesized from 10 μg of RNA using the cDNA synthesis kit (Superscript double stranded cDNA Synthesis, Gibco BRL, USA). The isolated cDNA was used for in vitro transcription in the presence of biotin-11-CTP and biotin-16-UTP using RNA Transcript Labeling Kit (Enzo Diagnostics, Affymetrix Santa Clara, CA). Complementary RNA was purified using RNeasy Mini kit (Qiagen, Germany), precipitated at -20 °C overnight using 7.5 M ammonium acetate (0.4 times of the cRNA volume) (Sigma) and absolute ethanol (2.5 times of the total volume), and washed. Prior to hybridization, a total of 9 μg of the purified cRNA product in 40 mM Tris- acetate (pH 8.1)/ 100 raM potassium acetate/30 mM magnesium acetate was fragmented for 35 min at 94 °C and was mixed with the hybridization mixture containing Herring sperm DNA (0.1 mg/ml; Sigma) and four control bacterial and phage cRNA which serve as internal controls for hybridization efficiency (1.5 pM BioB, 5 pM BioC, 25 pM BioD, and 100 pM Cre) all according to manufacturer's instructions (Affymetrix). Aliquots of the hybridization mixture (containing 9 μg of fragmented cRNA) were hybridized to the HG-U95A and each GENECHIP array was washed and scanned using the GeneArray scanner G2500A (Hewlett Packard) according to procedures developed by manufacturer (Affymetrix). Data Analysis - Scanned output files were visually inspected for hybridization artifacts and then analyzed with GENECHIP 3.1 software (Affymetrix). Arrays were scaled to an average intensity of 100 analyzed independently. The method of determination of whether each RNA species represented on the array was detectable has been previously described (Wodicka L., et al 1997, Nat Biotechnol. 15: 1359-67; Sandy D., et al 1998, PNAS, 95: 15623-15628). The expression value (average difference) for each gene was determined by calculating the average of differences of intensity (perfect match intensity minus mismatch intensity) between the probe pairs. Removal of the batch effect from the array was performed by calculating the average gene expression of each gene within each group and normalizing each expression measurement with the average expression of its group.
The expression analysis files created by GENECHIP 3.1 software were transferred to a database (Microsoft Access) and linked to Internet genome databases (e.g., NHLBI, Swiss Prot, and GeneCards). Mean intensity for each sample was defined as the mean of average differences of individual samples from all subjects. Fold changes were determined by dividing the mean intensity of each sample by the mean intensity derived from all samples. All values below 20 were brought to 20 and all values above 10,000 were brought to 10,000. Genes were identified as active if exhibited at least one value between 50 to 7500, one present call by Microarray Analysis Suite 5.0, and exhibited more than 2-fold change from average value in at least one sample. For further data mining and presentation the SPOTFIRE PRO 3.0 (Spotfire, Goteborg, Sweden) was used. Genes with at least one mean intensity value above 100 and a 2-fold difference in one pair-wise comparison were included in the cluster analysis. Since the fold ratios were calculated by using the mean values of the average differences of several subjects, a change was not considered substantial if it was caused only by a single outstanding value. Expression measurements were transformed to log-ratios by computing geometric average of the expression of each gene in the two groups and transforming each expression measurement to the log (base 2) of the ratio of the expression to the average of its group. The general approach to analysis has been outlined by Kaminski and Friedman, 2002, Am. J. Respir. Cell MoI. Biol. 27: 125-32, and performed using the ScoreGenes software tools (http://compbio.cs.huji.ac.il/scoregenes/, http://genexpress.stanford.edu).
Clustering - Un-supervised clustering was performed using DoublePCluster, an agglomerative hierarchical bi-clustering approach based on similarity in expression profiles. The similarity is measured with a generative probabilistic model identifying an optimal distribution model of the expression values in each of the clusters. In addition, standard hierarchical clustering was performed using the GENE CLUSTER and TREEVIEW programs cluster softwares as well a newly developed cluster analysis algorithm (Eisen MB, et al., 1998; Proc. Natl. Acad. Sci. USA, 95: 14863-14868; Friedman N. PCluster: Probabilistic Agglomerative Clustering of Gene Expression Profile. Technical report 2003-80 School of Computer Science & Engineering, Hebrew University, 2003).
Statistical analysis - Statistical analysis was performed using the ScoreGenes package (http://compbio.cs.huji.ac.il/scoregenes/) essentially as previously described [Kaminski and Friedman, 2002 (Supra)]. The identification of differentially expressed genes was performed using the following statistic tests: Threshold number of misclassiβcations (TNoM): A non-parametric test measuring the number of classification errors committed when using the best simple threshold to distinguish between two classes based on the expression levels of the given gene (Ben-Dor A., et al., 2000; J. Comput. Biol. 7: 559-8346. t-Test - two-tailed t-test to measure whether the mean expression of the gene in the two classes is significantly different.
Info - A non-parametric test estimating the uncertainty remaining about the class of a sample after observing the expression of the individual gene. A lower Info score indicates a higher predictive value for a given gene (Ben-Dor A, et al., 2002. Overabundance Analysis and Class Discovery in Gene Expression Data, Technical Report, 2002-50, School of Computer Science & Engineering, Hebrew University). In all three methods the scores were standardized using p-values that report the probability for observing the score under the null hypothesis. For the t-test, the null hypothesis was that a gene has the same mean in both classes; for the TNoM and ESfFO tests, the null hypothesis was that there is no dependency between gene expression and sample labels. Genes that exhibited a p-value of less than 0.05 in all three scoring methods were considered differentially expressed.
Benchmarking statistical significance - To select the statistically significant number of genes the "Fixed Significance Level" approach was used: all genes exhibiting a p-value of at most 0.05 in all three scoring methods were selected. The requirement that the gene is significant with respect to all three methods decreases the probability of selecting a spurious gene. This significance level was used for generating the genetic signature, and in the LOOCV procedure which was used to predict class assignment.
Differentially expressed signatures - The significance of the number of differentially expressed signatures was determined using a randomized permutation test to compute the probability of selecting that many genes under the null hypothesis of random class assignment.
Overabundance analysis and Pearson correlation - were based on the
ScoreGenes analysis package (http://compbio.cs.huii.ac.il/scoregenes/) by calculating for each p-value the accumulated number of genes that were scored with this p-value or better. The significance of the abundance plot was determined using a randomize permutation test with 1000 random reshufflings of labels.
Prediction of class assignment - Prediction of the label of a new sample was performed using the Naive Bayesian Classifier method (Duda RO, Hart PE. "Pattern Classification and Scene Analysis", John Wiley & Sons, New York, 1973). In this method the probability of gene expression value in each group and the probability of the observed pattern (for selected genes) are computed and the log-odds ratio between the two probabilities is calculated. The sign of the log-odds defines the predicted class, and the magnitude represents the confidence in the prediction.
Leave-one-out cross validation (LOOCV) - The leave-one-out cross validation procedure [Ben-Dor, 2000 (Supra)] was used to evaluate the performance of the classifier on unseen samples.
Experimental Results and Statistical Analyses -
Identification of gene expression patterns associated with PTSD — To identify gene expression profiles associated with PTSD, blood samples drawn within one hour or four months following a trauma were subjected to oligonucleotide hybridization analysis using the Affymetrix HU95A oligonucleotide arrays. As is further shown in Table 4, a total of 33 samples were available for expression profile analyses; of them 18 samples were obtained four months following a trauma (M4) and 15 samples were obtained within one hour following a trauma (ER). Following hybridization, the observed hybridization signals on the chip were quantitated and normalized to reduce background signal, resulting in a set of 4,512 active transcripts which exhibit some variance among the collected profiles.
The expression pattern of all study subjects was analyzed using un-supervised clustering analysis. As is shown in Figure Ia, analysis of samples both time points (ER and M4) partially distinguished between control and PTSD samples; two clusters contained all PTSD samples, and a third cluster contained most of the control samples. However, when samples from ER or M4 alone were subjected to the un-supervised clustering analysis, a nearly perfect (with one misclassified sample, figure Ib) and a perfect (Figure Ic) separation, respectively, was observed between the PTSD and the control samples. These results demonstrate that gene expression patterns observed immediately aftermath of trauma can be used to predict the later development of a PTSD phenotype.
Gene expression patterns discern PTSD status — To identify the most informative view of the core PTSD phenotype gene expression patterns of subjects exhibiting the consistent PTSD phenotype (subjects 1-8 in Table 4) were compared to gene expression patterns of subjects exhibiting no PTSD criteria at any time (subjects 14- 19 in Table 4). This comparison resulted in 656 transcripts which are differentially expressed between PTSD and controls in both ER and M4 (Figure Id). This number is significantly higher than expected by chance (p = 0.007). Moreover, when samples from either ER or M4 were analyzed separately, differentially expressed signatures with 574 (Figure Ie) or 408 (Figure If) transcripts, both of which significantly larger than expected by chance (p values 0.002 or 0.003, respectively), were observed.
To determine the significance of the classification result, the leave-one-out cross (LOOCV) validation procedure was used on unseen samples. The classifier was able to correctly classify 9 out of 11 ER samples (Figure Ig) and 8 out of 9 M4 samples (Figure Ih). Evaluation of the significance of these classifications using the random-permutation tests demonstrated significant classification with M4 samples (p = 0.027), and nearly significant classification with ER samples (p = 0.061).
Further comparison of gene expression patterns between the 13 subjects diagnosed with complete PTSD criteria by 4 months (including the 5 that did not consistently exhibit the complete diagnostic criteria at one month after trauma), and the
11 subjects exhibiting no formal criterion by four months (including the 5 that exhibited partial PTSD criteria at one month but decreased to subthreshold levels and did not meet any formal clinical criteria by 4 months) revealed 220 genes which are differentially expressed four months following a trauma (p < 0.066) but not immediately following a trauma (data not shown).
Altogether, these results demonstrate that signatures of gene expression patterns can differentiate between PTSD subjects both immediately after a trauma (i.e., ER samples) or four months following a trauma (i.e., M4 samples). Moreover, while the differentially expressed genes in signatures observed in ER samples can be used to predict the future development of PTSD, the differentially expressed genes in signatures observed in M4 samples can be used in the diagnosis of PTSD in trauma survivors.
In addition, the results presented in the present invention demonstrate, for the first time, that gene expression signatures can be used to identify a mental disorder (e.g., PTSD). This suggests the more general heuristic prospect that other organ related disorders may be approached through the study of accessible blood cells. EXAMPLE 3
CORRELATION OF GENE EXPRESSION PATTERN WITH SEVERITY OFPTSD
SYMPTOMS
PTSD symptoms include avoidance, re-experiencing, and hyper arousal, each manifesting with a variable intensity among survivors of trauma (Shalev AY., et al.,
1997; Br. J. Psychiatry; 170: 558-564), and each possessing a distinct genetic basis (True
WR, et al. 1993; Arch. Gen. Psychiatry; 50: 257-264), suggesting they represent discrete biological dimensions. To characterize PTSD - associated gene expression pattern the expression pattern of all 24-trauma survivors was correlated with the global symptom severity scores, regardless of the fulfillment of consistent, partial or no clinical diagnostic criteria of PTSD.
Statistical Methods
Correlation between genetic pattern and clinical score - The Pearson correlation was employed to correlate between the expression pattern of each gene in a group of samples and the IES scores in the same group. Experimental Results
Total IES score correlates with trauma severity but not the other personal and demographic variables - To identify factors affecting the overall PTSD symptoms, the
Pearson correlation was employed on the total IES score and the personal and demographic variables of the trauma survivors. As is shown in Table 7, hereinbelow, the total M4 IES score did not show any significant differences between male and female subjects, subjects of different ethnic origins, or subjects with co-morbid psychiatric diagnoses. On the other hand, there was a trend of correlation between IES scores at four months and trauma severity scores (r = 0.359), however, with limited (p = 0.056) significance (Table 7, hereinbelow). A multiple regression analysis revealed that none of these variables contributed to the variance in M4 IES scores. Table 7
Comparison of personal and demographic variables and Pearson correlations with total IES scores
Figure imgf000119_0001
Table 7: Comparison by personal and demographic variables and pearson correlations with total month four Impact of Event Scale (IES) score among all trauma survivors. NS = not- significant using 2-tailed t test (p > 0.1).
Gene expression pattern correlated with the severity of PTSD — To identify expression signatures differentiating subjects exhibiting various degrees of PTSD symptoms the gene expression pattern of samples obtained four months following a trauma was correlated with the PTSD IES scores. As is shown in Figure 2a-c, subjects exhibiting a total IES score of 40 or above shared a common signature of gene expression
(p < 0.05). Similar patterns were observed when gene expression pattern was correlated with the independent PTSD core symptoms: avoidance (Figures 2d-f), intrusion (Figures
2g-i), and hyper arousal (Figures 2j-l). Similar correlations were found among the 15 available ER samples (Figure 3a-l). These results demonstrate the presence of unique expression signatures differentiating subjects with various PTSD IES scores.
Common expression patterns between spectral PTSD symptoms and threshold- defined clinical PTSD - Of the genes expressed at ER and M4 that showed significant correlations with total M4 IES scores amongst all survivors, 369 and 260 transcripts respectively, overlapped with the ER and M4 informative sets of genes that separated the above PTSD and control sub sample. These results suggest a shared biological basis between spectral PTSD symptoms and threshold defined clinical PTSD.
Altogether, these results demonstrate that differentially expressed signatures correlate with each of the main PTSD symptom clusters, and with long term symptom severity among all survivors.
EXAMPLE 4
DOWNREGULATION OF GENESENCODING TRANSCRIPTIONENHANCERS AND CELL CYCLE PROTEINS IN PTSD SUB JECTS To further characterize the expressed signatures differentiating between threshold- defined clinical PTSD and controls the expressed genes were classified according to their function.
Methods
Functional gene group assignments - To find functional annotations enrichment in the different signatures all transcripts were automatically annotated according to Gene Ontology (GO) data base. AU annotations with more than four appearances were taken into consideration. The active transcripts on the chip (4512 transcripts) were defined as the background set. For each annotation, percentage of annotated transcripts in the signatures was compared with the percentage of annotated transcripts in the background. To present expression patterns of informative genes according to functional groups, the differentially expressed genes were manually assigned by extracting GO annotations (through Affymetrix netaffex query system) and extensive literature search (through PubMed and GeneCards).
Assignment of transcripts co-expressed in neuroendocrine tissues — Analysis of transcript expression in normal brain and endocrine tissues was performed by obtaining annotations from OMIM and UniGene and comparing with the U95 microarray transcripts using the Affymetrix netaffex query system. Each transcript was annotated with a tissue or process in which is expressed.
Significance of annotation enrichment or co-expression of transcripts in signatures - The p-value of annotation enrichment or enrichment of co-expressed annotations in each signature as compared with the background set of 4512 active genes was calculated according to hyper geometric distribution model, using GeneXPress software (http://genexpress.stanford.edu). Histograms present all significant annotations in PTSD vs. Control signature that passed False Discovery Rate (FDR) correction of 0.1. Results
Affected trauma survivors exhibit reduced expression of transcription enhancers and distinct immune activation - Gene transcripts differentiating consistent phenotype groups of PTSD and controls were classified according to functional groups. As is shown in Figure 4a transcripts encoding for proteins which are involved in transcriptional activation, cell cycle and proliferation were downregulated among PTSD affected subjects. Noteworthy, similar results were obtained for transcripts differentiating spectral PTSD symptoms subjects from the controls (not shown). In addition, as is shown in Figure 4b, distinct expression signatures for transcripts involved in immune activation, signal transduction and apoptosis were observed. Further quantitation of the distinct expression signatures revealed increased representations (p < 0.0005) of genes involved in RNA metabolism and processing, as well as nucleotide metabolism in the consistent PTSD signature as compared with the total active genes on the chip (Figure 4c). Significant increased representation of GO annotations was also found in the other signatures of genes showing significant correlations of expression levels with M4 IES scores among all survivors (data not shown).
Signatures of affected trauma survivors are significantly enriched with transcripts encoding neural and endocrine proteins - To further pursue how peripheral transcriptional response may be relevant to the neuropsychiatric process, the differentially expressed transcripts were classified according to their known expression pattern in primary tissues involved in the mediation of neural and endocrine reactivity to stress. As is shown in Figures 5a-c, gene transcripts known to be expressed in brain amygdalar and hippocampal regions, and the hypothalamic - pituitary adrenal (HPA) axis were found to be significantly overabundant among genes distinguishing trauma survivors with consistent PTSD from controls. Thus, out of 656 differentially expressed transcripts, 533 are expressed in relevant brain and neuroendocrine regions (Figure 5c). Significant increased representation of co-expressed genes was found also in the other signatures of genes showing significant correlations of expression levels with M4 IES scores among all survivors (data not shown). Some of the transcripts exhibiting differential expression patterns among affected trauma survivors play a major role in the neural and endocrine modulation of the stress response. Examples include the gaba amino butyric acid A receptor, a major brain target for neuroactive steroids; the serotonergic receptor 5-hydroxytriptamine 3, and phosphodiesterase E4A, both of which are selective targets for drugs possessing anti- anxiety properties, as well as multiple genes related to endocrine response including 17 alpha and 21 hydroxylases.
Altogether, these results demonstrate downregulation of transcripts encoding transcription enhancers and cell cycle protein and distinct upregulation of transcripts related to immune activation. General Analysis and Discussion - In contrast to the common notion that detection of informative transcriptional signals is dependent on homogeneous target cell subpopulations from tissues which are most relevant to the disease process (Nisenbaum LK. 2002. Genes Brain Behav. 1: 27-34; Barlow C and Lockhart DJ. 2002. Curr. Opin. Neurobiol. 12: 554-61), the data presented in the present invention reveal a robust differential signal in the heterogeneous PBMC cell population, lacking any primary involvement in the pathogenesis of PTSD. Of note, PBMCs are known to be perturbed following acute psychological stress (Aloe L, et al., 1994. Proc. Natl. Acad. Sci. U. S. A. 91: 10440-4), in part through neuroendocrine and sympathetic modulation (McEwen BS. 1998. N. Engl. J. Med. 338: 171-9). Long-term alterations in sympathetic (Southwick SM., et al., 1999. Biol. Psychiatry. 46: 1192-204) and HPA reactivity (Yehuda, R. 2002. N. Engl. J. Med. 346: 108-14) have been described in chronic PTSD, and suggested to impart alterations in immune modulation [McEwen, 1998 (Supra); Southwick, 1999 (Supra)]. Furthermore, altered white cell markers (Kawamura N., et al., 2001. Am. J. Psychiatry. 158: 484-6; Miller RJ., et al., 2001. Cytokine, 13: 253-5) and cytokine levels (Spϊvak B., et al. 1997. Biol. Psychiatry. 42: 345-8; Maes M., et al., 1999. Biol. Psychiatry. 45: 833-9) have been reported in chronic PTSD. Indeed, psychologically affected trauma survivors exhibited distinct expression patterns of genes encoding immune activators, as well as regulators of proliferation differentiation and demise of leukocytes, which may reflect a differential transcriptional activation following exposure to stress. Redistribution of white blood cells follows acute psychological trauma [McEwen, 1998 (Supra)] and may be an additional mechanism underlying the immediate expression differences observed. Such differences may thus reflect in part distinctive changes in the composition of circulating white cells among affected survivors. In this case, a global view at composite PBMCs may serve to enhance the differences observed. Time coursed flow cytometry would allow further characterization of leukocyte composition, as well as focusing on the distinctive expression changes among white blood cells subclasses.
The current practice is based on grouping trauma survivors into those with or without clinical PTSD, by applying a severity threshold on the conglomerate score of the three PTSD symptom clusters (DSM-IV), with a consequent inherent loss of data (Andreasen NC. 1997. Science. 1997. 275: 1586-93; Radant A., et al., 2001. Psychiatry Res. 102: 203-15). The results presented in the present invention demonstrate that gene expression signatures in PBMCs contain information that is highly correlated with continuous symptom severity measures among all trauma survivors regardless of threshold clinical designation, and for each of the three key biological dimensions that compose PTSD. Moreover, initial PBMCs gene expression signatures are informative of later clinical course, and could have a significant potential for guiding early detection and thus early intervention among survivors of trauma. Furthermore, while it is now well accepted that gene expression patterns in cancer tissues are indicative of a patient's prognosis (van de Vijver MJ, et al. 2002. N. Engl. J. Med. 347: 1999-2009; Rosenwald A, et al., 2002. N. Engl. J. Med. 346: 1937-47), these data suggest that such information exists in the much more accessible peripheral blood.
Moreover, expression signatures among PBMCs in response to extreme psychological stress may reflect in part genomic predisposition to develop PTSD, beyond the putative participation of immune cells in this neuropsychiatric disorder. Genes showing expression differences in lymphocytes from two patients with bipolar disorder, have recently been shown to constitute promising candidates for search of causative genomic polymorphisms associated with risk for the disorder, suggesting that peripheral expression differences contain pathogenetically relevant information for the neuropsychiatric process (Kakiuchi C, et al., 2003. Nat. Genet. 35: 171-5). Indirect support for this notion can be found in the increased proportion of genes co-expressed in brain and endocrine tissues, as well as specific genes related to neural transduction of stress among the informative transcripts observed in PBMCs.
The results presented in the present invention demonstrate a general reduction in PBMCs' expression of transcription activators among psychologically affected trauma survivors in response to stress. This decrease may explain much of the differences in gene expression signatures observed between the PTSD and control subjects. It remains to be established if some of the robust differences among PBMCs in gene transcripts related to transcriptional activation, intracellular signaling pathways, cell cycle, and apoptosis, might be indicative of parallel changes occurring among cell populations more relevant to central stress reactivity. Genomic variation may drive related transcriptional reactivity among glial cells that share closer embryonal derivation to leukocytes or even among neuronal cells. Reduced hippocampal volumes have been described among PTSD patients (Gilbertson MW, et al. 2002. Nat. Neurosci. 11: 1242-7). Altered neuroendocrine reactivity, signal transduction, and cellular proliferation and demise among neural and glial cells, have been implicated in hippocampal volume depletion [Kakiuchi, 2003 (Supra); Gilbertson, 2002 (Supra); Kim JJ, and Diamond DM. 2002. Nat. Rev. Neurosci. 6: 453-62], as well as in fear avoidance formation (Schafe GE, et al., 2001. Trends Neurosci. 24: 540-546) and memory consolidation (McEwen BS. 2001. Ann. N. Y. Acad. Sci. 933: 265-77) processes, and in some of the protective effects induced by antidepressant drugs (Santarelli L, et al. 2003. Science. 301: 805-9; Manji HK, et al., 2001. Nat. Med. 7: 541-7). Thus, the results presented in the present invention may suggest reduced potential for neural plasticity in response to stress among affected trauma survivors. It will be appreciated that altered gene expression may result from genomic sequence variation. Thus, the implicated transcripts in the signatures may be further pursued through informing candidate gene mutation screen and association studies among affected trauma survivors.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.
REFERENCES
(Additional references are cited in text)
Diagnostic and Statistical Manual of Mental Disorders - Fourth Edition (DSM-IV), The American Psychiatric Association, Washington D.C., 1994
Breslau N. The epidemiology of posttraumatic stress disorder: what is the extent of the problem? J Clin Psychiatry. 2001;62 Suppl 17:16-22.
Kessler RC, Sonega A, Bromet E, Hughes M, Nelson CB. Posttraumatic stress disorder in the national comorbidity survey. Arch Gen Psychiatry 1995; 52:1048-1060. Yehuda, R. "Post-traumatic stress disorder." N Engl J Med 2002; 346(2): 108-14.
Rothbaum BO, Foa EB. Subtypes of posttraumatic stress disorder and duration of symptoms. In Posttraumatic Stress Disorder, DSM IV and Beyond. Davidson JRT and Foa EB, eds. Washington, D.C. American Psychiatric Press, 1993: 23-35.
Shalev AY, Freedman S, Peri T, Brandes D, Sahar T. Predicting PTSD in civilian trauma survivors: prospective evaluation of self report and clinician administered instruments. Br J Psychiatry 1997; 170: 558-564
True WR, Rice J, Eisen SA, et al. A twin study of genetic and environmental contributions to liability for posttraumatic stress symptoms. Arch Gen Psychiatry 1993; 50: 257-264 Shalev AY, Freedman S, Peri T, et al. Prospective study of Posttraumatic Stress
Disorder and Depression Following Trauma. American Journal of Psychiatry, 1998; 155:630-637.
Zlotnick C, Warshaw M, Shea MT, Allsworth J, Pearlstein T, Keller MB. Chronicity in posttraumatic stress disorder (PTSD) and predictors of course of comorbid PTSD in patients with anxiety disorders. J Trauma Stress. 1999;12(l):89-100.
Blanchard EB, Hickling EJ, Forneris CA, et al. Prediction of remission of acute posttraumatic stress disorder in motor vehicle accident victims. J Trauma Stress. 1997;10(2):215-34.
Bryant RA, Sackville T, Dang ST, Moulds M, Guthrie R. Treating acute stress disorder: an evaluation of cognitive behaviour therapy and supportive counseling techniques. Am J Psychiatry 1999; 156: 1780-1786.
Brewin C, Andrews B, Valentine J. Meta-analysis of risk factors for posttraumatic stress disorder in trauma exposed adults. Journal of Consulting and Clinical Psychology 2000; 68: 748-766. Freedman SA, Peri T, Brandes D, Shalev AY. Predictors of chronic PTSD -A prospective study. Br J Psychiatry 1999; 174: 353-359
Pitman RK, Shalev AY, Orr SP. Post-traumatic stress disorder, Emotion, Conditioning and Memory. In: Gazzaniga MS ed. The Cognitive Neurosciences, 2nd ed, 2000: 1133- 1148 Kaufer D, Friedman A, Seidman S, Soreq H. Acute stress facilitates long-lasting changes in cholinergic gene expression . Nature 1998; 393:373-7.
Liberzon I, Lopez JF, Flagel SB, Vazquez DM, Young EA. Differential regulation of hippocampal glucocorticoid receptors mRNA and fast feedback: relevance to post¬ traumatic stress disorder. J Neuroendocrinol 1999; 11:11-7. Fujikawa T, Soya H, Fukuoka H, et al. A biphasic regulation of receptor mRNA expressions for growth hormone, glucocorticoid and mineralocorticoid in the rat dentate gyrus during acute stress. Brain Res. 2000;874(2): 186-93.
Aloe L, Bracci-Laudiero L, Alleva E, Lambiase A, Micera A, Tirassa P. Emotional stress induced by parachute jumping enhances blood nerve growth factor levels and the distribution of nerve growth factor receptors in lymphocytes. Proc Natl Acad Sci U S A. 1994; 91(22): 10440-4.
Kawamura N, Kim Y, Asukai N. Suppression of cellular immunity in men with a past history of posttraumatic stress disorder. Am J Psychiatry. 2001; 158(3):484-6.
Miller RJ, Sutherland AG, Hutchison JD, Alexander DA. C-reactive protein and interleukin 6 receptor in post-traumatic stress disorder: a pilot study. Cytokine. 2001; 13(4): 253-5.
Spivak B, Shohat B, Mester R, et al. Elevated levels of serum interleukin- 1 beta in combat-related posttraumatic stress disorder. Biol Psychiatry. 1997; 42(5):345-8
Maes M, Lin AH, Delmeire L, et al. Elevated serum interleukin-6 (IL-6) and IL-6 receptor concentrations in posttraumatic stress disorder following accidental man-made traumatic events. Biol Psychiatry. 1999; 45(7):833-9.
Carmody RJ, Hilliard B, Maguschak K, Chodosh LA, Chen YH. Genomic scale profiling of autoimmune inflammation in the central nervous system: the nervous response to inflammation. J Neuroimmunol. 2002;133(l-2):95-107. Tang Y, Lu A, Aronow BJ, Sharp FR. Blood genomic responses differ after stroke, seizures, hypoglycemia, and hypoxia: blood genomic fingerprints of disease. Ann Neurol. 2001; 50(6):699-707.
Nisenbaum LK. The ultimate chip shot: can microarray technology deliver for neuroscience? Genes Brain Behav. 2002;l(l):27-34. Barlow C, Lockhart DJ. DNA arrays and neurobiology— what's new and what's next?
Curr Opin Neurobiol. 2002;12(5):554-61.
McE wen BS. Protective and damaging effects of stress mediators. N Engl J Med. 1998;338(3):171-9.
Southwick SM, Bremner JD, Rasmusson A, Morgan CA 3rd, Arnsten A, Charney DS. Role of norepinephrine in the pathophysiology and treatment of posttraumatic stress disorder. Biol Psychiatry. 1999;46(9): 1192-204.
Chrousos GP. The hypothalamic-pituitary-adrenal axis and immune-mediated inflammation. N Engl J Med. 1995; 332(20): 1351-62.
Andreasen NC. Linking mind and brain in the study of mental illnesses: a project for a scientific psychopathology. Science. 1997; 14;275(5306):1586-93.
Radant A, Tsuang D, Peskind ER, McFaIl M, Raskind W. Biological markers and diagnostic accuracy in the genetics of posttraumatic stress disorder. Psychiatry Res. 2001; 24:102(3):203-15. van de Vijver MJ, He YD, van't Veer LJ, et al. A gene-expression signature as a predictor of survival in breast cancer. N Engl J Med. 2002; 347(25): 1999-2009.
Rosenwald A, Wright G, Chan WC, et al. Lymphoma/Leukemia Molecular Profiling Project. The use of molecular profiling to predict survival after chemotherapy for diffuse large-B-cell lymphoma. N Engl J Med. 2002; 346(25): 1937-47.
Iwamoto K, Kakiuchi C, Bundo M, Ikeda K, Kato T. Molecular characterization of bipolar disorder by comparing gene expression profiles of postmortem brains of major mental disorders. MoI Psychiatry. 2004 Apr;9(4):406-16.
Kakiuchi C, Iwamoto K, Ishiwata M, et al. Impaired feedback regulation of XBPl as a genetic risk factor for bipolar disorder. Nat Genet. 2003; 35(2):171-5.
Gilbertson MW, Shentoή ME, Ciszewski A, et al. Smaller hippocampal volume predicts pathologic vulnerability to psychological trauma. Nat Neurosci. 2002; 11:1242- 7.
Kim JJ, Diamond DM. The stressed hippocampus, synaptic plasticity and lost memories. Nat Rev Neurosci. 2002; 6:453-62.
McEwen BS. Plasticity of the hippocampus: adaptation to chronic stress and allostatic load. Ann N Y Acad ScL 2001; 933:265-77.
Sapolsky RM chickens eggs and hippocampal atrophy Nat Neurosci. 2002; 5(l l):l l l l-3.
Schafe GE, Nader K, Blair HT, LeDoux JE. Memory consolidation of Pavlovian fear conditioning: a cellular and molecular perspective. Trends Neurosci 2001; 24: 540-546 . Santarelli L, Saxe M, Gross C, et al. Requirement of hippocampal neurogenesis for the behavioral effects of antidepressants. Science. 2003; 301(5634):805-9.
Manji HK, Drevets WC, Charney DS. The cellular neurobiology of depression. Nat Med. 2001; 7(5): 541-7.
Li C, Wong WH. Model-based analysis of oligonucleotide arrays: Expression index computation and outlier detection. Proc. Natl. Acad. Sci. 2001; 98: 31-36
Kaminski N, Friedman N. Practical approaches to analyzing results of microarray experiments. Am J Respir Cell MoI Biol 2002; 27(2): 125-32.
Ben-Dor A, Friedman N, Yakhini Z. Overabundance Analysis and Class Discovery in Gene Expression Data, Technical Report 2002-50, School of Computer Science & Engineering, Hebrew University, 2002.
Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 1998; 95(25): 14863-14868.
Sl. Blake DD, Weathers FW, Nagy LM, Kaloupek DG, Klauminzer G, Charney DS, et al. A clinician rating scale for assessing current and lifetime PTSD: The CAPS-I. Behavior Therapist 1990 13: 187 -188. Spitzer RL, Williams JBW, Gibbon M, First MB. Structured Clinical Interview for DSM-IV (SCID-IV). Biometric Research Department, New York State Psychiatric Institute.1994.
Horowitz, M., Wilner, N., &Alvarez, W. Impact of event scale: A measure of subjective stress. Psychosom Med 1979; 41, 209 -218.
Weiss DS, Marmar CR. The Impact of Event Scale-Revised. In Wilson JP, Keane TM Eds. Assessing Psychological Trauma and PTSD. New York, Guilford Press 1997:399-411.
Friedman N. PCluster: Probabilistic Agglomerative Clustering of Gene Expression Profile. Technical report 2003-80 School of Computer Science & Engineering, Hebrew University, 2003.
Ben-Dor A, Bruhn L, Friedman N, Nachman I, Schummer M, Yakhini Z. Tissue classification with gene expression profiles. J Comput Biol 2000; 7(3-4):559-8346.
Duda RO, Hart PE. "Pattern Classification and Scene Analysis", John Wiley & Sons, New York, 1973.
CD-ROM Content
The following CD-ROM is attached herewith:
Information provided as: File name/ date of creation/ byte size/ operating system/machine format (all files are text files — operation program is therefore any text editor, including MS_word).
CD-ROMl (lfile)
1. 28215 Sequence Listing.txt, 8.06 MB / 01 August, 2004/ 8.06 MB/ text file/PC
The 28215 Sequence listing.txt file includes the sequence listing of SEQ ID
NOs: 1-906.

Claims

WHAT IS CLAIMED IS:
1. A kit for determining predisposition of a subject to develop PTSD comprising at least 10 and no more than 574 polynucleotides wherein each of said polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-574.
2. Use of an agent for the manufacture of a kit for determining predisposition to develop PTSD, the agent comprising at least 10 and no more than 574 polynucleotides wherein each of said polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 574.
3. The kit or the use of claim 1 or 2, wherein each of said polynucleotides is selected from the group consisting of an oligonucleotide molecule, a cDNA molecule, a genomic molecule and an RNA molecule.
4. The kit or the use of claim 1 or 2, wherein each of said polynucleotides is at least 10 and no more than 50 nucleic acids in length.
5. The kit or the use of claim 1 or 2, wherein each of said polynucleotides is bound to a solid support.
6. The kit of claim 1, further comprising at least one reagent suitable for detecting hybridization of said polynucleotides and at least one RNA transcript.
7. The kit of claim 6, further comprising packaging materials packaging said at least one reagent and instructions of using the kit in determining predisposition of the subject to develop PTSD.
8. A kit for diagnosing PTSD in a subject comprising at least 10 and no more than 408 polynucleotides wherein each of said polynucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904.
9. Use of an agent comprising at least 10 and no more than 408 polynucleotide sequences wherein each of said polynucleotide sequences is at least 80 % identical to at least one specific polynucleotide selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570, and 575-904 for the manufacture of a kit for diagnosing PTSD.
10. The kit or the use of claim 8 or 9, wherein each of said polynucleotides is selected from the group consisting of an oligonucleotide molecule, a cDNA molecule, a genomic molecule and an RNA molecule.
11. The kit or the use of claim 8 or 9, wherein each of said polynucleotides is at least 10 and no more than 50 nucleic acids in length.
12. The kit or use of claim 8 or 9, wherein each of said polynucleotides is bound to a solid support.
13. The kit of claim 8, further comprising at least one reagent suitable for detecting hybridization of said polynucleotides and at least one RNA transcript.
14. The kit of claim 13, further comprising packaging materials packaging said at least one reagent and instructions of using the kit in diagnosing PTSD in the subject.
15. A microarray comprising at least 10 and no more than 904 oligonucleotides wherein each of said oligonucleotides is capable of specifically binding at least one specific polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-904.
16. The microarray of claim 15, wherein each of said oligonucleotides is at least 10 and no more than 40 nucleic acids in length.
17. Use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 as a pharmaceutical.
18. Use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NO: 1-574 for the manufacture of a medicament identified for preventing PTSD.
19. The use of claim 17 or 18, wherein said regulating is upregulating an expression level and/or an activity of said at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:2-5, 7-13, 15, 16, 18-21, 23, 26-31, 34.42, 44-53, 55-58, 60, 62-68, 71, 73, 75, 77-87, 89-96, 98-104, 106-111, 113, 115-119, 123, 124, 126-134, 138, 139, 141, 142, 144-149, 151-155, 157, 159, 161, 162, 164-166, 168-179, 181-186, 188-190, 192-198, 200-204, 206-221, 223-234, 236-250, 252-264, 266, 268-303, 305-317, 320-325, 329-338, 340-353, 355, 357-367, 370-373, 376-381, 383, 384, 386-397, 399, 400, 403-405, 407, 408, 410, 411, 415-422, 425, 427-438, 440, 442-468, 470, 471, 473, 475-477, 479, 481-490, 492-494, 496, 497, 499, 500, 503-509, 511-527, 529, 531-546, 548, 550, 552, 553, 558-561, 563-567, and 570-574.
20. The use of claim 19, wherein said upregulating is effected by an agent selected from the group consisting of:
(a) an exogenous polynucleotide encoding said at least one gene;
(b) an agent capable of increasing expression of said at least one gene;
(c) an agent capable of increasing endogenous activity of said at least one gene product;
(d) an exogenous polypeptide including at least a functional portion of said at least one gene product;
(e) cells expressing said at least one gene.
21. The use of claim 17 or 18, wherein said regulating is downregulating an expression level and/or an activity of said at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 1, 6, 14, 17, 22, 24, 25, 32, 33, 43, 54, 59, 61, 69, 70, 72, 74, 76, 88, 97, 105, 112, 114, 120, 121, 122, 125, 135, 136, 137, 140, 143, 150, 156, 158, 160, 163, 167, 180, 187, 191, 199, 205, 222, 235, 251, 265, 267, 304, 318, 319, 326, 327, 328, 339, 354, 356, 368, 369, 374, 375, 382, 385, 398, 401, 402, 406, 409, 412, 413, 414, 423, 424, 426, 439, 441, 469, 472, 474, 478, 480, 491, 495, 498, 501, 502, 510, 528, 530, 547, 549, 551, 554-557, 562, 568, and 569.
22. The use of claim 21, wherein said downregulating is effected by an agent selected from the group consisting of:
(a) a molecule which binds said at least one gene and/or a gene product thereof;
(b) an enzyme which cleaves said at least one gene product;
(c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoded by said at least one gene;
(d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoded by said at least one gene;
(e) a DNAzyme which specifically cleaves an mRNA transcript or DNA sequence of said at least one gene; (f) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoded by said at least one gene;
(g) a non-functional analogue of at least a catalytic or binding portion of said at least one gene product;
(h) a molecule which prevents said at least one gene product activation or substrate binding.
23. The use of claim 22, wherein said agent is formulated for systemic administration.
24. Use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 as a pharmaceutical.
25. Use of an agent capable of regulating an expression level of at least one gene selected from the group consisting of SEQ ID NOs: 7, 10, 12, 17, 18, 20, 35, 62, 79, 81, 88, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320, 327, 331, 342, 344, 348, 352, 372, 376-378, 383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 474, 475, 483, 504, 505, 523, 526, 530, 531, 559, 561, 563, 565, 570 and 575-904 for the manufacture of a medicament identified for the treatment of PTSD.
26. The use of claim 24 or 25, wherein said regulating is upregulating an expression level and/or an activity of said at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs:7, 10, 12, 18, 20, 35, 62, 79, 81, 93, 107, 128, 129, 139, 144, 154, 159, 164, 169, 170, 174, 185, 186, 194, 211, 214, 221, 236, 248, 252, 253, 255, 257, 260, 275, 277, 278, 283, 295, 296, 317, 320 ,331, 342, 344, 348, 352, 372, 376, 377, 378 ,383, 389, 394, 395, 397, 408, 432, 437, 442, 452, 475, 483, 504, 505, 523, 526, 531, 559, 561, 563, 565, 570, 575-581, 585-591, 593, 597-602, 604, 605, 607-612, 615-617, 619, 622, 623, 627, 628, 631-633, 635, 636, 639, 640, 643, 647, 648, 650, 651, 652, 656-662, 664, 666-668, 672, 674-677, 679, 682, 686, 687, 690, 692-703, 706-708, 712-715, 718, 719, 722-727, 730-731, 734, 737-740, 742, 744, 746-752, 754,
755, 757, 759-763, 765-770, 772, 773, 775, 777, 778, 780, 781, 783-785, 788, 790, 793, 796-807, 810, 812, 813, 817, 818, 821, 822, 824-827, 830, 832-837, 843, 844, 846-849, 851-853, 856-859, 861-864, 866-869, 872-876, 878, 880-884, 889, 891, 893, 895, 899, and 900.
27. The use of claim 26, wherein said upregulating is effected by an agent selected from the group consisting of:
(a) an exogenous polynucleotide encoding said at least one gene;
(b) an agent capable of increasing expression of said at least one gene;
(c) an agent capable of increasing endogenous activity of said at least one gene product;
(d) an exogenous polypeptide including at least a functional portion of said at least one gene product;
(e) cells expressing said at least one gene.
28. The use of claim 24 or 25, wherein said regulating is downregulating an expression level and/or an activity of said at least one gene and/or a gene product thereof selected from the group consisting of SEQ ID NOs: 17, 88, 327, 474, 530, 582-584, 592, 594-596, 603, 606, 613, 614, 618, 620, 621, 624-626, 629, 630, 634, 637, 638, 641, 642, 644-646, 649, 653-655, 663, 665, 669-671, 673, 678, 680, 681, 683-685, 688, 689, 691, 704, 705, 709-711, 716, 717, 720, 721, 728, 729, 732, 733, 735, 736, 741, 743, 745, 753,
756, 758, 764, 771, 774, 776, 779, 782, 786, 787, 789, 791, 792, 794, 795, 808, 809, 811, 814-816, 819, 820, 823, 828, 829, 831, 838-842, 845, 850, 854, 855, 860, 865, 870, 871, 877, 879, 885-888, 890, 892, 894, 896-898, and 901-904.
29. The use of claim 28, wherein said downregulating is effected by an agent selected from the group consisting of:
(a) a molecule which binds said at least one gene and/or a gene product thereof;
(b) an enzyme which cleaves said at least one gene product;
(c) an antisense polynucleotide capable of specifically hybridizing with at least part of an mRNA transcript encoded by said at least one gene;
(d) a ribozyme which specifically cleaves at least part of an mRNA transcript encoded by said at least one gene;
(e) a DNAzyme which specifically cleaves an mRNA transcript or DNA sequence of said at least one gene;
(f) a small interfering RNA (siRNA) molecule which specifically cleaves at least part of a transcript encoded by said at least one gene;
(g) a non-functional analogue of at least a catalytic or binding portion of said at least one gene product;
(h) a molecule which prevents said at least one gene product activation or substrate binding.
30. The use of claim 27 or 29, wherein said agent is formulated for systemic administration.
PCT/IL2005/000824 2004-08-02 2005-08-02 Compositions and methods for diagnosing and treating post traumatic stress disorder WO2006013561A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US59240804P 2004-08-02 2004-08-02
US60/592,408 2004-08-02

Publications (2)

Publication Number Publication Date
WO2006013561A2 true WO2006013561A2 (en) 2006-02-09
WO2006013561A3 WO2006013561A3 (en) 2006-09-14

Family

ID=35787510

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2005/000824 WO2006013561A2 (en) 2004-08-02 2005-08-02 Compositions and methods for diagnosing and treating post traumatic stress disorder

Country Status (1)

Country Link
WO (1) WO2006013561A2 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010029176A1 (en) * 2008-09-12 2010-03-18 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Genes associated with posttraumatic-stress disorder (ptsd)
CN103068982A (en) * 2010-07-14 2013-04-24 库尔纳公司 Treatment of discs large homolog (dlg) related diseases by inhibition of natural antisense transcript to dlg
US8481507B2 (en) 2007-07-31 2013-07-09 The Board Of Regents, The University Of Texas System Micro-RNAs that control myosin expression and myofiber identity
US8629119B2 (en) 2009-02-04 2014-01-14 The Board Of Regents, The University Of Texas System Dual targeting of MIR-208 and MIR-499 in the treatment of cardiac disorders
WO2015027116A1 (en) * 2013-08-21 2015-02-26 The Regents Of The University Of California Diagnostic and predictive metabolite patterns for disorders affecting the brain and nervous system
JP2017078720A (en) * 2011-09-14 2017-04-27 ザ ヘンリー エム． ジャクソン ファウンデーション フォー ザ アドバンスメント オブ ミリタリー メディシン，インコーポレーテッド Processes and kits to detect and monitor diagnostic biomarkers for post traumatic stress disorder (ptsd) and to differentiate between suicidal and non-suicidal forms of that disorder
CN106701900A (en) * 2015-11-16 2017-05-24 上海市东方医院 Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer
US9856532B2 (en) * 2012-09-07 2018-01-02 Institute For Systems Biology Markers and methods for detecting posttraumatic stress disorder (PTSD)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002004677A2 (en) * 2000-07-06 2002-01-17 The Regents Of The University Of California Methods for diagnosis and treatment of psychiatric disorders
US20030059791A1 (en) * 2001-02-28 2003-03-27 Kazuhito Rokutan Method for evaluating DNA probes position on substrate

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002004677A2 (en) * 2000-07-06 2002-01-17 The Regents Of The University Of California Methods for diagnosis and treatment of psychiatric disorders
US20030059791A1 (en) * 2001-02-28 2003-03-27 Kazuhito Rokutan Method for evaluating DNA probes position on substrate

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
CAMPBELL CATHERINE ET AL: "Assessment of normal variability in peripheral blood gene expression." DISEASE MARKERS, vol. 18, no. 4, 2003, pages 201-206, XP009062691 ISSN: 0278-0240 *
CHANTARUJIKAPONG S I ET AL: "A twin study of generalized anxiety disorder symptoms, panic disorder symptoms and post-traumatic stress disorder in men." PSYCHIATRY RESEARCH. 20 SEP 2001, vol. 103, no. 2-3, 20 September 2001 (2001-09-20), pages 133-145, XP002371126 ISSN: 0165-1781 *
FREEDMAN S A ET AL: "Predictors of chronic post-traumatic stress disorder. A prospective study." THE BRITISH JOURNAL OF PSYCHIATRY : THE JOURNAL OF MENTAL SCIENCE. APR 1999, vol. 174, April 1999 (1999-04), pages 353-359, XP009062943 ISSN: 0007-1250 cited in the application *
LIBERZON I ET AL: "Differential regulation of hippocampal glucocorticoid receptors mRNA and fast feedback: Relevance to post-traumatic stress disorder" JOURNAL OF NEUROENDOCRINOLOGY, vol. 11, no. 1, January 1999 (1999-01), pages 11-17, XP002371120 ISSN: 0953-8194 cited in the application *
NIMGAONKAR ASHISH ET AL: "Reproducibility of gene expression across generations of Affymetrix microarrays." BMC BIOINFORMATICS ÄELECTRONIC RESOURCEÜ. 25 JUN 2003, vol. 4, 25 June 2003 (2003-06-25), page 27, XP002371121 ISSN: 1471-2105 *
OPALINSKA JOANNA B ET AL: "Nucleic-acid therapeutics: basic principles and recent applications." NATURE REVIEWS. DRUG DISCOVERY. JUL 2002, vol. 1, no. 7, July 2002 (2002-07), pages 503-514, XP009063128 ISSN: 1474-1776 *
RADICH J P ET AL: "Individual-specific variation of gene expression in peripheral blood leukocytes" GENOMICS, ACADEMIC PRESS, SAN DIEGO, US, vol. 83, no. 6, June 2004 (2004-06), pages 980-988, XP004512549 ISSN: 0888-7543 *
SEGMAN R H ET AL: "Peripheral blood mononuclear cell gene expression profiles identify emergent post-traumatic stress disorder among trauma survivors" MOLECULAR PSYCHIATRY, vol. 10, no. 5, May 2005 (2005-05), pages 500-513, XP002371124 ISSN: 1359-4184 *
SEGMAN RONNEN H ET AL: "Genetics of posttraumatic stress disorder." CNS SPECTRUMS. SEP 2003, vol. 8, no. 9, September 2003 (2003-09), pages 693-698, XP009062917 ISSN: 1092-8529 *
SEGMAN RONNEN H ET AL: "Peripheral blood mononuclear cells gene expression profiles identify emergent posttraumatic stress disorder among trauma survivors" NEUROPSYCHOPHARMACOLOGY, vol. 29, no. Suppl. 1, December 2004 (2004-12), page S207, XP002371123 & ANNUAL MEETING OF THE AMERICAN-COLLEGE-OF-NEUROPSYCHOPHARMACOLOG Y; SAN JUAN, PR, USA; DECEMBER 12 -16, 2004 ISSN: 0893-133X *
TANAKA T ET AL: "Expression profile of mRNAs from rat hippocampus and its application to microarray" MOLECULAR BRAIN RESEARCH, ELSEVIER SCIENCE BV, AMSTERDAM, NL, vol. 129, no. 1-2, 23 July 2004 (2004-07-23), pages 20-32, XP004591559 ISSN: 0169-328X *
WELLE STEPHEN ET AL: "Computational method for reducing variance with Affymetrix microarrays." BMC BIOINFORMATICS ÄELECTRONIC RESOURCEÜ. 30 AUG 2002, vol. 3, 30 August 2002 (2002-08-30), page 23, XP002371122 ISSN: 1471-2105 *
WHITNEY ADELINE R ET AL: "Individuality and variation in gene expression patterns in human blood." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 100, no. 4, 18 February 2003 (2003-02-18), pages 1896-1901, XP002371125 ISSN: 0027-8424 *
XIAN H ET AL: "Genetic and environmental influences on posttraumatic stress disorder, alcohol and drug dependence in twin pairs." DRUG AND ALCOHOL DEPENDENCE. 22 DEC 2000, vol. 61, no. 1, 22 December 2000 (2000-12-22), pages 95-102, XP002371127 ISSN: 0376-8716 *
YEHUDA RACHEL: "Post-traumatic stress disorder." THE NEW ENGLAND JOURNAL OF MEDICINE. 10 JAN 2002, vol. 346, no. 2, 10 January 2002 (2002-01-10), pages 108-114, XP009062957 ISSN: 1533-4406 cited in the application *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8481507B2 (en) 2007-07-31 2013-07-09 The Board Of Regents, The University Of Texas System Micro-RNAs that control myosin expression and myofiber identity
US8962588B2 (en) 2007-07-31 2015-02-24 The Board Of Regents, The University Of Texas System Micro-RNAS that control myosin expression and myofiber identity
WO2010029176A1 (en) * 2008-09-12 2010-03-18 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Genes associated with posttraumatic-stress disorder (ptsd)
US9243293B2 (en) 2008-09-12 2016-01-26 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Genes associated with posttraumatic-stress disorder (PTSD)
US8629119B2 (en) 2009-02-04 2014-01-14 The Board Of Regents, The University Of Texas System Dual targeting of MIR-208 and MIR-499 in the treatment of cardiac disorders
US8980860B2 (en) 2010-07-14 2015-03-17 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
CN103068982A (en) * 2010-07-14 2013-04-24 库尔纳公司 Treatment of discs large homolog (dlg) related diseases by inhibition of natural antisense transcript to dlg
JP2017078720A (en) * 2011-09-14 2017-04-27 ザ ヘンリー エム． ジャクソン ファウンデーション フォー ザ アドバンスメント オブ ミリタリー メディシン，インコーポレーテッド Processes and kits to detect and monitor diagnostic biomarkers for post traumatic stress disorder (ptsd) and to differentiate between suicidal and non-suicidal forms of that disorder
AU2012308305B2 (en) * 2011-09-14 2017-11-23 Banyan Biomarkers, Inc. Processes and kits to detect and monitor for diagnostic biomarkers for post traumatic stress disorder (PTSD) and to differentiate between suicidal and non-suicidal form of the disorder
US9856532B2 (en) * 2012-09-07 2018-01-02 Institute For Systems Biology Markers and methods for detecting posttraumatic stress disorder (PTSD)
WO2015027116A1 (en) * 2013-08-21 2015-02-26 The Regents Of The University Of California Diagnostic and predictive metabolite patterns for disorders affecting the brain and nervous system
CN106701900A (en) * 2015-11-16 2017-05-24 上海市东方医院 Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer
CN106701900B (en) * 2015-11-16 2020-03-20 上海市东方医院 Long-chain non-coding RNA HERC2P3 gene and application thereof in gastric cancer

Also Published As

Publication number Publication date
WO2006013561A3 (en) 2006-09-14

Similar Documents

Publication Publication Date Title
Tylee et al. Blood-based gene-expression biomarkers of post-traumatic stress disorder among deployed marines: a pilot study
Liang et al. A gene network regulated by the transcription factor VGLL3 as a promoter of sex-biased autoimmune diseases
Fillman et al. Increased inflammatory markers identified in the dorsolateral prefrontal cortex of individuals with schizophrenia
Marques et al. Kinetic profile of the transcriptome changes induced in the choroid plexus by peripheral inflammation
EP2414542B1 (en) Methods of predicting clinical course and treating multiple sclerosis
WO2006013561A2 (en) Compositions and methods for diagnosing and treating post traumatic stress disorder
Uriarte Huarte et al. Single-cell transcriptomics and in situ morphological analyses reveal microglia heterogeneity across the nigrostriatal pathway
WO2006014755A2 (en) Methods of identifying patients at risk of developing encephalitis following immunotherapy for alzheimer’s disease
Hu et al. Genetic landscape and autoimmunity of monocytes in developing Vogt–Koyanagi–Harada disease
Zurawska et al. Multiple sclerosis: circRNA profile defined reveals links to B-cell function
Szoeke et al. Multidrug‐resistant genotype (ABCB1) and seizure recurrence in newly treated epilepsy: data from international pharmacogenetic cohorts
Grubman et al. A single cell brain atlas in human Alzheimer’s disease
Fu et al. Single-nucleus RNA sequencing reveals the shared mechanisms inducing cognitive impairment between COVID-19 and Alzheimer’s disease
Rahimirad et al. Identification of hsa-miR-106a-5p as an impact agent on promotion of multiple sclerosis using multi-step data analysis
Zheng et al. circHtra1/miR-3960/GRB10 axis promotes neuronal loss and immune deficiency in traumatic brain injury
Abd El Gayed et al. mRNA expression of the CUB and sushi multiple domains 1 (CSMD1) and its serum protein level as predictors for psychosis in the familial high-risk children and young adults
Yang et al. Autophagy-related genes are involved in the progression and prognosis of asthma and regulate the immune microenvironment
Chen et al. Different exosomal microRNA profile in aquaporin-4 antibody positive neuromyelitis optica spectrum disorders
Wang et al. Genetic regulatory and biological implications of the 10q24. 32 schizophrenia risk locus
Grubman et al. Mouse and human microglial phenotypes in Alzheimer’s disease are controlled by amyloid plaque phagocytosis through Hif1α
Zhou et al. An integrated analysis of hypoxic–ischemic encephalopathy‐related cell sequencing outcomes via genes network construction
Dominguez-Mozo et al. microRNA Expression and Its Association with Disability and Brain Atrophy in Multiple Sclerosis Patients Treated with Glatiramer Acetate
Christodoulou et al. Unraveling the transcriptomic signatures of Parkinson’s disease and major depression using single-cell and bulk data
Hangul et al. Estradiol differentially regulates DUX4, β-catenin and PAX3/PAX7 in primary myoblasts of facioscapulohumeral muscular dystrophy patients
Li et al. Whole exome sequencing reveals novel variants associated with diminished ovarian reserve in young women

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase