WO2004046335A2 - A method for cloning of a rare, specifically mutated cell - Google Patents

Abstract

The invention concerns a new method of detecting a rare product of a directed genetic alteration of a cultured cell. The method is applicable to any method of making the alteration. The method comprises sequentially using polymerase chain reaction (PCR) using an allele specific primer to preferentially amplify sequences containing one of the two linked alterations, coupled with a second technique that detects the second change in the PCR product. The second method may comprise restriction digestion, conventional DNA sequencing or pyro-sequencing. Experiments indicate that alterations as rare as one correctly altered copy in 10,000 cells can be detected using the methods provided.

Description

A METHOD FOR CLONING OF A RARE, SPECIFICALLY MUTATED CELL

Related Applications

This application claims the benefit of the filing date of U.S. Application No.

10/298850, filed November 18, 2002, entitled "METHOD FOR CLONING OF A RARE, SPECIFICALLY MUTATED CELL", by R. A. Metz, M. Dicola, and R. M.

Blaese. The entire teachings of the referenced application are incorporated by reference herein.

Background of the Invention

A variety of sequence-specific processes have been developed that make a specific, directed genetic alteration in a cultured cell. The desired alteration most often is a nucleotide mutation, for example to correct a genetic defect or to introduce an in-frame stop codon and thereby "knock out" the target gene. The methods have in common the step of introducing into the cells of the culture an exogenous nucleic acid having the desired sequence, i.e., the exogenous nucleic acid "encodes" the desired mutation. The exogenous nucleic acid can be a duplex "hairpin" "chimeric" oligonucleotide which includes 2' alkoxy substituted ribonucleotides (Cole-Strauss, et al, 1996, Science 273, 1386-89), an end-protected olignucleotide (WO 01/15740; Gamper et al., 2000, NAR 28, 4332-39) or unprotected DNA fragments of between about 100 and 2000 nucleotides, which can be optionally separated so that the introduced nucleic acid is substantially free of either the sense or antisense strand. Goncz et al., 1998, Hum. Mol. Genetics 7, 1913; Kunzelmann et al., 1996, Gene Ther. 3, 859; U.S. Patent No. 6,010,908. The exogenous nucleic acid forms a duplex with the homologous region of the genomic DNA (the "target genomic fragment") and the cell's enzymatic machinery causes the desired mutation in the target genomic fragment.

Chimeric hairpin oligonucleotides can be used to mutate plant cells. Beetham et al., 1999, Proc. Natl. Acad. Sci. 96, 8774; Zhu et al., 1999, Proc. Natl. Acad. Sci. 96, 8768; WO 98/54330; WO 99/07865; WO 99/07865. A sequence-specific process to induce mutations in yeast using phosphorothioate end-protected single stranded oligonucleotides has been developed and 2O-4' methylene blocked oligonucleotides. Parekh-Olmedo, H., et al., 2002, Chem. Biol. 9, 1073-84; Liu, L., et al., 2002, NAR 30, 2742-50; Liu, L., et al., 2002, Mol. Cell. Biol. 22, 3852-63..

A problem that has limited the use of sequence-specific processes is that the fraction of the cultured cells that contain the desired mutation can be very small. Under these circumstances there is no practical way to identify and clone the altered cells unless the desired alteration confers some selectable phenotype, such as drug resistance, or a grossly visible phenotype that permits cloning by inspection.

Techniques have been developed to permit the detection of single nucleotide mutation in cultured cells. One common technique is allele specific polymerase chain reaction (AS-PCR). PCR is the technique whereby two primers are used to amplify a template sequence using bacterial enzymes in a cell free system. The DNA polymerase employed in PCR requires that the primer be hybridized (Watson- Crick paired) to the template DNA for synthesis to occur. Therefore, if the hybridization conditions are made sufficiently stringent, a single nucleotide mismatch between template and one of the two primers can cause a readily detectable difference in the amount of DNA that is synthesized in the'PCR process. This technique permits the use of allele 'specific primers to distinguish the genotype of a homogeneous DNA sample from an allelic genotype that differs by a single nucleotide mutation. Particular attention has been drawn to the effects of mismatches at the 3' end of the primer. Reviewed, Bottema, CD., & Sommer, S.S., 1993, Mutation Research 288, 93-102.

However, AS-PCR is a reportedly satisfactory method to detect a rare cell of one genotype in the presence of the allelic genotype only up to a sensitivity of 1 in 100. Kirby, G. M., et al., 1996, Int. J. Cancer 68, 21-25. Experience has shown that when the hybridization stringency is high enough to suppress amplification of the unwanted allele, i.e., to prevent false positives, AS-PCR becomes insensitive to the presence of the rare cell having the correct allele. In addition to AS-PCR, other techniques have been developed to readily detect single nucleotide differences in small samples of DNA. The oldest is the restriction enzyme technology that is used to detect restriction fragment length polymorphism (RFLP). Restriction enzymes are DNA endonucleases that cut the DNA polymer whenever they encounter a specific nucleotide sequence that is typically a palindrome between 4 and 8 nucleotides in length. Other techniques include direct sequencing, in particular, the technique called "pyrosequencing" uses a luciferase-based detection of the production of pyrophosphate (a phosphoric acid anhydride), which occurs during DNA polymerization. Ronaghi et al., 1998, Science 281, 363; Ronaghi et al. 2000, Anal. Biochem. 286, 282-8; U.S. patent No. 6,210,891. Pyrosequencing has been shown to be effective in detecting a single nucleotide difference in as few as one in 20 cells, but not fewer. Hochberg, E.P., et al, 2002, Blood,101(l):363-9.

There remains a nee for a method of detecting mutant cells at frequencies less than one in 100 and one in 5,000. ^,

Summary of the Invention

In certain aspects, the present invention provides a new and sensitive method for reliably detecting the presence of a rare cell having a desired nucleotide mutation that was introduced by a sequence-specific process. In one^' embodiment of the invention, PCR amplification using an allele-specific oligonucleotide primer is conducted at a reduced level of hybridization stringency, such that the amount of resulting product is not significantly affected by the presence or absence of the desired mutation. When PCR amplification is so conducted and the desired mutation is present at the level as low as 1 part, in 10.000, the PCR product can contain the desired mutation at a level greater than one part in about 20.

This discovery permits the detection with great sensitivity and specificity of two linked nucleotide mutations. A first mutation is used in a reduced-stringency PCR amplification using an allele-specific primer to selectively amplify a target fragment that contains both mutations. The amplified second mutation can be readily detected in the PCR product using a number of techniques available to one skilled in the art. In one embodiment, the second amplified mutation is detected using RFLP, PCR amplification or direct sequencing.

The invention, therefore, comprises designing an exogenous nucleic acid for a sequence-specific process comprising a desired mutation and a linked companion mutation. The mutations are separated by a convenient distance that is dependent on the sequence-specific process. A culture is then treated with the exogenous nucleic acid and replicate subcultures are made. Genomic DNA is prepared from a sample of the replicate subcultures and tested for the presence of the mutation. In one embodiment, the desired mutation is detected by PCR amplification using an AS- primer and the companion mutation introduces a novel restriction site that is detected by RFLP analysis. Further subdivisions are made from the reserved replicate of the positive subculture until clones having the desired mutation are obtained. The subdivided positive subcultures can be tested using the method of the invention or, when practical, RFLP. In some embodiments, the exogenous nucleic acid additionally comprises multiple desired and/or companion mutations.

Brief Description of the Drawings

Figure 1 shows an embodiment of the invention that distinguishes two alleles (SEQ ID NOS: 7-8) of Factor VIII Binding Protein (von Willebrand's Factor).

Figure 2 shows the bovine PrP target region and design. The following sequences are described:

25Xv 5' GTAGGCCTCTGCTAGAAGCCA3' (SEQ IDNO: 20) 25KV 5' GTGGGCCTCTGC AAGAAGCCA 3' (SEQ ID NO: 21) 179Rv 5' GTC GATCGGTAT 3' (SEQ IDNO: 22) 179QN 5" GTG GATCAGTAT 3' (SEQ IDNO: 23)

SDF-25XV 5' AGT GAC GTA GGC CTC TGC TAGAAG 3' (SEQ IDNO: 24) SDF-25RV 5* AGG CCA GTC GAT CGG TAT 3' (SEQ IDNO: 25) Figure 3 shows pyrosequencing and RFLP analysis of a wild-type plasmid, a

25Xv plasmid SEQ ID NO: 26, and of a mixture thereof. The following sequences are described:

WT 5' GGGCCTCTG 3' (SEQ IDNO: 26) 25X 5' AGGCCTCTG 3' (SEQ IDNO: 27)

Figure 4 shows pyrosequencing and RFLP analysis of the PrP locus. DF- 25Xv was able to edit the PrP locus in bovine fibroblast cell line at a frequency of 0.014 % (~1 per 7000 cell). The photograph on the left shows only six samples analyzed - three positive and three negative by RFLP analysis. Wt and 25X controls are indicated in the right lanes. The corresponding pyrosequencing profiles confirm the presence of the edited allele as indicated by the appearance of the "A" peak.

Detailed Description of the Invention

One aspect of the invention provides a method of cloning a specifically mutated cell from a culture of cells, comprising: a) subjecting the culture to a 'sequence-specific process that introduces at least one 3' mutation and at least one 5' mutation in a genomic target; b) forming at least two replicate subcultures of the treated culture; c) performing a PCR amplification using a sample of genomic DNA from a replicate subculture as template to generate a first PCR ^' product, wherein the first PCR product comprises the site of the 3' mutation and the site of the 5' mutation; d) performing a PCR amplification using (i) the first PCR product as template; (ii) an AS-PCR primer that contains at least part of the 3' mutation; and (iii) and a forward primer that does not contain the 5' mutation, to generate a second PCR product that contains the site of the 5' mutation; e) identifying a positive subculture by identifying the presence of the 5' mutation in the second PCR product; f) cloning a rare mutated cell from the positive subculture, wherein the rare mutated cell contains the 5' mutation and the 3' mutation.

In one embodiment, prior to step (f), steps (b) through (e) are reiterated at least once, with the modification that in each subsequent iteration of step (b) the replicate subcultures are formed from the positive subculture identified in the preceding step (e). Thus, each reiteration enriches for the presence of the rare, mutated cell.

The implementation of the detection method of the invention is substantially unaffected by the choice of the sequence-specific process that is used to introduce the mutation. The culture is treated with the exogenous nucleic acid that contains the desired mutation and the companion mutation in the target genomic fragment and subcultures made. Many methods are well known to one skilled in the art for introducing exogenous nucleic acids into cells, including transformation, electroporation, transduction, viral infection, liposomes and microinjection based techniques. The method used will depend on such factors as the size of the nucleic acid and the type of target cell. Such methods and others may be found, for example, in Molecular Cloning: A Laboratory Manual, 3rd Ed., ed. by Sambrook and Russell (Cold Spring Harbor Laboratory Press: 2001); and Current Protocols in Cell Biology, ed. by Bonifacino, Dasso, Lippincott-Schwartz, Harford, and Yamada, John Wiley and Sons, Inc., New York, 1999.

The sequence-specific process may be performed on cells in culture or, in alternate embodiments; it may be performed on cells in vivo followed by cell culture of the cells. The modification ofcells in vivo may be suitable for cells that do not proliferate well in culture, or that differentiate or undergo extensive cell death in culture. For example, an embryo might be treated with a retrovirus, and a specific cell type isolated from the embryo or the adult animal at a later time for detection of the rare mutated cell.

The methods for cloning a rare specifically mutated cell described herein are not restricted to any particular cell type. Cells may be prokaryotic or eukaryotic, and comprise animal, plant, yeast, bacterial, fungal, mammalian, and human cells. In one embodiment, the cells are primary human cells or human stem cells. One aspect of the invention provides methods for identifying rare mutated cells and subsequently implanting them into a subject, preferably a mammalian subject, such as a human, or using nuclei from the specifically mutated cells in nuclear transfer experiments. The methods described herein may also be applied to the isolation of a rare, specifically mutated virus or phage, with the appropriate culture conditions and host cells used for the subject virus or phage. Methods for maintaining cells in culture are commonly known to those skilled in the art and may be found in the references provided herein.

The desired mutation and the companion mutation can be adjacent nucleotide mutations or may be separated by a convenient distance. One skilled in the art may choose a suitable distance for the particular application. The more widely separated the mutations are, the more easily RFLP analysis can be performed, but the more likely the possibility of loss of linkage between the desired and the companion mutation during the sequence-specific process for incorporating the mutations into the target cells. Another factor when selecting a suitable distance is the availability of mutational targets for generating either of the mutations. For example, if it is desired to create or delete a restriction enzyme recognition site with the companion mutation, the choice for the location of the companion mutation will determined by the availability of either restriction enzyme recognition sites or near restriction enzyme recognition sites in the target genomic fragment.

In one embodiment, SFHR is used as the sequence-specific process. In another embodiment, the separation between the desired and the companion mutations is up to about 50 bp, up to about 100 bp, up to about 250 bp, up to about 500 bp, up to about 1,000 bp, up to about 2,000 bp or up to about 5,000 bp.

Although two mutations that are far apart in the exogenous nucleic acid may fail to both be incorporated into the target cell, the sensitivity of the methods described herein allows for the detection of a rare event in which both mutations are incorporated into the target cell.

The exogenous nucleic acid may contain more than two mutations. For example, in specific embodiments, the nucleic acid may contain more than one desired mutation, more than one companion mutation, or both. A nucleic acid may contain, for example, two desired mutations, a first desired mutation comprising a point mutation resulting in an amino acid substitution and a second desired mutation comprising a small deletion which results in the deletion of one or more amino acids in an encoded protein, while also having one or more companion mutations.

Furthermore, the desired mutation(s) and the companion mutation(s) may be located in introns or exons of a gene, in regulatory regions of a gene, or in regions not containing genes. In one embodiment, regulatory regions of genes comprise promoter regions, enhancer elements and splice junction sites. Furthermore, the mutations need not be in the same gene. In one embodiment, the desired mutation(s) lies in the exon, intron, or regulatory element of one gene, while the companion(s) mutation does not lie in the exon, intron or regulatory region of the same gene. In a specific embodiment, when more than one desired mutation is present in the exogenous nucleic acid, the desired mutations may affect the same amino acid, such as two point mutations within the same codon, they may each affect different amino acids, or one may affect one amino acid while the others affect a regulatory region. In another specific embodiment, the nucleic acid contains more than one companion mutation wherein the companion mutations together generate one RFLP, such as when one or more mutations are required to generate a new restriction enzyme recognition site. In another specific embodiment, the nucleic acid contains more than one companion mutation wherein the companion mutations generate different RFLPs.

The cells that have been treated with the exogenous nucleic acid, or a sample thereof, are divided to form at least two replicate subcultures of the treated culture. In one embodiment, after the cells have been treated with the exogenous nucleic acid, the cells are allowed to divide at least once, such that two daughter cells arise from a cell which has successfully incorporated the mutations. This cell division step may be done before or after the cells, or a sample thereof, are divided into replicate subcultures. Alternatively, cells may be allowed to divide both before and after the replicate subcultures are formed. A sample of genomic DNA from each subculture is then used for further analysis. The sample of genomic DNA may be extracted using any of a number of methods and reagents commonly available in the art, and such method may be selected according to the cell type. The references listed herein contain methods that may be used to isolate genomic DNA. One skilled in the art will appreciate that the genomic DNA does not need to be of great purity, as PCR reactions may be performed in the presence of some contaminating cell debris or cellular proteins.

In one embodiment, the methods of the invention employ at least two DNA amplification steps, wherein the product of the first PCR amplification is used as the template for the second. The first PCR amplification is a conventional PCR amplification, while the second uses an allele-specific oligonucleotide primer. In an alternative embodiment, the first PCR amplification is omitted, such that the genomic DNA is used as a template for the second PCR amplification. Such omission might be desirable when the conditions of the second amplification are such that sufficient amplification of the DNA is obtained, when the ratio of the size of the amplified DNA fragment relative to the size of the genome of the modified target cell or virus is not exceedingly small, or when detection of the 5' mutation relies on a highly sensitive technique, such as PCR-amplification.

For convenience, the following nomenclature related to the PCR will be defined. The template DNA is an antiparallel duplex and consists of complementary sense and antisense strands. PCR amplification typically employs a template duplex and two primers, one complementary to the sense strand and one complementary to the antisense strand, although PCR amplification can also be performed using a single-stranded DNA molecule as template rather than a DNA duplex. In PCR amplification, all DNA polymerization occurs by addition of 5'dNTP to the 3' end of the primer and release of pyrophosphate. DNA is conventionally represented with the 5' end on the left and the 3' on the right. Accordingly, the primer that is complementary to and binds the antisense strand is the "forward" primer (polymerization moving left to right) and the primer that is complementary to and binds the sense strand is the "reverse" primer. However, when a DNA duplex is used as template, the sense and antisense strands are present as templates in equal amounts at all stages of the reaction. Accordingly, in the reaction there is no distinction between the forward and the reverse primer. In on embodiment, the primers are designed using a computer program to calculate the melting temperature and to exclude self-complementarity. Suitable software is available at "www.oligos.net" from Molecular Biology Insights, Inc., Cascade CO. The melting temperature should be between 50 °C and 60 °C. Primer length is between about 16 and 21 nucleotides, although longer primers may also be used. The length of the primer may be adjusted to compensate for GC content and to achieve a melting temperature in the target range.

The annealing temperature of the PCR reaction using the AS-primer must be empirically selected for each primer set using templates that are mixtures of known amounts of the mutated and non-mutated template. Good results can be obtained by initially using a 1:1 mixture running a coarse series of reactions at various temperatures and finding the lowest temperature that gives essentially no amplification from the non-mutant template. Using that temperature as a starting point a second and finer sequence of temperatures is tested using a titration of mixtures (1:100, 1:1000 and 1 : 10,000) until a temperature with suitable sensitivity is determined. Typically a temperature that results in about 500-1000 fold preferential amplification can be found, i.e., a product ratio of 1:10 can be obtained from a template ratio of 1:10,000.

The first PCR process merely amplifies the target genomic fragment and eliminates the possibility of contamination of the assay with the exogenous nucleic acid. To avoid contamination from the exogenous DNA, the primers for the first PCR reaction may be chosen to make amplification of the exogenous nucleic acid unlikely or impossible. Contamination by the exogenous nucleic acid may occur, for instance, from residual exogenous template in the culture media or from a non- homologous integration event into the genome of the target cell population. In some embodiments, the PCR primers used in the first PCR amplification may additionally introduce sequences which may facilitate further manipulation of the resulting PCR products, such as introducing restriction enzyme sites for subcloning or introducing sequences compatible for annealing to sequencing primers.

The genomic DNA from about 10,000 mammalian cells is the largest amount of genomic DNA that can be conveniently used in a PCR reaction. In one embodiment, the detection of the desired mutation in one per 10,000 cells is readily achieved. In another embodiment, the initial subcultures optimally contain about 10,000 individual cells from the treated culture.

The first PCR product is diluted and used as the template for the second PCR amplification, which uses the allele-specific primer process performed at reduced stringency. The dilution can be adjusted depending on the specific application. In one embodiment, the first PCR product is diluted about from 1:50 to about 1:20,000. The primers for this reaction are conventionally termed the forward primer and the allele-specific (AS)-PCR primer. In this reaction, either primer can be complementary to either strand. The AS-PCR primer can be selected to contain either the desired or the companion mutation. Whichever mutation is encoded by the AS-PCR primer, it is preferred that the mutation be contained at least in part near the 3' terminal of the primer and more preferably at the 3' terminal nucleotide of the AS-PCR primer. For example, if the mutation comprises an insertion of three nucleotides, it preferred that at least the last nucleotide of the primer be able to anneal to the most 3' of the inserted nucleotides, although the primer may the designed so that the last two or the last three nucleotides of the primer anneal to the two or three inserted nucleotides, respectively. In specific embodiments, the AS- PCR comprises the entire '3 mutations. In another embodiment, the AS-PCR primer preferentially anneals to a DNA fragment containing the 3' mutation compared to a DNA fragment not containing the 3¹ mutation.

In embodiments where more than one desired mutation or more than' one companion mutation is introduced into the nucleic acid, the AS-PCR primer may contain more than one mutation, such as when the two mutations are point mutations that are adjacent or very close together. Alternatively, in embodiments where more than two mutations are introduced into the target DNA, an AS-PCR primer containing one mutation may be used in one round of PCR amplification, whereas a second AS-PCR primer directed to a second mutation may be used in subsequent reiterations of the screening methods. Similarly, in embodiments where more than two mutations are introduced into the target DNA, one mutation may serve as the basis for identifying a positive subculture, while a second mutation is used at any other iteration.

The mutation contained in the AS-PCR primer is herein termed the "the 3' mutation." The companion mutation can more readily be used to generate a restriction site. Accordingly, in one embodiment of the methods described herein, the AS-PCR primer contains the desired mutation and the companion mutation generates an RFLP. In such case, the desired mutation would be the "3' mutation" and the companion mutation would be the "5' mutation." The forward primer is designed so that the target genomic fragment is amplified but it does not itself contain the 5' mutation. Note that the terms 3' mutation and 5' mutation do not connote positions for the mutations.

As described above, in embodiments where more than two mutations are introduced into the nucleic acid, two of the mutations may be designated as the 5' and 3' mutations. Alternatively, more- than one mutation may be used as a 5 ' or 3' mutation. For example, an exogenous nucleic acid may have two 5' mutations and one 3' mutation, such that one skilled in the art may chose to detect either 5' mutation at any step while performing the methods described herein. One 5' mutation may be detected during the initial replicative subcultures, while the other 5' mutation is detected during one or more of the iterations. Likewise, when an ^; exogenous nucleic acid contains more than one 5' mutation or more than one 3' mutation, one of the mutations may be relied upon to analyze one replicative subculture while the other is used to analyze one or more of the others subcultures. Many of these variations are obvious to one skilled in the art and lie within the scope of the invention.

It will be readily appreciated that the detection of the 3 ' mutation by PCR- amplification using the AS-primer preferably involves a base-pairing mismatch at the 3' terminal of the AS-PCR primer with the non-mutated DNA. Accordingly, there is no material difference whether the 3' mutation is a substitution, deletion or insertion. Similarly, the 5' mutation can be a substitution, deletion, or insertion. As used herein, a deletion mutation refers to a deletion of one or more continuous base pairs, an insertion mutation refers to an insertion of one or more continuous base pairs, and a substitution refers to a single nucleotide substitution.

The size of the first and second products is not critical to the invention. The product of the first PCR may conveniently be between about 50 bp and 5,000 bp, between 100 bp and 2,500 bp or between 250 bp and 1,000 bp. The size will depend, in part, on the distance between the elected 5' and 3' mutations. The product of the second PCR-amplification is selected to permit ready detection of the 5' mutation. In general, the second PCR product is conveniently between 50 bp and 5,000 bp, between 100 bp and 2,500 bp or between 250 bp and 1,000 bp, although smaller or larger fragments may be generated.

The 5' mutation may be detected using any of a number of methods commonly known in the art. In one embodiment, the method comprises direct DNA sequencing of the second PCR product. In another embodiment, the method comprises digestion of the second PCR product with at least one restriction enzyme, , preferably followed by analysis of the resulting DNA fragments by agarose electrophoresis. Another embodiment comprises a third PCR amplification, such as a AS-PCR amplification, wherein one of the primers is specific for the 5' mutation. An alternative system to detect the 5' mutation is commercially available (PE Biosystems) under the tradename TaqMan™. The system relies upon an oligonucleotide probe labeled at opposite ends with a fluorescent dye and a quenching dye. The probe is hybridized to the AS-PCR product in the presence of Tag polymerase. Selection of suitably stringent hybridization conditions permits hybridization to the sequence containing the 5 'mutation but not to the unmodified sequence. Hybridization is detected because of the 5' exonuclease activity of the polymerase, which releases the fluorescent dye from proximity to the quencher. The release results in a detectable fluorescent signal. Livak, K.J.,1999, Genetic Anal. 14, 143-149.

Once a positive subculture has been identified, at least two subdivisions of that culture are made, and the presence of the 5' mutation in the subdivisions is determined, thereby progressively enriching for the desired cell until a clone is identified. However not each subdivision needs to be tested. For example, if 10 subdivisions are made and the first subdivision is tested and found to contain the 5' mutation, the other subdivisions do not need to be tested, and further subdivisions from the first positive culture may be made.

In one embodiment, when a single cell clone has been isolated, the presence of both the 5' and 3' mutations are confirmed. Such confirmation may occur, for example, by sequencing a PCR product encompassing the region where the mutations are found. In another embodiment of the methods described herein, the cloned cell is transplanted into the subject from which the original cell was derived, wherein the subject comprises a multicellular organism, preferably a mammal or more preferably a human.

Accordingly, the invention also provides a method for introducing a corrective or compensatory mutation in a gene of a cell, such that transplantation of the cell back into the subject from which the cell was derived provides a therapeutic value to the subject. A related aspect of the invention provides a method of treating a subject afflicted with a disorder, comprising transplanting to the subject the rare mutated cell isolated according to any of the methods described herein, thereby treating the disorder. In one specific embodiment, the disorder is a genetic disorder such as diabetes. Examples of genetic disorders may be found, for example, in Medical Genetics, L.N. Jorde et al., Elsevier Science 2003, and Principles of Internal Medicine, 15th edition, ed by Braunwald et al., McGraw-Hill, 2001. In one representative embodiment, human pancreatic cells carrying a mutation in the insulin gene that impairs the ability of insulin to regulate blood sugar levels in a human subject are isolated from the subject and genetically modified, using the methods described herein, to increase the biological function of insulin, such as by removing the original mutation or introducing a compensatory mutation. A rare modified cell is isolated using the methods described herein, and a composition comprising the genetically modified cell is introduced into the patient, thereby providing a therapeutic improvement in the regulation of blood sugar level in the human subject.

The invention further provides specifically mutated cells, and compositions comprising specifically mutated cells, that are generated using any of the methods described herein. Furthermore, the invention provides the use of a specifically mutated cell, isolated using any of the methods described herein, for the manufacture of a medicament. In one embodiment, the medicament is administered to a subject from whom the cell was derived.

The practice of the present invention will employ, where appropriate and unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, virology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are described in the literature. See, for example, Molecular Cloning: A Laboratory Manual, 3rd Ed., ed. by Sambrook and Russell (Cold Spring Harbor Laboratory Press: 2001); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Using Antibodies, Second Edition by Harlow and Lane, Cold Spring Harbor Press, New York, 1999; Current Protocols in Cell Biology, ed. by Bonifacino, Dasso, Lippincott-Schwartz, Harford, and Yamada, John Wiley and Sons, Inc., New York, 1999; PCR Protocols, ed. by Bartlett et al., Humana Press, 2003. Basic Cell culture, ed. By John Davis, Oxford University Press, 2002; .

Exemplification

The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

Examples

Example 1:

In order to detect potentially rare events that do not result in a phenotype, we developed a highly sensitive screening procedure that takes advantage of SFHR's ability to alter more than one nucleotide. We reasoned that rare events (<0.01%) would require a pooling strategy whereby transfected cells would be plated in 96 well plates at cell densities ranging from 100 to 1,000 cells per well. The plated cells would then be maintained for several doublings and split half going for analysis and half maintained for clonal isolation and further analysis. Such a pooling strategy would limit our ability to use standard molecular analysis, like sequencing or restriction fragment length polymorphism (RFLP) analyses, to detect the rare edited events in pooled populations. Moreover, since the sampling size in a standard PCR reaction is limited, ranging from 1-3 X 10⁴ genome equivalents (60-180 ng of DNA in a lysate), the assay must be sensitive and specific enough to detect 10 edited alleles in the background of a sample containing at least 10⁴ cells. Allele-specific PCR (AS-PCR) has been used successfully by a number of labs to detect certain polymorphisms in mixed cell populations but requires optimization and carefully designed and purified primers. However, even carefully designed and optimized AS- PCR assays can lead to false positives, due to varying conditions brought about by cell lysis, or false negatives, because the assay is too stringent for detecting low levels (0.1%) of a particular single nucleotide polymorphism. False negatives are a great concern.

The gene-editing strategy employed in this experiment makes two changes in a target sequence - one that affects the function of the gene in the desired way, such as repairing the 1514 stop codon of pCmutNG, and an other that introduces a closely positioned nucleotide change that can be functionally silent, i.e., changing GTG to GTC for pCNG-N1515v. By making two base changes it is possible to design an assay that allows for the selective amplification of a gene-edited target using the AS- PCR primer that is selective for one of the nucleotide changes followed by a secondary assay that is specific for the second nucleotide change.

Using this strategy we detected as few as 4 copies of the pCVG-N1515v template, carrying two nucleotides differences, from a sample containing 40,000 copies of the pCmutNG. We mixed two cell lines, containing either an integrated pCmutNG or pCNG1515v plasmids, at varying ratios. PCNG-N1515v expresses a functional NWF-GFP fusion differing from pCmutNG at two nucleotides- CAG at codon 1514 and a silent nucleotide change (GTG to GTC) in the adjacent codon, 1515. The pCNG-Nl 515v has a Fok I restriction site overlapping the wildtype 1514 codon, which is not present at the corresponding position in the mutant pCmutNG. In order to increase our sensitivity and selectivity, we performed two rounds of PCR amplification. The first reaction used a primer set flanking of the SFHR targeted region. The products from the first round reaction were diluted 10,000 fold and used as a template for a second round PCR reaction, which uses the AS-primer (1515 AS) as a handle to selectively enrich sequences containing the N1515v sequence. The second PCR product (170 bp) was then digested with Fokϊ. Uncut PCR products from the second reaction are those that do not contain the second nucleotide change and contain the stop codon. If the second PCR reaction selectively enriches for the N1515v site and the second nucleotide change (CAG at position 1514) is present, Fok I will digest the AS-PCR product into a 142 and 38 bp fragments. Agarose gel electrophoresis of the digest demonstrated the selective amplification of the pCNG- N1515v template in the background of the pCmutNG template. These data show that we can detect as few as four copies of pCNG-N1515v in the background of 40,000 cells containing pCmutNG.

HEK-pCmutNG cells were transfected with SDF-N1515v SFHR molecule (defined by primer set 4740C/8350ΝC). Grown for two days and split into a 96-well plate at a cell density of 1000 cells per well. Following 1 week (7 doublings) the cells were split into a replicate 96-well plate and grown for an additional day. One plate was lysed in 50 uL of lysis buffer (50 mM KCl, 10 mM Tris pH 8.3, 1.0 mM MgCl₂ O.lmg/mL Gelatin, 0.45% v/v Igepal CA-630, 0.45% v/v Tween 20, and Proteinase K at 1 ug/ml) at 55 °C for 5 hours. The Proteinase K was inactivated by heating a 95 °C for 15 minutes. 10 uL of each lysate was used in the first round PCR reaction using primers 213NC/7716C and 1 x PCR buffer with 1.5 mM MgCl₂.

The cycling conditions were as follows: 95 °C for 2 min; 35 cycles of (95 °C 45 sec, 55 °C 45 sec, and 72 °C for 1.5 min, followed by a 5 minute extension at 72 °C. The first round products were then diluted in water at 1:10,000. 10 μl of this dilution was used in the second PCR reaction using primers AS-PCR NC/4740C primer set and 1 X PCR buffer with 1.5 mM MgCl₂. The cycling conditions were as follows: 95 °C for 2 min; 35 cycles of (95 °C 30 sec, 62 °C 30 sec, and 72 °C for 30sec, followed by a 2 minute extension at 72 °C.) 10 uL of each product was digested with 5 Units of FoKl and analyzed on a 4 % agarose gel. One can also use the primers AS-PCRC and 8350NC primers coupled with Drdl.

First Round PCR Primers 213NC 5' TCGGGGTAGCGGCTGAAGCAC 3' (SEQ ID NO: 1)

7716C 5' CATGGCACAAGTCACTGTGG 3' (SEQ ID NO: 2)

Second Round AS Primers

b-8350NC 5'CCACCTGCACACAAGGTGCC 3' (SEQ ID NO: 3) b-4740-4720C 5 ' AACAGGACCAACACTGGGCTG 3 ' (SEQ ID NO: 4)

AS-PCR-C 5' GGCTGCCTGGAGACATCC 3' (SEQ ID NO: 5)

AS-PCR-NC 5' GCCCACTCCAATGGGCACG 3' (SEQ ID NO: 6)

Example 2

Example 2 concerns the detection of mutations in a murine erythropoietin receptor. A stop codon was introduced into at Glu398 and a silent mutation (GCT- >GCC) was introduced at the codon encoding Ala399. The mutation converts the receptor to one that is constitutively active, conferring hormone independent growth.

A primary PCR product of about 920 bp was formed followed by a second

PCR product of 391 bp. Detection of the conversion event was performed by the detecting the removal of a HmdIII site from the wild type sequence.

First Round PCR: 50uL reaction mixes contain template DNA (2 ng), 30 pMoles of each primer 30u/9511) flanking the target sequence, 0.2 mM of each dNTPs, 1.5 mM MgCl₂ and 3 units of Taq Polymerase. Cycling conditions, 2 minute (min) denaturation at 95 °C; followed by 35 cycles of a 30 second (s) 95 °C denaturation; 30 s 54 °C annealing; and 30 s 72 °C extension; and a final 2 min extension at 72 °C).

Second PCR using AS-primer: 50 uL reaction mixes contain template DNA

(2 ng), 30 pMoles of each primer flanking the target sequence, 0.2 mM of each dNTPs, 1.5 mM MgCl₂ and 3 units of Taq Polymerase. Cycling conditions, 2 minute (min) denaturation at 95° C; followed by 35 cycles of a 30 second (s) 95 °C denaturation; 30 s 54 °C annealing; and 30 s 72 °C extension; and a final 2 min extension at 72 °C).

First Round Primers: muEPO-R30U21 5 ' CCC AAG CCC AGA GAG CGA GTT 3 ' (SEQ ID NO:

9) muEPO-R951L 5' GAA TAA GAC GAA TCA AGG 3' (SEQ ID NO: 10)

Second Round AS Primers:

muEPO-R834L21 5 ' GGC TTC ACC AAT CCC GTT CAA 3 ' (SEQ ID NO: 11) or muEPO-R95 IL 5 ' GAA TAA GAC GAA TCA AGG 3 ' (SEQ ID NO: 12) and As-PCR-C 5' GACCCTGTGACTATGGATT 3' (SEQ ID NO: 13) Using test systems, RFLP analysis was readily able to detect as few as 3 mutant events per 2,000 wild-type genomes.

Example 3

This example demonstrates the detection of cells possessing introduced mutations in the bovine PrP gene. Figure 2A shows a map of the bovine PrP gene (BoPrP). The positions and sequence of the intended nucleotide changes in the boPrP's coding region are indicated. For the PrP⁰ target region, shown on the left half of figure 2A, the desired mutation is a stop codon introduced at lysine 25, and the companion mutation is a silent G to A change in the third codon position of valine 21. The companion mutation introduces a Stul recognition site. Thus, the wildtype allele is designated as 25KN and the mutant allele as 25Xv.

For the PrP^ARR BSE-Resistant region, shown on the right half of Figure 2A, the desired mutation is a lysine to arginine substitution at position 179, and the companion mutation is a silent G to A change in the third codon position of valine 177. The companion mutation introduces a Pvul recognition site. Thus, the wildtype allele is designated as 179QN and the mutant allele as 179Rv.

The SDF targeting molecules and target sequence used are shown in Figure 2B. SDF-25Xv and SDF-179Rv molecules are 350 and 400 base pairs, respectively, as defined by the respective primer pairs (Prl and Pr2) as indicated. The positions of the PCR primers for PCR amplification using AS-primers are indicated (Pr3-6 for each respective target, sequences are indicated below.).

25X-Pr3 5' GCCCAGTTGCAAGAATC 3' (SEQ ID NO: 14)

25X-Pr4 5' CGCCAAGGGTATTAGC 3' (SEQ ID NO: 15)

25X-Pr5 5' TTTCGTGAGATGTATGGAATG 3' (SEQ ID NO: 16)

25XAS-Pr6 5' AGGTTTTGGTCGCTTCTA 3' (SEQ ID NO: 17)

179R-Pr3 5' GCCCAGTTGCAAGAATC 3' (SEQ ID NO: 18)

179R-Pr4 5' CGCCAAGGGTATTAGC 3' (SEQ ID NO: 19)

179R-Pr5 5* GAAGCATGTGGCAGGAG 3' (SEQ ID NO: 20)

179RAS-Pr6 5' GTTGTTCTGGTTACTATACC 3' (SEQ ID NO: 21)

For the desired mutation at position 25, the gene-editing event is confirmed by the presence of the Stu I site at the "Handle" location caused by the companion mutation. The first-round PCR amplification uses primers external to the targeted region, 25XPr3 and 25XPr4. The first-round PCR products are diluted (1:10,000) and used as a template in a second PCR reaction using the 25XPr5 primer and the allele-specific 25XAS-Pr6 primer. The products of the second PCR reaction are then digested with Stw I and analyzed by RFLP following agarose gel electrophoresis. Alternatively, the product of the second PCR amplification can be sequenced directly using Pyrosequencing , a newly developed real-time high- throughput SNP detection technique. Pyrosequencing is described in Nordstrom et al. (2000) Anal Biochem 282(2), 186-93 and in Example 4 below. Example 4

This example demonstrates the sensitivity of the PCR and detection strategies of the methods provided by the invention using plasmids containing the 25Kv and 25KN alleles. Both Plasmid DΝA samples containing wildtype (Wt-lane 1), mutant (25Xv-lane 3), or a 1:4000 25Xv to wt DΝA mixture as shown in Figure 3, Left panel, were analyzed by RFLP (Left panel) and Pyrosequencing (Right panel). The RFLP following Stul digestion shown in the left panel was analyzed on a 4% agarose gel by electrophoresis. The pyrosequencing profile from each PCR product is illustrated in the right panel of Figure 3. The appearance of the "A" peak and simultaneous reduction in height of the neighboring "G" peak indicates the presence of the edited handle allele.

Example 5

This example shows SDF-mediated PrP targeting in bovine fibroblasts. In order to assess the power of the handle detection technology for assessing SFHR- mediated gene-editing events, primary fetal bovine fibroblasts transformed with E6/E7 expressing retrovirus (LXSΝ-E6/E7- InVitrogen) were transfected with the SDF-25Xv small fragment homologous replacement (SFHR) genome-editing molecule (Kunzelmann et al., (1996) Gene targeting of CFTR DNA in CF epithelial cells. Gene Ther 3(10), 859-67). The transfected cells (4 X 10⁵ ) were assayed in 144 pooled samples representing 2800 initially transfected cells per sample. Prior to harvesting, the cells were grown and passaged for 14 days. The cells were lysed using the PCR-compatible lysis buffer (PBND) and a portion of the DNA from each sample was analyzed. A first-round PCR amplification was performed using primers the primers, 25XvPr-3 and 25XvPr-4 primers, which lie outside the SFHR region. The first round products were diluted and then used with an allele-specific primer in a second PCR reaction followed by RFLP analysis. There were 57 positives out of the 144 samples (2800 initial cell per sample). We calculated that the gene-editing frequency for generating the 25Xv allele was at least 0.014% (~1 in 7,000 cells transfected). Five samples are shown in Figure 4. The sequence of the PCR products were also analyzed by pyrosequencing to confirm the presence of the handle modification - the appearance of an A peak (Figure 4). All of the samples analyzed that were positive by RFLP also contained the A peak in the pyrosequencing reaction. None of the RFLP negative samples contained an A peak (Figure 4).

Incorporation by Reference

All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent were specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.

Equivalents

While specific embodiments of the subject inventions are explicitly disclosed herein, the above specification is illustrative and not restrictive. Many variations of the inventions will become apparent to those skilled in the art upon review of this specification and the claims below. The full scope of the inventions should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

Claims

Claims:

1. A method of cloning a specifically mutated cell from a culture of cells, comprising: a) subjecting the culture to a sequence-specific process that introduces at least one 3' mutation and at least one 5' mutation in a genomic target; b) forming at least two replicate subcultures of the treated culture; c) performing a PCR amplification using a sample of genomic DNA from a replicate subculture as template to generate a first PCR product, wherein the first PCR product comprises the site of the 3 ' mutation and the site of the 5' mutation; d) performing a PCR amplification using (i) the first PCR product as template; (ii) an AS-PCR primer that contains at least part of the 3' mutation; and (iii) and a forward primer that does not contain the 5' mutation, to generate a second PCR product that contains the site of the 5' mutation; e) identifying a positive subculture by identifying the presence of the 5' mutation in the second-PCR product; f) cloning a rare mutated cell from the positive subculture, wherein the rare mutated cell contains the 5' mutation and the 3' mutation.

2. The method of claim 1 , wherein prior to step (f), steps (b) through (e) are reiterated at least once, with the modification that in each subsequent iteration of step (b) the replicate subcultures are formed from the positive subculture identified in the preceding step (e).

3. The method of claim 1, wherein the second PCR product is generated under PCR hybridization conditions wherein the amount of second PCR product generated is not significantly affected by the presence or absence of the 3' mutation in the first PCR product.

4. The method of claim 1, wherein the cloned cell contains both the 5' and the 3' mutations.

5. The method of claim 1, wherein the 3' terminal end of the AS-PCR primer contains at least part of the 3' mutation.

6. The method of claim 1, wherein the presence of the 5' mutation is identified using a restriction enzyme digest.

7. The method of claim 1, wherein the presence of the 5' mutation is identified pyrosequencing.

8. The method of claim 1, wherein the presence of the 5' mutation is identified using PCR.

9. The method of claim 8, wherein the PCR is AS-PCR.

10. The method of claim 1, wherein the presence of the 5' mutation is identified by hybridization-dependent enzymatic degradation of an oligonucleotide probe that is labeled with a fluorescent dye and a quenching dye, wherein said degradation results in separation of the fluorescent dye and the quenching dye.

11. The method of claim 1, wherein the sequence-specific process is short fragment homologous recombination (SFHR).

12. The method of claim 1, wherein the AS-PCR primer contains the 3' nucleotide mutation.

13. The method of claim 11 , wherein the SFHR is performed with an exogenous nucleic acid substantially free of the antisense strand.

14. The method of claim 11, wherein the SFHR is performed with an exogenous nucleic acid substantially free of the sense strand.

15. The method of claim 1, wherein the mutated cell is a yeast cell, a mammalian cell, a bacterium, or a plant cell.

16. The method of claim 5, wherein the sequence-specific process is short fragment homologous replacement (SFHR).

17. The method of claim 16, wherein the SFHR is performed with an exogenous nucleic acid substantially free of the antisense strand.

18. The method of claim 16, wherein the SFHR is performed with an exogenous nucleic acid substantially free of the sense strand.

19. The method of claim 11, wherein the mutated cell is a yeast cell, a mammalian cell, a bacterium or a plant cell.

20. A method of treating a subject afflicted with a disorder, comprising transplanting to the subject the rare mutated cell isolated according to the method of claim 1, thereby treating the disorder.

21. The method of claim 20, wherein the cell is derived from the subject.

SEQUENCE LISTING

<110> Metz et al.

<120> A METHOD FOR CLONING OF A RARE, SPECIFICALLY MUTATED CELL

<130> BRMZ-PWO-003

<Ϊ40> Not Assigned <141> 2003-11-18

<150> 10/298,850 <151> 2002-11-18

<160> 27

<170> Patentln version 3.2

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 1 tcggggtagc ggctgaagca c 21

<210> 2 <211> 20 <212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 2 catggcacaa gtcactgtgg 20

<210> 3 <211> 20 <212> DNA <213> Artificial Sequence

<220>

<223> primer

<400> 3 ccacctgcac acaaggtgcc 20

<210> 4 <211> 21 <212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 4 aacaggacca acactgggct g 21

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 5 ggctgcctgg agacatcc 18

<210> 6 <211> 19 <212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 6 gcccactcca atgggcacg 19

<210> 7 <211> 21 <212> DNA <213> Homo sapiens

<400> 7 ggagacatcc aggtcgtgcc c 21

<210> 8 <211> 21 <212> DNA

<213> Homo sapiens

<400> 8 ggagacatct aggtggtgcc c 21

<210> 9 <211> 21 <212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 9 cccaagccca gagagcgagt t 21

<210> 10 <211> 18 <212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 10 gaataagacg aatcaagg 18

<210> 11 <211> 21 <212> DNA

<213> Artificial Sequence

<220>

<223> primer <400> 11 ggcttcacca atcccgttca a 21

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 12 gaataagacg aatcaagg 18

<210> 13 <211> 19 <212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 13 gaccctgtga ctatggatt 19

<210> 14

<211> 17

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 14 gcccagttgc aagaatc 17

<210> 15

<211> 16

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 15 cgccaagggt attagc 16 <210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 16 tttcgtgaga tgtatggaat g 21

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 17 aggttttggt cgcttcta 18

<210> 18

<211> 17

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 18 gcccagttgc aagaatc 17

<210> 19

<211> 16

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 19 cgccaagggt attagc 16

<210> 20

<211> 21

<212> DNA

<213> Bovine Sequence <400> 20 gtaggcctct gctagaagcc a 21

<210> 21

<211> 21

<212> DNA

<213> Bovine Sequence

<400> 21 gtgggcctct gcaagaagcc a 21

<210> 22

<211> 12

<212> DNA

<213> Bovine Sequence

<400> 22 gtcgatcggt at 12

<210> 23

<211> 12

<212> DNA

<213> Bovine Sequence

<400> 23 gtggatcagt at 12

<210> 24

<211> 24

<212> DNA

<213> Bovine Sequence

<400> 24 agtgacgtag gcctctgcta gaag 24

<210> 25

<211> 18

<212> DNA

<213> Bovine Sequence

<400> 25 aggccagtcg atcggtat 18

<210> 26

<211> 9

<212> DNA

<213> Artificial Sequence

<220> <223> primer <400> 26 gggcctctg

<210> 27

<211> 9

<212> DNA

<213> Artificial Sequence

<220> <223> primer

<400> 27 aggcctctg