WO1998024925A1 - Tissue specific and target rna-specific ribozymes as antimicrobial therapeutics against microbial pathogens - Google Patents
Tissue specific and target rna-specific ribozymes as antimicrobial therapeutics against microbial pathogens Download PDFInfo
- Publication number
- WO1998024925A1 WO1998024925A1 PCT/US1997/021922 US9721922W WO9824925A1 WO 1998024925 A1 WO1998024925 A1 WO 1998024925A1 US 9721922 W US9721922 W US 9721922W WO 9824925 A1 WO9824925 A1 WO 9824925A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ribozyme
- pathogen
- nucleic acid
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/121—Hammerhead
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/127—DNAzymes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the invention relates to the delivery of ribozymes to microorganisms in order to treat infections. More specifically, the invention relates to the use of virions to package and deliver DNA encoding ribozymes to the an infected patient. Most specifically, the invention relates to the use of target specific virions to package and deliver DNA comprising a target specific promoter and encoding a ribozyme directed to the target organisms nucleic acids.
- Infectious diseases sicken or kill millions of people each year.
- Numerous antimicrobial therapies have been designed to target one or several infectious agents. These therapies show varying degrees of success in eradicating infection. However, the failure of many of these therapies to target specific infectious agents has lead to overuse or inappropriate use of the therapies, which in turn has lead to the development of drug resistant microbes. The development of drug resistance in many infectious agents has reduced the efficacy and increased the risk of using the traditional antimicrobial therapies .
- ribozymes While ribozymes have been known and studied for several years, they have not been used in the treatment of bacterial infections. There are many reasons for this. A key technical concern in the use of ribozymes as antimicrobial agents is that the ribozyme must be taken up and expressed by the targeted microbe so that the ribozyme (s) can cleave the targeted RNA(s) inside the microorganism. This concern is addressed by the present invention.
- RiboZideTM is a microbiocidal agent directed against any viral, bacterial, fungal, or other single or multicellular organism from any known taxonomic family, genus, or species, and from previously unknown, or uncharacterized organism.
- the present composition of matter has resulted from the development of a new process that delivers a series of ribozymes directed against fundamental and essential cellular processes specific to a targeted microorganism through an inactivated, altered, virus (virion) , or abiologic delivery vehicles, capable of delivering a nucleic acid containing the ribozyme (s) into the targeted microorganism.
- the microorganisms maybe any virus, nonvirus, bacterium, or lower eukaryotes such as fungi, yeast, parasites, protozoa, or other eukaryotes that may be consider normal flora or pathogens of humans, animals, fish, plants or other forms of life.
- eukaryotes such as fungi, yeast, parasites, protozoa, or other eukaryotes that may be consider normal flora or pathogens of humans, animals, fish, plants or other forms of life.
- the present RiboZideTM ribozyme is uniquely suited as an antimicrobial therapeutic in that upon nucleic acid hybridization with the target RNA transcript, the ribozyme-RNA complex achieves a catalytic form that acts as a nuclease to cleave the targeted RNAs .
- cleavage deprives the invading microorganism of essential cellular processes which then kill or render it less fit.
- This approach offers new and unprecedented advances for antimicrobial therapeutics: (1) the preparation bypasses any de novo built-in drug resistance, which sophisticated microbes will be expected to have or develop.
- the custom design of the present delivery vehicle can be readily tailored to different families of organisms, (5) the modified delivery vehicle is a non-replicating, artificial construct easy to assemble and manufacture, (6) the preparation can be applied topically or it can be delivered via injection, inhalation, or ingestion, (7) the preparation can be lyophilized and thus confer stability to the antimicrobial therapeutic, (8) the inhalant, ingested or topical form of the antimicrobial therapeutic reduces the immunogenicity of the RiboZideTM preparations as opposed to its parenteral use, and (9) animal test systems exist that enable the evaluation of the RiboZideTM in a measured, incremental fashion to quickly determine the efficacy of the antimicrobial therapeutic agent. Therefore, the combination of the present unique delivery approach and an aggressive mechanism for depriving the microbial cells of essential gene products can achieve the timely defeat of microbe
- the targets of the antimicrobial RiboZideTM therapeutic described herein are the RNAs of invading or normal flora microorganisms.
- the invention provides the delivery of a series of ribozymes directed towards essential, housekeeping, or virulence genes of one or a series of candidate microorganisms.
- a ribozyme is uniquely suited as the active component of the present antimicrobial therapeutic in that it is a catalytic RNA molecule that cleaves RNA in a sequence specific manner. Therefore, the catalytically active component of RiboZideTM contains ribozymes that have been designed to inactivate RNA coding for components of the microbial cell. Inactivation of essential proteins and virulence determinants render the invading microbes inactive or slow their growth, while at the same time, the essential processes of the host are not affected.
- the coding sequence for a ribozyme or number of ribozymes may be placed under the control of one or more of the following genetic elements: a naturally occurring strong, intermediate or weak constitutively expressed or regulated promoter from the targeted microorganism, or an artificially contrived constitutively expressed or regulated promoter containing either a strong, intermediate or weak consensus sequence that delivers desired levels of ribozyme expression in the targeted microbe.
- This genetic information is delivered into the microbe by a either a modified virus or abiologic delivery vehicle.
- This present RiboZideTM is unique in that it contains sufficient genetic information for expression of the ribozyme (s) and such genetic information necessary and sufficient for its assembly and delivery to the targeted microorganism, but does not include nucleic acids native to the virus.
- the virion can serve as a molecular vehicle that delivers the inactivating ribozyme (s).
- an abiologic delivery system e.g., liposomes
- Figure 1A shows a schematic of DNA encoding the ribozyme used in the molecular sequence of events in ribozyme maturation and action.
- Figure IB shows the primary RNA transcript. Autocatalytic cleavage takes place upon completion of transcription.
- Figure IC shows the release of the trans acting ribozyme.
- Figure ID shows the sequence specific hybridization of the ribozyme.
- the internal or trans acting ribozyme contains a sequence that is reverse and complementary to the targeted message.
- the ribozyme is synthesized at a concentration sufficient to locate and hybridize to all or substantially all targeted transcripts.
- Figure IE shows the trans-catalytic cleavage. Upon hybridization of the internal ribozyme to the targeted mRNA transcript, the internal ribozyme achieves a catalytic topology and cleaves the targeted message. Upon cleavage the trans acting ribozyme is released and its activity and function are recycled.
- Figure 2A shows in vi tro packaging of the RiboZideTM.
- Purified double-stranded DNA containing a pathogen-specific promoter, ribozymes, transcriptional termination site and packaging elements is mixed with an appropriate concentration of the in vi tro packaging extract which contains all of the necessary proteins required for the spontaneous self assembly of viral head around the nucleic acid.
- Figure 2B shows the collection and purification of the intact phage from the components in Panel A.
- Figure 3A shows in vivo packaging of the RiboZideTM.
- Induction of the viral lysogen results in the production the packaging elements that then spontaneously self assembly into a empty virion which are then filled with the ribozyme encoding DNA.
- Figure 3B shows the collection and purification of the intact virion from the components in Panel A.
- Figure 4 schematic representation of the essential genetic elements necessary and sufficient for the production of an active RiboZideTM in a liposome constituting an abiologic delivery vehicle.
- Figure 5 shows the present plasmid, pClip, used to generate the ribozyme encoding DNA construct.
- Figure 6 shows several mutations in the ribozyme that effect catalytic activity.
- the present invention provides a virion comprising non-viral DNA.
- virion as used herein can be a bacteriophage, a mycovirus, or other virus that attacks a bacteria, fungus, yeast, parasite or virus, which can be modified to deliver ribozyme-encoding DNA.
- the virion can be modified to be non-replicative . Alternatively, if preferred, it can maintain the replicative ability of the native virus.
- the virion of the present invention can be any bacteriophage which specifically infects a bacterial pathogen of the present invention as well as any virus which can be specifically targeted to infect the pathogen of the present invention.
- the bacteriophage can include, but is not limited to, those specific for bacterial cells of the following genera: Bacill us, Campylobacter, Corynebacterium, Enterobacter, Enterococcus, Escherichia , Klebsiella , Mycobacteri um, Pseudomonas, Salmonella, Shigella, Staphylococcus , Streptococcus , Vibrio, Streptomyces, Yersinia and the like (see, e.g., the American Type Culture Collection Catalogue of Bacteria and Bacteriophages, latest edition, Rockville, MD) , as well as any other bacteriophages now known or later identified to specifically infect a bacterial pathogen of this invention.
- the non-viral DNA can encode a ribozyme.
- the non-viral DNA can comprises a pathogen-specific promoter upstream from a sequence encoding a triple ribozyme comprising a) a 5' autocatalytically cleaving ribozyme sequence, b) a catalytic ribozyme comprising a target RNA-specific binding site and c) a 3' autocatalytically cleaving ribozyme sequence.
- the present virion wherein the non-phage DNA encodes more than one triple ribozyme is also provided.
- ribozyme encoding sequences 1) ribozymes directed to different targets in the same pathogen; and 2) multiple copies of the same ribozyme. These be combined in various ways, e.g., multiple copies of DNA encoding 4 different ribozymes in a single construct under one promoter.
- the promoter can have the chosen level of specificity as described herein.
- the virion can contain a nucleic acid encoding at least two different triple ribozymes.
- the virion can contain a nucleic acid encoding more than one copy of a triple ribozyme.
- the virion can comprise any ribozyme- encoding nucleic acid, particularly those described herein.
- a liposome comprising a nucleic acid comprising a pathogen-specific promoter upstream from a sequence encoding a triple ribozyme comprising a) a 5' autocatalytically cleaving ribozyme sequence, b) a catalytic ribozyme comprising a target RNA-specific binding site and c) a 3' autocatalytically cleaving ribozyme sequence.
- the liposome of the invention wherein the nucleic acid encodes more than one triple ribozyme is provided.
- the liposome can comprise any ribozyme-encoding nucleic acid, particularly those described herein.
- the viral and liposomal delivery systems of the invention can be used to deliver a nucleic acid comprising a pathogen-specific promoter upstream from a sequence encoding a triple ribozyme comprising a) a 5' autocatalytically cleaving ribozyme sequence, b) a catalytic ribozyme comprising a target RNA-specific binding site and c) a 3' autocatalytically cleaving ribozyme sequence.
- the nucleic acid delivered by the virion or liposome can encode more than one triple ribozyme.
- the nucleic acid can encode at least two different triple ribozymes.
- the nucleic acid can encode more than one copy of the same triple ribozyme.
- the nucleic acid can encode combinations of different ribozymes, some or all of which may be encoded in more than one copy.
- the nucleic acid, wherein at least one triple ribozyme is targeted to the rpoA transcript of the pathogen is provided.
- the nucleic acid, wherein at least one triple ribozyme is targeted to the secA transcript of the pathogen is provided.
- the nucleic acid, wherein at least one triple ribozyme is directed to the dnaG transcript of the pathogen is provided.
- the nucleic acid, wherein at least one triple ribozyme is directed to the ftsZ transcript of the pathogen is provided.
- a ribozyme- encoding nucleic acid can encode all or some of the above triple ribozymes.
- the triple ribozymes can all be under the control of a single promoter.
- nucleic acid encoding the transacting ribozyme of the triple ribozyme are described herein and in the Sequence Listing (e.g., SEQ ID NOS: 8- 17) .
- a method of treating an infection in a subject comprising administering to the subject a virion comprising DNA comprising a target-specific promoter and encoding a ribozyme, whereby the ribozyme encoded by the non-phage DNA is expressed and the infectious agent is killed or weakened.
- the infection can be bacterial, fungal, yeast, parasitic, viral or non-viral.
- the pathogen of the present invention can also include, but is not limited to pathogenic species of yeast/fungal genera (e.g., Candida , Cryptococcus, Aspergill us , Tri chophyton, Microsporum) as well as any other yeast or fungus now known or later identified to be pathogenic.
- yeast/fungal genera e.g., Candida , Cryptococcus, Aspergill us , Tri chophyton, Microsporum
- the pathogen of the present invention can be a parasite, including, but not limited to, members of the Apicomplexa phylum such as, for example, Babesia, Toxoplasma , Plasmodi um, Eimeria, Isospora , Atoxoplasma , Cystoisospora , Hammondia , Besniotia , Sarcocystis , Frenkelia , Haemoproteus , Leucocytozoon, Theil eria, Perkinsus and Gregarina spp.; Pneumocysti s carinii ; members of the Microspora phylum such as, for example, Nosema , Enterocytozoon, Encephali tozoon, Septata , Mrazekia , Amblyospora , Ameson, Gl ugea , Pleistophora and Microsporidi um spp.; and members of the
- viral pathogens include, but are not limited to, retroviruses (human immunodeficiency viruses) , herpesviruses (herpes simplex virus; Epstein Barr virus; varicella zoster virus) , ortho yxoviruses (influenza) , paramyxoviruses (measles virus; mumps virus; respiratory syncytial virus), picornaviruses (Coxsackie viruses; rhinoviruses) , hepatitis viruses (hepatitis C) , bunyaviruses (hantavirus; Rift Valley fever virus) , arenaviruses (Lassa fever virus) , flaviviruses (dengue fever virus; yellow fever virus; chikungunya virus) , adenoviruses, birnaviruses, phleboviruses, caliciviruses, hepadnaviruses, orbiviruses, papovaviruses,
- the virion construct used in this method can comprise any ribozyme-encoding nucleic acid, particularly those described herein targeted to genes of the pathogen.
- the virion can be a bacteriophage, or other virus selected for its ability to target a specific cell-type, microorganism or animal.
- the bacteriophage can be lambda, PI or other phage.
- PI is the virion
- the non-viral DNA can further comprise a PAC site is also provided. This construct is preferred when using PI.
- the virion can be selected because it has a broad range of targets .
- a method of treating an infection in a subject comprising administering to the subject the liposome comprising DNA comprising a target-specific promoter and encoding a ribozyme, whereby the ribozyme encoded by the DNA is expressed and the infectious agent is killed or weakened.
- the liposome used in this method can comprise any ribozyme-encoding nucleic acid, particularly those described herein targeted to genes of the pathogen.
- the infection can be bacterial, fungal, yeast, parasitic, viral or non-viral.
- a method of delivering a ribozyme to a target (e.g., a pathogen) in a subject comprising a) generating a virion comprising DNA having a promoter specific for the target (e.g., the pathogen) and encoding the ribozyme; and b) delivering the virion to the subject, whereby the pathogen-specific promoter directs transcription of the ribozyme in the cells of the pathogen, thereby targeting the ribozyme to the pathogen.
- the target can be a pathogen, for example, a bacteria, fungus, yeast, parasite, virus or non-viral pathogen.
- the above targeting method wherein the virion is a bacteriophage is provided.
- the bacteriophage can be lambda, PI or other phage.
- the targeting method, wherein the non-viral DNA further comprises a PAC site is also provided. This construct is preferred when using PI.
- a method of delivering a ribozyme to a target (e.g., a pathogen) in a subject comprising a) generating a liposome comprising a promoter and ribozyme encoding sequence; and b) delivering the liposome to the subject, whereby the target-specific promoter directs transcription of the ribozyme in the cells of the target.
- the target can be a pathogen, for example, a bacteria, fungus, yeast, parasite, virus or non-viral pathogen.
- a method of targeted delivery of a ribozyme to a pathogen in a subject comprising a) generating a virion comprising non-viral DNA of the invention; b) combining it with a liposome; and b) delivering the liposome containing the virion to the subject, whereby liposome enters the eukaryotic cell and releases the virion, which delivers the DNA to the pathogen, whereby the pathogen-specific promoter directs transcription of the ribozyme in the cells of the pathogen.
- Ribozymes are catalytic RNA molecules that cleave RNA in a sequence specific manner (3, 5, 24) . With the invention of the present delivery system and construct, they are uniquely suited as antimicrobial compounds in that they possess an intrinsic enzymatic activity under which the ribozyme can act as a nuclease against itself ( ci s acting) or against a different RNA targets ( trans acting) . Catalytic activity of the trans acting ribozyme requires hybridization between the ribozyme and its target at which a catalytic topology is achieved and cleavage occurs.
- trans acting ribozyme can be achieved by placing the coding sequence of the three hammerhead ribozymes under the control of one or more of the following genetic elements: a naturally occurring strong, intermediate or weak constitutively expressed or regulated promoter from the targeted microorganism, or an artificially contrived constitutively expressed or regulated promoter containing either a strong, intermediate or weak consensus sequence that delivers desired levels of ribozyme expression in the targeted microbe.
- a naturally occurring strong, intermediate or weak constitutively expressed or regulated promoter from the targeted microorganism
- an artificially contrived constitutively expressed or regulated promoter containing either a strong, intermediate or weak consensus sequence that delivers desired levels of ribozyme expression in the targeted microbe.
- the first critical component in the assembly of the RiboZideTM is the selection of appropriate RNA targets.
- RNA targets For ribozymes to be effective anti-microbial therapy, it is preferable to target the RNA of, for example, several key proteins, tRNA, rRNA or any other RNA molecule essential for cell viability or fitness, in order to insure complete inactivation and prevent escape of the invading microorganism.
- tRNA, rRNA or any other RNA molecule essential for cell viability or fitness in order to insure complete inactivation and prevent escape of the invading microorganism.
- four bacterial genes, essential for viability and unrelated in activity have been selected and are described herein to highlight how the selection of appropriate mRNA targets is carried out for the preferred construction of the RiboZideTM against prokaryotic targets.
- Cross-genera RNA targets can be used to design a RiboZideTM that can have broad application, modified by the specificity of the promoter.
- the first ribozyme targets an essential transcription factor
- the second ribozyme targets an essential general secretory component
- the third ribozyme targets an essential component of the primosome required for DNA biosynthesis
- the fourth ribozyme targets an enzyme required for cell division. Consequently, the ribozymes are redundant in the fact that they inhibit growth by specifically targeting a fundamental process required for bacterial growth. Thus, this can minimize the development of resistance to the antimicrobial therapeutic.
- the first gene, rpoA produces an essential protein, RpoA or the alpha subunit of RNA core polymerase.
- RpoA was selected rather than the other components of the RNA polymerase holoenzyme, because it is thought to facilitate the assembly of an active RNA Polymerase enzyme complex. Inactivation of the rpoA transcript results in a decrease in the intracellular concentration of the holoenzyme RNA polymerase rendering the cell less able to respond to changes demanded of it once it has invaded a new host.
- the nucleotide sequence of rpoA is known for a large number of microorganisms (>20 genera) and they are readily available from GenBank.
- the second ribozyme target can be the mRNA of the secA gene from bacteria.
- the product of this gene is the essential and rate-limiting component of the general secretory pathway in bacteria (2) .
- SecA has been found in every prokaryotic cell investigated to date. Additionally, its biosynthesis is translationally coupled to the upstream gene, X (17), presenting a convenient target for a ribozyme. Inhibition or decreased synthesis of secA is also sufficient to confer a reduction in viability to the cell (18) .
- a pathogen responds to changes required of the infectious process a change in the availability of a key protein such as SecA will disadvantage the pathogen enabling the host to counteract it.
- the third ribozyme can target an essential factor for DNA biosynthesis, DnaG. Every 1 to 2 seconds, at least 1,000 times for each replication fork within E. coli , priming of an Okazaki fragment is repeated as a result of an interaction between the cellular primase DnaG (4) and DnaB (11) . As would be expected of protein required every 1 to 2 seconds during replication, a lesion within dnaG or an alteration in its concentration results in an immediate stop phenotype (11, 28). Therefore, inactivation of the dnaG message by a ribozyme should have profound cellular consequences in that general priming of the lagging strand is reduced if not eliminated.
- DnaG is a component of the primosome, a multi-protein complex responsible for priming replication. Any of the components of the primosome, either individually or in any combination, can serve as a target for inactivation of the primosome and, thus, kill the cell.
- the other components of the primosome are DnaB, DnaC, DnaT, PriA, PriB, and PriC.
- the primosome is also sufficiently complex to provide numerous other targets (DnaB, DnaC, DnaT, PriA, PriB and Pri C) for inactivation by the trans ribozyme.
- the fourth target can be ftsZ .
- This gene also encodes an essential protein, FtsZ, that is required for cell division in that it is responsible for the initiation of separation.
- FtsZ was selected because its synthesis was under the control of an antisense RNA molecule encoded by the gene dicF. Transcription of dicF is all that is needed to inhibit the translation of ftsZ; thus, overexpression of this antisense molecule is sufficient to cause an inhibition of cell division and a reduction in viability.
- dicF a ribozyme against ftsZ over the antisense molecule, dicF. Specifically, the ribozyme functions catalytically while dicF functions stoichiometrically.
- RiboZideTM can comprise ribozymes targeted to these other messages.
- ribozymes may be targeted against other RNA species within the cell.
- appropriate targets in bacteria, fungi and other lower eukarytoes include ribosomal RNA such as Small Subunit RNAs (SSU) or Large Subunit (LSU) and tRNA molecules required for protein synthesis.
- SSU Small Subunit RNAs
- LSU Large Subunit
- tRNA molecules required for protein synthesis.
- the RiboZideTM therapeutic can hybridize and cleave the RNA complimentary RNA and impact on the fitness of the microbial cell.
- over 3000 rRNA species have been sequenced and aligned.
- Promoter selection is accomplished using techniques that are available in the art. For example a method is described in the Examples that permits the selection of both controlled and uncontrolled promoters, as well as consensus promoters that can be design for application in the present RiboZideTM.
- the promoter can be a naturally occurring strong, intermediate or weak constitutively expressed or regulated promoter from the targeted microorganism, or an artificially contrived constitutively expressed or regulated promoter containing either a strong, intermediate or weak consensus sequence that delivers desired levels of ribozyme expression in the targeted microbe.
- the RiboZideTM ribozyme possesses sufficient catalytic activity to inactivate the RNA of the targeted transcripts. From an antimicrobial perspective, hammerhead-type ribozymes are especially attractive since the molecule inactivates gene expression catalytically through the cleavage of the phosphodiester bond of the mRNA. Furthermore, hammerhead-type ribozymes have been re-engineered to function in an intermolecular or transducer (trans) acting state (6, 27). The catalytic activity of the ribozyme requires a sufficient concentration of the divalent cation, Mg +2 , and substrate.
- the substrate can have any sequence as long as the cleavages site contains the recognition element NUX, where N represents any nucleotide, U corresponds to uracil, and X is any nucleotide except G (8) .
- Ribozymes have been widely demonstrated to function in vivo (5,7) .
- the present invention improves the initial design of hammerhead-type ribozymes (25) by constructing a cassette containing two cis acting hammerhead ribozymes flanking a ribozyme that inactivates the targeted RNA. Upon transcription the targeted ribozyme is released as a 60-70 base transcript which not only improves its specificity by reducing non-specific interactions but also improves its catalytic activity as well.
- This invention includes modifications to the ribozyme described in U.S. Serial No. 08/554,369.
- the arms of the cis acting ribozymes have been lengthened by 20 bases.
- the sequence has been modified to enhance the catalytic activity of the cis-acting elements, for example those shown in SEQ ID NOS: 18-38. Additional restriction sites are included that facilitate easier cloning and manufacturing.
- tRNA elements are present in to the 3' end of the RiboZideTM.
- the addition of the tRNA elements creates additional structure that improves the stability of RiboZideTM helping it resist nuclease attack.
- An inverted nucleotide repeat has been inserted into the 3' end of the RiboZide-i.
- the addition of the inverted repeat, a hairpin loop structure improves the stability of RiboZide-i helping it resist nuclease attack.
- ribozymes in eukaryotes was limited because a convenient and efficient delivery system has not been available.
- a key to the present invention is the strategies used to deliver the ribozyme to the targeted microorganism. Two separate classes of delivery systems can be manufactured, one biologic in nature and the other abiologic.
- the key features of the present invention are the combination of ribozyme with viral delivery and assembly of the virions using a unique combination of plasmid features .
- ribozyme Abiologic delivery of the ribozyme is accomplished by packaging plasmid DNA carrying the gene(s) that codes for the ribozyme (s) into liposomes (Fig 4.).
- the liposome is be composed of cationic and neutral lipids commonly used to transfect cells in vi tro .
- the cationic lipids complex with the plasmid DNA and form liposomes.
- the RiboZide that is administered to a subject can further comprise a liposome.
- Cationic and neutral liposomes are contemplated by this invention.
- Cationic liposomes can be complexed with the a negatively-charged biologically active molecule (e.g., DNA) by mixing these components and allowing them to charge-associate.
- Cationic liposomes are particularly useful when the biologically active molecule is a nucleic acid because of the nucleic acids negative charge.
- Examples of cationic liposomes include lipofectin, lipofectamine, lipofectace and DOTAP (30-32) .
- Procedures for forming cationic liposomes encasing substances are standard in the art (33] and can readily be utilized herein by one of ordinary skill in the art to encase the complex of this invention.
- the liposomes may be incorporated into a topical ointment for application or delivered in other forms, such as a solution which can be injected into an abscess or delivered systemically.
- Plasmid DNA coding for the ribozymes is used rather than preformed ribozymes for the following reasons. Plasmid DNA allows the targeted cells to produce the ribozyme and, thus, results in a higher delivered dose to the cell than can be expected by delivery of ribozyme RNA via liposome.
- the DNA also provides specificity of action based on target sequence specificity.
- the liposomes deliver their DNA to any cell in the area of administration, including cells of the host.
- the promoter driving the transcription of the ribozyme is specific for the targeted microorganism and, thus, will be inactive in other cell types. Therefore, liposomal delivery of DNA coding for the ribozyme provides amplification and specificity.
- the biologic delivery vehicle of the RiboZideTM takes advantage of the fact that generalized transducing particles completely lack DNA originating from the viral vector. Instead such particles only contain sequences of host origin. Consequently, the invention uses a biologic assembly of viral head proteins (packaging elements for the antimicrobial therapeutic) around the nucleic acid containing the necessary genetic elements that will insure the desired level of expression of the ribozyme (s) ( Figures 2, 3 and 4) .
- This delivery system consists of a DNA plasmid carrying the gene(s) coding for the ribozyme (s) packaged into viral particles. Specificity is conferred by the promoter driving transcription of the ribozymes and by the host specificity of the viral vehicle.
- the following description is one example of the system using bacteriophage lambda virions to package DNA carrying ribozymes directed against Escherichia coli . Similar strategies are used to generate RiboZidesTM capable of delivering ribozymes directed against other microorganisms.
- the virions used to package the DNA can be species specific, such as the virion derived from the bacteriophage lambda coat, or they can possess a broader host range, such as virion derived from bacteriophage PI.
- Broad host-range viruses facilitate production of the anti-microbial agents without the loss of species specificity because species-specific promoters are used to direct the transcription of the ribozymes which are directed against species specific targeted RNA sequences.
- the present RibZide entails the use of a plasmid carrying the ribozyme gene(s), a plasmid origin of replication, a selectable marker for plasmid maintenance, the minimal lambda origin of replication, and cos sites, which are required for packaging of DNA into lambda virions.
- This plasmid is maintained in a lambda lysogen that is defective in integration/excision and recombination functions.
- the defective lysogen provides all of the replication factors needed to activate the lambda origin of replication on the plasmid and all of the structural components needed to form mature virions; however, the lysogen is not able to replicate and package its own DNA into the virions.
- the lysogen also carries the cl 851 temperature-sensitive repressor mutation. Induction of the lysogen is described in the Examples. A similar strategy can be used to generate ribozyme-encoding plasmids packaged into bacteriophage PI virions.
- PI has a broad intergenera and interspecies range (29) .
- the PI receptor of E. coli is the terminal glucose of the lipopolysaccharide (LPS) core lysergic ring of the bacterial outer membrane (12) .
- LPS lipopolysaccharide
- Yarmolinsky and Sternberg report that in addition to E. coli , this particular phage has the ability to inject its nucleic acid into a large number (>25) of diverse gram negative bacteria (29) .
- PI can accommodate a significant amount of genetic information, over 2% (100,000 bp) of the DNA of E.
- the active PAC site is contained within a 161 base-pair segment of the PI EcoRl fragment 20 (23) .
- the phage head serves as a molecular syringe that delivers the inactivating ribozyme (s) to the pathogen.
- the genes coding for the ribozymes can be toxic to the cells that are needed to produce the ribozyme-carrying virions.
- the organism used to produce the RiboZideTM can be different from the target organism.
- the producing strain is resistant to the toxic effects of the ribozymes because the ribozymes are not efficiently expressed in the producing strain, due to species-specific promoter elements, and the ribozymes will not have any target RNA molecules to attack, due to the species-specific sequences that target the ribozymes.
- this toxicity becomes a significant concern.
- RiboZideTM consisting of anti-S. coli ribozyme genes packaged in lambda will illustrate the approach used to circumvent the toxicity.
- the ribozymes directed against RNA species of E. coli is expressed from a artificial promoter containing consensus promoter elements. This promoter provides high level transcription of the ribozyme immediately upon infection of targeted cells. In order to prevent the unwanted death of the producing strain of E. coli , transcription is repressed in the producing strain by a mechanism not available to the wildtype strains that are targeted for killing. Sequences constituting the DNA binding sites for a heterologous transcription factor are interspersed between the essential activating elements of the ribozyme promoter.
- the heterologous transcription factor in the producing strain results in the occlusion of the activating promoter elements and preventing the binding of RNA polymerase.
- the gene for the Saccharomyces cerevisiae transcription factor Stel2p may be expressed in E. coli and bind to its binding sites, the pheromone response element, located within the ribozyme promoter. Stel2p will not be found in wild strains of E. coli ; therefore, the ribozyme promoter will be accessible to RNA polymerase following delivery of the plasmid to the targeted cells.
- ribozyme-resistant versions of the targeted RNA molecules employs ribozyme-resistant versions of the targeted RNA molecules.
- This strategy can be used when the target RNA molecule codes for a protein.
- the ribozyme target site within the mRNA molecule is mutated by site-directed mutagenesis such that the amino acid sequence of the translated protein does not change but the mRNA sequence no longer serves as a substrate for the ribozyme.
- hammerhead ribozymes require an NUX sequence within the target mRNA for cleavage to occur. By changing this sequence to something else, the ribozyme will not cleave the mRNA.
- This type of ribozyme resistant version of the target RNA can be expressed from a plasmid or integrated into the chromosome of the producing strain and thus render this strain resistant to the toxic effects of the ribozyme.
- a non-replicative delivery system has an advantage in that once the phage coat has injected the nucleic acid into the targeted bacterium, the expression of the RiboZideTM ribozyme will destroy the microbe, as opposed to a lytic infection cycle typical of an intact bacteriophage. Consequently, amplification of the phage coat will not be an issue and it is less likely that the non-replicative phage delivery system will generate an immune response such that subsequent use of the delivery system would be jeopardized.
- the RiboZideTM is effective and neutralizes the invading microbe, then it is expected that the microbial antigens liberated as a result of the action of the RiboZideTM, will illicit sufficient humoral immunity and cell-mediated immunity to confer protection against subsequent attacks.
- Parenteral administration if used, is generally characterized by injection (intravenous, intradermal, subcutaneous and intramuscular) .
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant level of dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
- Suitable carriers for parenteral administration of the substance in a sterile solution or suspension can include sterile saline that can contain additives, such as ethyl oleate or isopropyl myristate, and can be injected, for example, intravenously, as well as into subcutaneous or intramuscular tissues.
- Topical administration can be by creams, gels, suppositories and the like. Ex vi vo (extracorporeal) delivery can be as typically used in other contexts. Oral administration is also contemplated.
- Suitable carriers for oral administration include one or more substances which can also act as flavoring agents, lubricants, suspending agents, or as protectants.
- Suitable solid carriers include calcium phosphate, calcium carbonate, magnesium stearate, sugars, starch, gelatin, cellulose, carboxypolymethylene, or cyclodextrans .
- Suitable liquid carriers can be water, pyrogen free saline, pharmaceutically accepted oils, or a mixture of any of these.
- the liquid can also contain other suitable pharmaceutical additions such as buffers, preservatives, flavoring agents, viscosity or osmo-regulators, stabilizers or suspending agents.
- suitable liquid carriers include water with or without various additives, including carboxypolymethylene as a pH-regulated gel.
- the RiboZideTM can be administered to the subject in amounts sufficient to produce an antibiotic effect or to inhibit or reduce the activity of the target pathogen.
- Optimal dosages used will vary according to the individual, on the basis of age, size, weight, condition, etc, as well as the particular modulating effect being induced.
- dosages are best optimized by the practicing physician and methods for determining dosage are described, for example, in
- Treatment can be at intervals and can be continued for an indefinite period of time, as indicated by monitoring of the signs, symptoms and clinical parameters associated with a particular infection.
- the parameters associated with infection are well known for many pathogens and can be routinely assessed during the course treatment.
- Promoters specific for the target can be selected by screening genomic sequences for the ability to activate a promoterless reporter gene.
- the promoterless reporter gene is based on the strategy developed for use with plasmid pMC1871 (Casadaban MJ et al Meth. Enzymol. 100, 293 (1983)) .
- plasmid capable of stable replication and maintenance in the microorganism understudy is modified by standard molecular biology techniques to carry the coding region of a reporter gene (Sambrook et al . latest eddition) .
- the reporter gene can be any of a number of standard reporter genes including but not limited to the lacZ gene of E. coli, which codes for ⁇ -galactosidase .
- Total genomic DNA is isolated from cells of the pathogen, cleaved with restriction endonucleases to yield fragments of a few hundred basepairs on average. These fragments are then ligated into a unique restriction endonuclease cleavage site at the 5' end of the reporter gene coding region, creating a library of plasmids.
- the library is then transformed into the pathogen by standard techniques and the resulting transformants are screened for expression of the reporter gene.
- the transformants can be plated onto medium containing the chromogenic °-galactosidase substrate X-Gal (5-bromo-4-chloro-3-indolyl-°-D-galactoside) .
- Transformants that contain a plasmid with an insert carrying a promoter will express ⁇ -galactosidase and will turn blue on X-Gal plates.
- the intensity of the blue color is relative to the level of expression; promoters of different strength can be selected based on the intensity of the blue color.
- the above-described screening procedure can be modified to identify regulated promoters.
- promoters that are regulated by carbon source availability can be screened on plates that contain different carbon sources.
- Other modifications are possible and will depend, in part, on the organism in question.
- the identified promoters are transferred to promoterless reporter plasmids capable of replication and maintenance in a different organism. Truly species-specific promoters will not activate the expression of the reporter gene in any other species.
- Obvious modifications can be used to identify and test artificial promoters composed of synthetic oligonucleotides inserted into the promoterless reporter plasmid.
- the present example entails the use of a plasmid carrying the ribozyme gene(s), a plasmid origin of replication, a selectable marker for plasmid maintenance, the minimal lambda origin of replication, and cos sites, which are required for packaging of DNA into lambda virions.
- This plasmid is maintained in a lambda lysogen that is defective in integration/excision and recombination functions.
- the defective lysogen provides all of the replication factors needed to activate the lambda origin of replication on the plasmid and all of the structural components needed to form mature virions; however, the lysogen is not able to replicate and package its own DNA into the virions.
- the lysogen also carries the cl 857 temperature-sensitive repressor mutation. Induction of the lysogen by temperature shift to 42 °C or by other means, such as exposure to 5J/m 2 of ultraviolet radiation will mobilize the plasmid and result in its replication and packaging into lambda virions (Fig. 3) . The virions can then be harvested, purified free of E. coli proteins and be used to deliver the ribozyme gene(s) to E. coli .
- RiboZide-i Abiologic delivery of the RiboZide-i is accomplished with ribozyme (s) constructs that have been engineered to be expressed within the targeted tissue. Briefly, the genetic element containing the promoter and ribozyme (s) are complexed with cationic liposomes
- the next series of trials determine whether the administration of RiboZides-i after infection is effective at preventing an acute bacterial infections.
- tissues obtained at necropsy are examined histologically and the presence of replicating microorganism in tissue samples is determined by standard methodology.
- Animals can be infected by various routes (systemic and/or mucosai) and the RiboZides-i delivered over time after infection by systemic and/or mucosai routes. Both abiologic as well as biological delivery of RiboZides-i is used.
- the demonstration of a positive effect of the RiboZides-i in controlled experimental model system provides compelling evidence for the efficacy of the preparation and determines whether or not the preparation warrants evaluation under conditions of standard clinical trials.
- the following is a routine approach for designing, manufacturing and testing of the ribozymes that are incorporated into the RiboZideJ invention.
- the catalytic component of RiboZideJ invention is/are transacting internal targeted ribozyme (s) (ITRz) .
- ITRz targeted triple ribozyme
- This artifically contrived genetic element consists of autocatalytic, self-cleaving 5' and 3' ribozymes ( Figure 5), with a cloning region (denoted by the box entitled Targeted Ribozyme) between them.
- This double ribozyme cassette is then placed within a series of expression vectors that were either constructed (pClip) , purchased from commercial vendors (pBluescriptll , Stratagene; pCRII, InVitrogen; pET-30a-c; pBACsurf-1, pIEl and pIE4, Novagen) and used intact or modified as necessary to confer the desired activity within the RiboZideJ.
- pClip (the genetic element described in Figure 5) is a modification of pBluescript, wherein the cassett shown is dropped into the Not I site in pBluescript.
- the targeted ribozyme (transacting catalytic ribozyme) is dropped into the Bgl II site (TGCTCT) .
- An internal targeted ribozyme is synthesized as reverse complementary overlapping oligodeoxynucleotides, which are designed in such a way that when annealed they form single stranded ends identical to those produced by digestion with the restriction endonuclease contained with the region between the two cis-acting ribozymes.
- the restriction endonuclease recognition site is that recognized by Bgl II.
- any RNA can be targeted: specificity is conferred by selecting sequences for the ribozyme that are reverse and complementary to sequences flanking the chosen cleavage site in the targeted RNA molecule.
- AE000119;U00096 dnaG (AE000388 U00096) , rpoA (AE000407 U00096) and tRNA-asp (X14007) , Streptomyces lividins secA (Z50195) , Enterococcus faecalis , ftsZ (U94707) , Pseudomonas putida , dnaG (U85774) , Streptomyces coeli col or rpoA (X92107) , Staphylococcus warneri tRNA-Asp (X66089 S42075) .
- SEQ ID NOS: 1-7 are examples of the transacting ribosyme sequences .
- the following sequences are for ribozymes directed against the targets described.
- the naming system refers to the target cytosine in the GUC motif. It is the nucleotides number from the referenced sequence (accession number indicated) .
- Ribozymes directed against secA targets have restriction sites for Bgl II on both ends. All other inserts have Bgl II (5 end) and Sty I (3 end) restriction sites for use in the new vector. Antisense arms are boldfaced. Escherichia coli ftsZ target (ACCESSION: AE000119 U00096)
- rpoA target (ACCESSION: AE000407 U00096) 8308 AGATCTAAAAGAGCGCTGATGAGTCCGTGAGGACGAAACAGTCAAAACCAAGG 8494 AGATCTAAATTTCGATCTGATGAGTCCGTGAGGACGAAACCAGCTAAACCAAGG 8737 AGATCTAAACGATTTCCTGATGAGTCCGTGAGGACGAAACATCACCAAACCAAGG (SEQ ID NO: 11)
- tRNA-Asp target (directed against GUC anticodon loop. Accession: X14007)
- Enterococcus faecalis ftsZ target (ACCESSION: U94707)
- IGF-1 GCGAGGAG CTGATGAGTCCGTGAGGACGAAA CATGGTGT (SEQ ID NO: 24)
- TGFfi-1 TAGCACA CTGATGAGTCCGTGAGGACGAAA CGTTTGA (SEQ ID NO: 29)
- mutants have also been created by substituting an A for a G, or a G for an A, at nucleotides (denoted within circles, Figure 6) which are absolutely required for catalytic activity. These "mutants” allow us to document that the efficiency of destruction of the targeted RNAs is due to ribozyme catalytic activity and not to antisense effects.
- the TRz constructs are isolated from the bacterium their nucleotide sequence is determined to confirm their identities and to document their orientation within the vector. The constructs are then transcribed in vi tro using SP6 and T7 RNA polymerases with 32 P-CTP. When transcribed in the "sense" orientation, all of these TRz constructs should be "self-liberating” ; that is, the 5 1 and 3' self-cleaving ribozymes should work effectively, freeing the ITRz during (or immediately after) transcription ( Figure lc) .
- the 5' liberated ribozyme (whose only function is self-cleavage, liberating the 5' end of the ITRz) is associated with relatively short stretches of vector sequences and the 3' self-cleaving ribozyme (whose only function is self-cleavage, liberating the 3 ' end of the ITRz) remains associated with long vector sequences.
- the liberated ITRz achieves its catalytic topology upon hybridization with the targeted sequence. Transcription of all of these TRz in the "antisense" direction should not result in self-cleavage .
- the self-liberating TRz should be evaluated for their ability to effectively cut their targeted RNAs .
- Appropriate regions of the targeted RNAs are generally cloned using cellular RNA and reverse transcription/polymerase chain reaction amplifications. In some cases, cloned full-length cellular RNAs can also used. The identities of the constructs used for transcription of target RNAs are also confirmed by sequencing. Target RNAs are then synthesized in vi tro using the appropriate T7/SP6 RNA polymerase with 32 P-CTP, and are subsequently gel -purified.
- a preparation of the TRz under evaluation is then synthesized without 32 P-CTP.
- the TRz preparation is then mixed with their an appropriate concentration of radiometrically 32 P-labeled target or substrate RNA ( 32 P-labeled target RNAs and unlabeled TRz preparations are mixed at a 10:1 molar ratio) and is incubated for various lengths of time. Following incubations, the RNA is examined using polyacrylamide gel electrophoresis (PAGE) and autoradiography . All of the constructs tested should be able to cleave their target RNAs. In general, the data show an approximate catalytic rate of 0.2 cleavages/ribozyme-min.
- TRz should then be evaluated with intact cells.
- TRz cassette is excised from the parental plasmid and is then placed into an appropriate expression vector.
- Vectors utilized include (but are not limited to) the LacSwitch vector (from Stratagene) , which is an
- IPTG- inducible system IPTG- inducible system
- TetSplice vector from Gibco-BRL
- TRz constructs in these expression vectors were then transfected into cells using standard techniques.
- Cell types used in transfections have included E. coli, human CaSki cervical carcinoma cells, SV-40 immortalized rat hepatocytes, and mouse fibroblasts .
- transient transfection analyses all constructs tested produced substantial reductions in their respective target RNAs.
- the secA targeted TRz construct against the secA gene of E. coli is in the vector pClip, which is a variation of the generalized cloning vector, pBluescript of Stratagene.
- the plasmid containing the construct was transformed into competent bacterial cells and cells containing the plasmid with the TRz were selected by using the antibiotic selectable marker within the vector, . pClip.
- IPTG isopropyl- ⁇ -D thiogalactoside,
- a reduction in total viable cells is an indication of synthesis and catalytic activity of the TRz against the essential target.
- the poll-targeted TRz construct (in LacSwitch vector) was used in transfections of SV40-immortalized rat hepatocytes (CWSV1 cells) , and stably transfected cell populations were obtained. Cells not transfected with the antibiotic resistance plasmid were all dead by day 5, indicating that the antibiotic selection procedure was effective. Growth of cells transfected with the double ribozyme (as a control, with no cellular RNA target) , and of cells expressing the catalytically inactive "mutant" poll TRz, was unaffected. However, growth of cells expressing the poll -targeted TRz was depressed by nearly 90%..
- the mRNA for poll was decreased by at least 70% from poll mRNA levels in the cells expressing the mutant poll TRz. Since expression of the TRz was essentially equivalent for the two TRz, this clearly documents that the effects on cell growth are due to TRz catalytic activity and not to antisense effects. In other experiments, expression of the poll -TRz in LacSwitch resulted in cell death with mouse fibroblast cell populations .
- the RB-targeted TRz (in the tetracycline-inducible TetSplice vector system) was used in trans ections with CWSV1 cells, and stably transfected cells were selected using G418 antibiotic in the presence of tetracycline, and individual clones were harvested and used (expression of RB-targeted TRz is "off" in the presence of tetracycline, and is "on” in the absence of tetracycline) . Expression of the RB-targeted TRz had no effect on cell growth, as expected. Expression of RB mRNA was substantially reduced to below detectable levels by Northern blot analysis.
- the B2-targeted TRz (in the IPTG-inducible LacSwitch vector) was used in transfections of CWSV1 cells, and antibiotic selection was used to obtain a number of individual clones. Reductions in cytoplasmic B2 RNA levels of up to 80% were observed by Northern blot analysis, and growth of transfected clones was reduced in parallel. In fact, a linear relationship between growth rate and B2 RNA levels was observed. The reductions in B2 transcripts paralleled the level of B2 -targeted TRz expression (as determined by slot-blot analysis) .
- the B2 target RNA is of additional interest, because B2 transcripts are not translated (i.e., they are not mRNAs) and they are abundant, highly- structured RNAs.
- TRz constructs have also been successfully tested using this methodology (including C9 in the tetracycline-inducible system, and CAT, BRACl and Albumin driven by the albumin promoter with HepG2 cells) .
- RNA-transcript-trimming plasmid which can be used both in vi tro and in place of run-off and (G)-free transcriptions and in vivo as multi-sequences transcription vectors.
- NAR. 19(9) 5125-5130.
- RNA-SPECIFIC RIBOZYMES AS ANTIMICROBIAL TISSUE SPECIFIC AND TARGET RNA-SPECIFIC RIBOZYMES AS ANTIMICROBIAL THERAPEUTICS AGAINST MICROBIAL PATHOGENS
- AAATTATCCA CTGATGAGTC CGTGAGGACG
- AAACGGGCGA AAAGATCTAG ATCTAAATCG 120
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU56886/98A AU743119B2 (en) | 1996-12-03 | 1997-12-02 | Tissue specific and target RNA-specific ribozymes as antimicrobial therapeutics against microbial pathogens |
CA002274584A CA2274584A1 (en) | 1996-12-03 | 1997-12-02 | Tissue specific and target rna-specific ribozymes as antimicrobial therapeutics against microbial pathogens |
JP52495898A JP2001505427A (en) | 1996-12-03 | 1997-12-02 | Tissue-specific and target RNA-specific ribozymes as antibacterial therapeutics against microbial pathogens |
EP97953066A EP0943005A1 (en) | 1996-12-03 | 1997-12-02 | Tissue specific and target rna-specific ribozymes as antimicrobial therapeutics against microbial pathogens |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/554,369 US5824519A (en) | 1995-11-08 | 1995-11-08 | Tissue-specific and target RNA-specific ribozymes |
US3226196P | 1996-12-03 | 1996-12-03 | |
US60/032,261 | 1996-12-03 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09319395 A-371-Of-International | 1999-10-05 | ||
US10/127,025 Continuation US20030125280A1 (en) | 1996-12-03 | 2002-04-19 | Tissue specific and target RNA-specific ribozymes as antimicrobial therapeutics against microbial pathogens |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998024925A1 true WO1998024925A1 (en) | 1998-06-11 |
Family
ID=26708189
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/021922 WO1998024925A1 (en) | 1995-11-08 | 1997-12-02 | Tissue specific and target rna-specific ribozymes as antimicrobial therapeutics against microbial pathogens |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO1998024925A1 (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999067400A1 (en) * | 1998-06-24 | 1999-12-29 | Musc Foundation For Research Development | Tissue-specific and target rna-specific ribozymes |
WO2000043781A2 (en) * | 1999-01-21 | 2000-07-27 | Metamorphix, Inc. | Growth differentiation factor inhibitors and uses therefor |
US6271359B1 (en) | 1999-04-14 | 2001-08-07 | Musc Foundation For Research Development | Tissue-specific and pathogen-specific toxic agents and ribozymes |
EP1169480A1 (en) * | 1999-04-14 | 2002-01-09 | MUSC Foundation For Research Development | Tissue-specific and pathogen-specific toxic agents and ribozymes |
AU2004201285B8 (en) * | 1998-06-24 | 2004-04-29 | Musc Foundation For Research Development | Tissue-specific and target RNA-specific ribozymes |
US6811975B2 (en) * | 1998-07-14 | 2004-11-02 | Isis Pharmaceuticals, Inc. | Phosphorothioate oligonucleotides having modified internucleoside linkages |
EP1702983A2 (en) | 2000-04-13 | 2006-09-20 | Medical University of South Carolina | Tissue-specific and pathogen-specific toxic agents, ribozymes, DNAzymes and antisense oligonucleotides and methods of use thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995007923A1 (en) * | 1993-09-15 | 1995-03-23 | Temple University Of The Commonwealth System Of Higher Education | Multi-unit ribozyme inhibition of oncogene expression |
US5500357A (en) * | 1990-11-02 | 1996-03-19 | Agency Of Industrial Science & Technology, Ministry Of International Trade & Industry | RNA transcription system using novel ribozyme |
WO1997017433A1 (en) * | 1995-11-08 | 1997-05-15 | Medical University Of South Carolina | Tissue-specific and target rna-specific ribozymes |
-
1997
- 1997-12-02 WO PCT/US1997/021922 patent/WO1998024925A1/en not_active Application Discontinuation
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5500357A (en) * | 1990-11-02 | 1996-03-19 | Agency Of Industrial Science & Technology, Ministry Of International Trade & Industry | RNA transcription system using novel ribozyme |
WO1995007923A1 (en) * | 1993-09-15 | 1995-03-23 | Temple University Of The Commonwealth System Of Higher Education | Multi-unit ribozyme inhibition of oncogene expression |
WO1997017433A1 (en) * | 1995-11-08 | 1997-05-15 | Medical University Of South Carolina | Tissue-specific and target rna-specific ribozymes |
Non-Patent Citations (5)
Title |
---|
C. ZHOU ET AL.: "Expression of Hammerhead ribozymes by retroviral vectors to inhibit HIV-1 replication: Comparison of RNA levels and viral inhibition.", ANTISENSE AND NUCLEIC ACID DRUG DEVELOPMENT, vol. 6, 1996, pages 17 - 24, XP002062053 * |
OHKAWA J ET AL: "ACTIVITIES OF HIV-RNA TARGETED RIBOZYMES TRANSCRIBED FROM A 'SHOT-GUN' TYPE RIBOZYME-TRIMMING PLASMID", NUCLEIC ACIDS SYMPOSIUM SERIES, vol. 27, 1 January 1992 (1992-01-01), pages 15/16, XP000568246 * |
R. E. CHRISTOFFERSEN ET AL.: "Ribozymes as Human Therapeutic Agents.", JOURNAL OF MEDICINAL CHEMISTRY, vol. 38, no. 12, 9 June 1995 (1995-06-09), pages 2023 - 2037, XP002062054 * |
S. M. SULLIVAN: "Development of Ribozymes for gene therapy", THE JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 103, no. 5, November 1994 (1994-11-01), pages 85S - 89S, XP002062055 * |
TAIRA K ET AL: "CONSTRUCTION OF SEVERAL KINDS OF RIBOZYMES THEIR REACTIVITIES AND UTILITIES", GENE REGULATION, BIOLOGY OF ANTISENSE RNA AND DNA, 1 January 1992 (1992-01-01), ERICKSON R P;IZANT J G, pages 35 - 54, XP002002021 * |
Cited By (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999067400A1 (en) * | 1998-06-24 | 1999-12-29 | Musc Foundation For Research Development | Tissue-specific and target rna-specific ribozymes |
AU2004201285B8 (en) * | 1998-06-24 | 2004-04-29 | Musc Foundation For Research Development | Tissue-specific and target RNA-specific ribozymes |
AU2004201285B2 (en) * | 1998-06-24 | 2007-07-05 | Musc Foundation For Research Development | Tissue-specific and target RNA-specific ribozymes |
US7732197B2 (en) * | 1998-06-24 | 2010-06-08 | The Penn State Research Foundation | Tissue-specific and target RNA-specific ribozymes |
US6811975B2 (en) * | 1998-07-14 | 2004-11-02 | Isis Pharmaceuticals, Inc. | Phosphorothioate oligonucleotides having modified internucleoside linkages |
WO2000043781A2 (en) * | 1999-01-21 | 2000-07-27 | Metamorphix, Inc. | Growth differentiation factor inhibitors and uses therefor |
WO2000043781A3 (en) * | 1999-01-21 | 2001-02-01 | Metamorphix Inc | Growth differentiation factor inhibitors and uses therefor |
US6271359B1 (en) | 1999-04-14 | 2001-08-07 | Musc Foundation For Research Development | Tissue-specific and pathogen-specific toxic agents and ribozymes |
EP1169480A1 (en) * | 1999-04-14 | 2002-01-09 | MUSC Foundation For Research Development | Tissue-specific and pathogen-specific toxic agents and ribozymes |
AU778737B2 (en) * | 1999-04-14 | 2004-12-16 | Musc Foundation For Research Development | Tissue-specific and pathogen-specific toxic agents and ribozymes |
EP1169480A4 (en) * | 1999-04-14 | 2005-02-02 | Musc Found For Res Dev | Tissue-specific and pathogen-specific toxic agents and ribozymes |
EP1702983A2 (en) | 2000-04-13 | 2006-09-20 | Medical University of South Carolina | Tissue-specific and pathogen-specific toxic agents, ribozymes, DNAzymes and antisense oligonucleotides and methods of use thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6271359B1 (en) | Tissue-specific and pathogen-specific toxic agents and ribozymes | |
US20060223774A1 (en) | Tissue-specific and pathogen-specific toxic agents, ribozymes, dnazymes and antisense oligonucleotides, and methods of use thereof | |
US6107078A (en) | Ribozymes with optimized hybridizing arms, stems, and loops, tRNA embedded ribozymes and compositions thereof | |
US5580967A (en) | Optimized catalytic DNA-cleaving ribozymes | |
US7575918B2 (en) | Tissue-specific and pathogen-specific ribozymes | |
EP0964930A1 (en) | Catalytic rna molecules | |
US7732197B2 (en) | Tissue-specific and target RNA-specific ribozymes | |
CA2086105A1 (en) | Method for treating leukemias | |
WO1998024925A1 (en) | Tissue specific and target rna-specific ribozymes as antimicrobial therapeutics against microbial pathogens | |
AU743119B2 (en) | Tissue specific and target RNA-specific ribozymes as antimicrobial therapeutics against microbial pathogens | |
US20030125280A1 (en) | Tissue specific and target RNA-specific ribozymes as antimicrobial therapeutics against microbial pathogens | |
AU2001253471B2 (en) | Tissue-specific and pathogen-specific toxic agents, ribozymes, dnazymes and antisense oligonucleotides, and methods of use thereof | |
AU2001253471A1 (en) | Tissue-specific and pathogen-specific toxic agents, ribozymes, dnazymes and antisense oligonucleotides, and methods of use thereof | |
AU2004201285B2 (en) | Tissue-specific and target RNA-specific ribozymes | |
EP1702983A2 (en) | Tissue-specific and pathogen-specific toxic agents, ribozymes, DNAzymes and antisense oligonucleotides and methods of use thereof | |
AU704325C (en) | Novel enzymatic RNA molecules | |
AU4107399A (en) | Novel enzymatic RNA molecules |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
CFP | Corrected version of a pamphlet front page |
Free format text: ADD INID NUMBER (63) "RELATED BY CONTINUATION (CON) OR CONTINUATION-IN-PART (CIP) TO EARLIER APPLICATION" WHICH WAS INADVERTENTLY OMITTED FROM THE FRONT PAGE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2274584 Country of ref document: CA Ref country code: JP Ref document number: 1998 524958 Kind code of ref document: A Format of ref document f/p: F Ref country code: CA Ref document number: 2274584 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 56886/98 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997953066 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1997953066 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09319395 Country of ref document: US |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWG | Wipo information: grant in national office |
Ref document number: 56886/98 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1997953066 Country of ref document: EP |