WO1997018323A2 - Cell-cycle checkpoint phosphatidylinositol- (pik-) related kinases, genes coding therefor and methods for assaying and modulating enzymatic activity - Google Patents

Abstract

The present invention generally relates to genes encoding cell cycle checkpoint phosphatidylinositol kinase (PIK)-related proteins essential to DNA damage responses in cells. These PIK-related kinases are required in regulatory pathways that arrest the cell cycle following DNA damage to allow DNA repair prior to mitosis or initiation of DNA replication. More particularly, the invention provides a novel human cell cycle checkpoint PIK-related kinase, MCCS1, and polynucleotide sequences encoding the MCSS1. Assays for identifying modulators of MCCS1 useful as, for example, chemotherapy and radiation adjuvants, are also provided by the invention. Further, assays for identifying modulators of the cell cycle checkpoint phosphatidylinositol kinase (PIK)-related protein identified as ATM are provided.

Description

CELL CYCLE CHECKPOINT PIK-RELATED KINASE MATERIALS AND METHODS

FIELD OF THE INVENTION

The present invention generally relates to genes encoding cell-cycle checkpoint phosphatidylinositol kinase (PΙK)-related genes and proteins essential to

DNA damage responses in cells. The checkpoint kinases play a role in the surveillance of DNA damage that occurs as a result of replication errors, DNA mismatches, radiation treatment, or chemotherapeutic drugs. These kinases are required in regulatory pathways that lead to cell cycle arrest following DNA damage, giving the cell notice and time to correct lesions prior to the initiation of DNA replication. More particularly, the invention relates to a novel human PIK-related kinase, Mammalian Cell Cycle Surveillance 1 (MCCS1), polynucleotides encoding the PIK-related kinase, and methods for assaying and modulating the enzymatic activity of the kinase and related kinases. BACKGROUND

The process of eukaryotic cell growth and division is the somatic or mitotic cell cycle which consists of four phases, the G₁ phase, the S phase, the G₂ phase, and the M phase. The G₁, S, and G₂ phases are collectively referred to as interphase of the cell cycle. The cell cycle is structurally and functionally conserved in its basic process and mode of regulation across all eukaryotic species. During the G₁ (gap) phase, biosynthetic activities of the cell progress at a high rate. The S (synthesis) phase begins when DNA synthesis starts and ends when the DNA content of the nucleus of the cell has been replicated and two identical sets of chromosomes are formed. The cell then enters the G₂ (gap) phase which continues until mitosis starts. In mitosis, the chromosomes pair and separate and two new nuclei form, and in cytokinesis the cell itself splits into two daughter cells each receiving one nucleus containing one of the two sets of chromosomes. Mitosis and cytokinesis together form the M (mitosis) phase ofthe cell cycle. Cytokinesis terminates the M phase and marks the beginning of interphase of the next cell cycle. The sequence in which the events in the cell cycle proceed is tightly regulated such that the initiation of one cell cycle event is dependent on the completion ofthe prior cell cycle event. This allows fidelity in the duplication and segregation of genetic material from one generation of cells to the next.

The term "cell cycle checkpoints" refers to the proteins, signals, processes, and feedback controls that integrate discontinuous events during cellular replication, in order to maintain essential dependencies within the cell cycle. The present invention specifically relates to the cell cycle checkpoint that ensures that mitosis is delayed until the completion of DNA synthesis and/or the accurate repair of DNA damage occurs.

Failure of cell cycle checkpoints predisposes individuals to or directly causes many disease states such as cancer, ataxia telangiectasia, embryo abnormalities, and various immunological defects associated with aberrant B and T cell development. The latter are associated with pathological states such as lupus, arthritis and autoimmune diseases. Intense research efforts have therefore focused on identifying cell cycle checkpoints and the proteins essential for the function of the checkpoints.

Genetic analysis in the yeasts Schizosaccharomyces pombe and Saccharomyces cerevisiae has identified a number of genes important for cell cycle arrest and DNA repair responses to ionizing radiation (IR). For a review, see Carr and Hoekstra, Trends in Cell Biology, 5: 32-40 (1995). One such gene, identified in both yeasts, is required for a DNA damage checkpoint which arrests the cell cycle at the G2 phase, as well as a related checkpoint which monitors the completion of DNA synthesis and arrests the cell cycle at the S phase. The gene is named rad3+ in 5. pombe [Seaton et al., Gene, 119: 83-89 (1992)], MEC1IESR1 in S. cerevisiae [Kato etal., Nuc. Acids. Res., 22(15): 3104-3112 (1994)], and is hereinafter referred to as rad3+. Cells having mutations in rad3+ fail to either sense or appropriately respond to DNA damage and subsequently lose viability more rapidly than wild type cells after exposure to clastogenic agents or events (e.g. , IR, DNA damaging agents, and mutations affecting chromosomal integrity). See Weinert et al., GENES & DEVELOPMENT, 8: 652-665 (1994) and Al-Khodairy et al. , EMBO J., 11(4): 1343-1350 (1992). This sensitivity to IR (radiosensitivity) can be caused by defects in checkpoint responses or defects in direct DNA repair reactions.

Theproduct ofthe rad3+ gene is an approximately 270 kD protein that falls into a growing family of high molecular weight PIK-related kinases. See Hunter, Cell, 83: 1-4 (1995) for a discussion of this family of kinases. The primary structures of the catalytic domains found in members of this gene family are closely related to well characterized phosphatidylinositol kinases. This structural relationship initially suggested that these PIK-related kinases might be capable ofphosphorylating lipids. When the substrate specificity of the PIK-related kinases is examined, however, these enzymes appear to function as protein kinases and have yet to be demonstrated to phosphorylate phosphatidylinositides. Hartley et al., Cell, 82: 849856 (1995) reports that purified preparations highly active in protein kinase assays failed to show lipid kinase activity. Additional PIK-related kinases identified include: the TEL1 gene product from S. cerevisiae which affects telomere length [Greenwell et al., Cell, 82: 823-829 (1995)], and Mei41+ gene product from Drosophila melanogaster which is important for a G2 checkpoint and meiotic development [Hari et al., Cell, 82: 815-821 (1995)], the DNA-PK gene product from mouse which is important in immunoglobulin rearrangements and processing of DNA double strand breaks, and the FRAP gene product which is important in the G1/S transition [Brown, E. et al., Nature, 377:441-446 (1995)]. Mutations in the DNA-PK gene can result in the Severe Combined Immunodeficiency Syndrome (SCID) defect (Hartley et al. , supra).

In humans, less is known about the molecular components required for checkpoint function. One component of the mammalian checkpoint machinery has been identified through the analysis of the human disease syndrome ataxiatelangiectasia (AT). Patients with AT show a diverse set of clinical symptoms, including predisposition to a variety oftumor types. Fibroblasts from AT patients are radiosensitive and fail to undergo cell cycle arrest following treatment with IR leading to a phenomenon termed radioresistant DNA synthesis. This is reminiscent of the S. pombe rad3 defect where cells fail to sense or respond appropriately to DNA damage. Interestingly, the locus responsible forAT, the Ataxia-Telangiectasia Mutated (ATM) gene, was recently described in Savitsky et al., Science, 268: 1749-1753 (1995) and the partial cDNA encodes a protein with amino acid similarity to the rad3+ gene. Savitsky et al., Human Molecular Genetics, 4(11);2025-2032 (1995) describes isolation of a cDNA encoding full length ATM. The increased radiosensitivity of rad3+ yeast mutants and of mammalian cells lacking functional ATM suggests that these proteins may comprise a family of checkpoint proteins.

Kuerbitz et al., Proc. Natl. Acad. Sci. USA, 89: 7492-7495 (1992) establishes that the tumor suppressor p53 is required for a G1 checkpoint and cell cycle arrest observed following DNA damage. Irradiation ofcells results in increased levels of p53 leading to the transcriptional activation of p53 responsive genes. One such p53-induced target is the product ofthe WAF1 gene (also called p21 , CIP1, and sdil). WAF1 is a member of an expanding class of cell cycle regulators termed cyclin-dependentkinaseinhibitoryproteins. Theactivities ofcyclin-dependentkinases control transit through the cell cycle. Transcriptional activation of WAF1 thus provides a direct link between DNA damage-dependent induction of p53 and the inhibition of kinases essential for cell cycle progression. See Elledge and Harper, Current Opinion in Cell Biology, 6: 847-852 (1994). Mutations in the p53 gene are one of the most common genetic alterations in human cancers. For example, Baker et al., Science, 244:217-221 (1989) reports that approximately 70% of human colorectal carcinomas contain deletions or mutant copies of the p53 gene. In addition, Fearon et al., Cell, 61: 759-767 (1990) reports that breast, lung, bladder and brain tumors have been associated with loss of chromosome 17p, the region to which the p53 gene localizes.

At present there is relatively little known about the molecular components ofthe G2 checkpoints in mammalian cells. Caffeine is a chemical entity which abrogates G2 checkpoint control. Russell et al., Cancer Res., 55: 1639-1642 (1995) and Powell et al., Cancer Res., 55: 1643-1648 (1995) report that analysis of cell lines which differ only by the presence or absence offunctional p53 demonstrated preferential caffeine-enhanced sensitization to IR in those cells lacking the p53-dependent G1 checkpoint. Thus, the conversion of potentially lethal damage into lethal damage is greater in cells lacking the G1 and G2 checkpoints in comparison to cells containing an intact G1 checkpoint.

While certain cells undergo DNA damage-dependent cell cycle arrest, other cells appear to respond to DNA damage by initiating an intrinsic suicide program termed apoptosis orprogrammed cell death. The factors determining which process occurs are not fully understood. Recent work has demonstrated an important role for p53 both in the regulation of G1 cell cycle transitions and apoptosis. Symonds et al., Cell, 78: 703-711 (1994) describe p53-dependent apoptosis as suppressing tumor growth and progression in vivo.

High doses of radiation and chemotherapy are used to treat tumor cells in order to damage DNA so severely that the cells will die. However, even though tumor cells having mutations in the p53 gene are defective in a G1 checkpoint, they can still repair DNA damaged induced by radiation or chemotherapy. The present invention contemplates, for example, that inhibition of the G2 checkpoint in tumor cells should lead to a state in which tumor cells are incapable of repairing DNA damage therefore sensitizing the tumor cells to DNA damaging agents. Normal cells, containing intact G1 and G2 checkpoints, should still be able to repair DNA damage in the presence ofa G2 checkpoint-specific inhibitor. Thus, treatment oftumors with a G2 checkpoint-specific inhibitor followed by radiation or chemotherapy should increase the efficacy of cell killing and thereby decrease the required doses of toxic

DNA-damaging agents.

There thus exists a need in the art for identification of the mammalian proteins that are involved in the cell cycle checkpoints in order to develop therapies for the human disease states associated with defective cell cycle checkpoints and for the isolation of the genes encoding those proteins which in themselves may be useful as therapeutics or which would enable the development of therapeutically useful modulators of the proteins encoded by the genes.

SUMMARY OF THE INVENTION

The present invention provides novel human PIK-related kinases essential for a cell cycle checkpoint that responds in the G2 phase of the cell cycle to both damaged and unreplicated DNA. In one of its aspects, the present invention provides purified and isolated polynucleotides (e.g., DNAs and RNAs, both coding and non-coding strands thereof) encoding the cell cycle checkpoint PIK-related kinase MCCS1 and polynucleotides encoding other cell cycle checkpoint PIK-related kinases that exhibit about 50, about 60, or about 65% nucleotide identity to the MCCS1 polynucleotide region encoding the MCCS1 kinase domain (MCCS1α nucleotides 6579 to 7562 of SEQ ID NO: 30 or MCCS1β nucleotides 6457 to 7440 of SEQ ID NO: 32). Alternatively, the MCCS1-like PIK-related kinases exhibit about 40%, about 45%, or about 50% amino acid identity to the MCCS1 kinase domain (MCCS1α amino acids 2083 to 2410 ofSEQ ID NO: 31 or MCCS1βamino acids 2152 to 2480 ofSEQ

ID NO: 33). Polynucleotides contemplated by the invention include genomic DNAs, RNAs, cDNAs and wholly or partially chemically synthesized DNAs. Preferred polynucleotides of the invention comprise the MCCS1α DNA sequence set out in SEQ ID NO: 30, the partial MCCS1βDNA sequence set out in SEQ ID NO: 3, the full length MCCS1βDNA sequence set out in SEQ ID NO: 32, and DNA sequences which hybridize to the noncoding strands thereof under stringent conditions or which would hybridize but for the redundancy of the genetic code. Exemplary stringent hybridization conditions are as follows: hybridization at 65°C in 3X SSC, 20mM NaPO₄ pH 6.8 and washing at 65°C in 0.2X SSC. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide base content of the sequences to be hybridized. Formulas standard in the art are appropriate for determining exact hybridization conditions. See Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). The MCCS1α DNA of SEQ ID NO: 30 was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn

Drive, Rockville, Maryland 20852, on November 3, 1995 as an insert in plasmid pBSHFB/HT2-27 in E. coli DH5α and was assigned ATCC Accession No.69951. The MCCS1βDNA of SEQ ID NO: 32, was deposited with the ATCC on November 7, 1995 as an insert in plasmid 517 in E. coli DH5α and was assigned ATCC Accession No.69950.

The DNA sequence information provided by the present invention makes possible the identification and isolation of DNAs encoding related molecules by well-known techniques such as DNA/DNA hybridization as described above and polymerase chain reaction (PCR) cloning. As one series of examples, knowledge of the sequence of a cDNA encoding MCCS1 makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences encoding the kinase and expression control regulatory sequences such as promoters, operators and the like.

Similarly, knowledge of a partial cDNA sequence encoding MCCS1βmake isolation ofa complete cDNA possible. DNA/DNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of the PIK-related kinase; non-human species enzymes homologous to the PIK-related kinase; and other structurally related proteins sharing one or more ofthe enzymatic activities, or abilities to interact with members or regulators, of the cell cycle checkpoint pathway in which MCCS1 participates. Polynucleotides ofthe invention when detectably labelled are also useful in hybridization assays to detect the capacity of cells to synthesize MCCS1. The DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout" strategies [see, Capecchi, Science, 244: 1288-1292 (1989)], of rodents that fail to express functional MCCS1 or that express a variant of MCCS1. Such rodents are useful as models for studying the activities of MCCS1 and MCCS1 modulators in vivo. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in the MCCS1 locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of MCCS1 by those cells which ordinarily express the same.

The invention also provides autonomously repbcating recombinant constructions such as plasmid and viral DNA vectors incorporating polynucleotides of the invention, especially vectors in which the polynucleotides are functionally linked to an endogenous or heterologous expression control DNA sequence and a transcription terminator.

According to another aspect of the invention, host cells, especially unicellular host cells such as procaryotic and eukaryotic cells, are stably transformed or transfected with DNAs of the invention in a manner allowing expression of the PIK-related kinase therein. Host cells of the invention are conspicuously useful in methods for the large scale production of MCCS1 wherein the cells are grown in a suitable culture medium and the desired enzymes are isolated from the cells or from the medium in which the cells are grown.

MCCS1 products having part or all ofthe amino acid sequence set out in SEQ ID NO: 31, SEQ ID NO: 4, or SEQ ID NO: 33 are contemplated. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., myristoylation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. The enzyme products of the invention may be full length polypeptides, fragments or variants. Variants comprise

MCCS1 products wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss of the kinase activity specific to MCCS1; or (2) with disablement ofthe kinase activity specific to MCCS1; or (3) with disablement of the ability to interact with members or regulators of the cell cycle checkpoint pathway.

Substrates of MCCS1 and proteins which interact with MCCS1 may be identified by various assays.

Substrates of MCCS1 may be identified by incorporating test compounds in assays for kinase activity. MCCS1 kinase is resuspended in kinase buffer and incubated either in the presence or absence of the test compound (e.g., casein, histone H1, or appropriate substrate peptide). Moles ofphosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate to the test compound is indicative that the test compound is a substrate of the kinase.

Interacting proteins may be identified by the following assays.

A first assay contemplated by the invention is a two-hybrid screen. The two-hybrid system was developed in yeast [Chien et al., Proc. Natl. Acad. Sci. USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene. Specifically, a polynucleotide encoding a protein that interacts with MCCS1 is isolated by: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS1 and either the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all ofputative MCCS1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; detecting binding ofan MCCS1 interacting protein to MCCS1 in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.

Other assays for identifying proteins that interact with MCCS1 may involve immobilizing MCCS1 or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCS1.

Another type of assay for identifying MCCS1 interacting proteins involves immobilizing MCCS1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable ofexciting the fluorescent agent, contacting the immobilized MCCS1 with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the fluorescent agent. Alternatively, the putative interacting protein may be immobilized and MCCS1 may be labelled in the assay.

Also comprehended by the present invention are antibody products (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins (such as those identified in the assays above) which are specific for the MCCS1 kinases of the invention. Binding proteins can be developed using isolated natural or recombinant enzymes. The binding proteins are useful, in turn, for purifying recombinant and naturally occurring enzymes and identifying cells producing such enzymes. Specifically illistrating monoclonal antibodies of the invention are the monoclonal antibodies produced by hybridoma cell lines 224C and 224F which were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 on November 7, 1996 and assigned ATCC Accession Nos. HB

12233 and HB 12234, respectively. Assays for the detection and quantification of proteins in cells and in fluids may involve a single antibody substance or multiple antibody substances in a "sandwich" assay format. The binding proteins are also manifestly useful in modulating (i.e.,blocking, inhibiting, or stimulating) enzyme/substrate or enzyme/regulator interactions. Anti-idiotypic antibodies specific for PIK-related kinase binding proteins are also contemplated.

The invention contemplates that mutations in the MCCS1 gene that result in loss of normal function of the MCCS1 gene product underlie human disease states in which failure of the G₂ cell cycle checkpoint is involved. Gene therapy to restore MCCS1 activity would thus be indicated in treating those disease states (for example, testicular cancer). Delivery of a functional MCCS1 gene to appropriate cells is effected in vivo or ex vivo by use of viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus) or ex vivo by use ofphysical DNA transfer methods (e.g. , liposomes or chemical treatments). For reviews ofgene therapy technology see Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific American: 68-84

(1990); and Miller, Nature, 357: 455-460 (1992). Alternatively, it is contemplated that in other human disease states preventing the expression of or inhibiting the activity of MCCS1 will be useful in treating the disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of MCCS1. Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides) capable of specifically binding to MCCS1 expression control sequences or MCCS1 RNA are introduced into cells (e.g., by a viral vector or colloidal dispersion system such as a liposome). The antisense nucleic acid binds to the MCCS1 target sequence in the cell and prevents transcription or translation of the target sequence. Phosphothioate and methylphosphate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' end.

Moreover, for example, if a particular form of cancer results from a mutation in a gene other than MCCS1 such as the p53 gene, an agent which inhibits the transcription or the enzymatic activity of MCCS1 and thus the G₂ cell cycle checkpoint may be used to render cancerous cells more sensitive to chemotherapy or radiation therapy. The therapeutic value of such an agent lies in the fact that current radiation therapy or chemotherapy in most cases does nothing to overcome the ability of the p53 mutant cancerous cell to sense and correct the DNA damage imposed as a result of the treatment. As a result, a cancer cell can simply repair the DNA damage. Modulating agents of the invention may therefore be chemotherapy and radiation adjuvants or may be directly active as chemotherapeutic drugs themselves.

Agents that modulate MCCS1 kinase activity may be identified by incubating a test compound with MCCS1 immunopurified from cells naturally expressing the PIK-related kinase, with MCCS1 obtained from recombinant procaryotic or eukaryotic host cells expressing the enzyme, or with purified MCCS1, and then determining the effect of the test compound on MCCS1 activity. The activity of the PIK-related kinase can be measured by determining the moles of ³²P-phosphate transferred by the kinase from gamma-³²P-ATP to either itself (autophosphorylation) or to an exogenous substrate such as a lipid or protein. The amount of phosphate incorporated into the substrate is measured by scintillation counting or autoradiography. An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS1 kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS1 kinase. In another aspect, agents that modulate both MCCS1 and ATM or modulate one of the enzymes are also contemplated. Agents which modulate MCCS1 are screened in a kinase assay as described above in which ATM is the phosphorylating enzyme. In a presently preferred assay, a MCCS1-specific antibody linked to agarose beads is incubated with a cell lysate prepared from host cells expressing the kinase. The beads are washed to remove proteins binding nonspecifically to the beads and the beads are then resuspended in kinase buffer. The reaction is initiated by the addition of gamma-³²P-ATP and an appropriate exogenous substrate such as lipid or peptide. The activity of the kinase is measured by determining the moles of ³²P-phosphate transferred either to the kinase itselfor the added substrate. In a preferred embodiment the host cells lack endogenous MCCS1 and/or ATM kinase activity. The selectivity of a compound that modulates the kinase activity of MCCS1 can be evaluated by comparing its activity on MCCS1 to its activity on other known PIK- related kinases. The combination of the recombinant MCCS1 products of the invention with other recombinant PIK-related kinase products in a series of independent assays provides a system for developing selective modulators ofMCCS1.

Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.

For example, an assay for identifying modulators of MCCS1 kinase activity involves incubating an MCCS1 kinase preparation in kinase buffer with gamma-³²P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. An increase in the moles of phosphate transferred to the substrate in presence ofthe test compound compared to the moles ofphosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS1 kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles ofphosphate transferred to the substrate in the absence ofthe test compound indicates that the modulator is an inhibitor of said MCCS1 kinase.

Moreover, assays for identifying compounds that modulate interaction ofMCCS1 with other proteins may involve: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS1 and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA sequence encoding part or all of a protein that interacts with MCCS1 and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS1 and the interacting protein by detecting binding of the interacting protein to MCCS1 in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence ofthe modulating compound. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.

Another type of assay for identifying compounds that modulate the interaction between MCCS1 and an interacting protein involves immobilizingMCCS1 or a natural MCCS1 interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCS1 interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCS1 interaction with the protein.

Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCS1 and an interacting protein involves immobilizing MCCS1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized

MCCS1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the flourescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound. Alternatively, the MCCS1 interacting protein may be immobilized and MCCS1 may be labelled in the assay.

The present invention further provides a cell-based complementation assay for identifying compounds which modulate the activity of MCCS1 or ATM. The assay involves complementation of a phenotypic trait associated with a genetic alteration in the cell. For example, the genetic alteration identified as esr1-1 results in cellular sensitivity to DNA damage in yeast cells [Kato et al., Nuc. Acids. Res., 22(15): 3104-3112 (1994)]. esr1-1 cells fail to either sense or appropriately response to DNA damage after exposure to DNA damaging agents such as ionizing radiation or clastogenic agents. The phenotypic trait of the genetically altered cell is complemented by transforming and expressing MCCS1 or ATM in the cell. The transformed cells are exposed to DNA damaging treatment (e.g. ionizing radiation) in the presence and absence of a test compound and sensitivity of the cells to DNA damage is measured. Agents that affect the cell sensitivity to DNA damaging activity of MCCSl and/or ATM are identified as modulators.

Modulators of MCCS1 may affect its kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway. MCCS1 modulators may be formulated in compositions comprising pharmaceutically acceptable carriers. Such compositions may additionally include chemotherapeutic agents. Dosage amounts indicated would be sufficient to result in modulation of MCCS1 activity in vivo. Selective modulators may include, for example, polypeptides or peptides which specifically bind to MCCS1 or MCCS1 nucleic acid, oligonucleotides which specifically bind to the PIK-related kinase or PIK-related kinase nucleic acid, and/or other non-peptide compounds (e.g. , isolated or synthetic organic molecules) which specifically react with MCCS1 or MCCS1 nucleic acid. Mutant forms of MCCS1 which affect the enzymatic activity or cellular localization of wild-type MCCS1 are also contemplated by the invention. Presently preferred regions of the PIK-related kinases which are targets for the development of selective modulators include, for example, the following four regions: the MCCS1α amino terminal effector domain (amino acids 1 to 1081 of SEQ ID NO: 31), the MCCS1β amino terminal effector domain (amino acids 1 to 1150 of SEQ ID NO: 33), the MCCS1α rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS1β rad3+ domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCS1α PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS1βPIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).

DETAILED DESCRIPTION

The present invention is illustrated by the following examples. Example 1 details the isolation of cDNAs encoding MCCS1 kinases. Example 2 describes mapping of the human MCCS1 gene to human chromosome 3. The recombinant expression ofMCCS1 in E. coli and insect cells is respectively described in Examples 3 and 4. Example 4 also presents assays for measuring MCCS1 kinase activity. Example 5 describes the production of MCCS1-specific polyclonal and monoclonal antibodies. Example 6 reports the immunoprecipitation ofMCCS1 kinase associated activity from mouse testes. Example 7 examines the expression ofMCCS1 mRNA in various human tissues and cancer cell lines. Example 8 describes analyses of MCCS1 mRNA and protein expression in mouse testes. Example 9 describes analyses of MCCS1 protein expression in meiotic cells. Assays for substrates and interacting proteins of MCCS1 are described in Example 10. Example 11 describes modulators and assays for modulators of the kinase activity of MCCS1. Example 12 describes the cell-based complementation assay for identifying modulators ofMCCS1 and/or ATM and Example 13 describes the kinase activity of ATM.

Example 1

cDNAs encoding the PIK-related kinase MCCS1 were isolated by a series of PCR reactions.

An alignment of the amino acid sequences of S. pombe rad3+ (Hari et al. , supra) and S. cerevisiae MEC1 (Kato et al. , supra) was the basis for design of seven degenerate oligonucleotides that encoded (or were complementary to) the regions of highest homology/lowest degeneracy between the sequences and contained convenient restriction sites to facilitate cloning of amplification products. The oligonucleotides were then used in a PCR-based assay to isolate a related human sequence.

Initially, PCR amplifications were performed on cDNA preparations from rat T-cells, human peripheral blood mononuclear cells (PBMC), and S. cerevisiae genomic DNA. Five oligonucleotide pairs were used (oDH15a/oDH16, oDH15b/oDH16, oDH17a/oDH16, oDH15a/oDH17b, and oDH15b/oDH17b) forthe primary amplifications. The sequences of the oligonucleotide primers included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions. oDH15a (SEQ ID NO: 5)

5' GCA GAC GGA TCC GGI WCI GAY GGI AAY HTI TAY 3' oDH15b (SEQ ID NO: 6)

5' GCA GAC GGA TCC GGI WCI GAY GGI AAY 3' oDH16 (SEQ ID NO: 7)

5' GCA GAC GAA TTC RCA RTY RAA RTC IAC RTG 3' oDH17a (SEQ ID NO: 8)

5' GCA GAC GGA TCC AAR TTY

CCI CCI RTI YTI TAY SAR TGG TT 3'

oDH17b (SEQ ID NO: 9)

5' GCA GAC GAA TCC AAC CAY

TSR TAI ARI AYI GGI GGR AAY TT 3' PCR was performed on reaction mixtures of IX PCR buffer (Perkin Elmer Cetus,

Emeryville, California), 2-3μM oDH primers, 1.5mM MgCl₂, 200μM dNTPs, and 0.5 μl Amplitaq polymerase. The reaction was performed in a Perkin-Elmer Cetus Thermocycler Model 480 under the following conditions: denaturation at 94°C for 1 minute, annealing at 64°C for 2 minutes, and elongation at 72°C for 1 minute for 3 cycles. The procedure was then repeated using 60°C annealing temperature for 3 cycles, 56°C annealing for 3 cycles, and finished with denaturation at 94°C for 1 minute, annealing at 54°C (2 minutes, and elongation at 72°C for 1 minute for 30 cycles. PCR products were separated on 2 or 4% Tris Acetate EDTA (TAE) agarose gels, stained with ethidium bromide, and DNA products were visualized by UV fluorescence. From the primary amplifications of yeast genomic DNA, rat T-cell cDNA, and human PBMC cDNA, only a single reaction with yeast genomic DNA (oDH17a/oDH16) gave a visible amplification product, resulting in a product that was the expected size for the region of the S. cerevisiae MECl gene between these primers. Further analysis of the oDH17a/oDH16 amplifications that utilized rat T-cell and PBMC cDNA was therefore performed. To remove oligonucleotides and "primer dimers" that might interfere with subsequent PCR, primary reactions were purified prior to reamplification.

A "nested" PCR strategy was employed, and amplifications were repeated with primer pairs oDH18a/oDH16 and oDH18b/oDH16 under reaction conditions described above with cycle times of denaturation of 94°C for 1 minute, annealing at 55C for 1 minute, and elongation at 72°C for 30 seconds for 30 cycles. The sequences ofthe oDH18a and oDH18b oligonucleotide primers included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions. oDH18a (SEQ ID NO: 10)

5' GCA GAC GGA TCC YΗ GGI YTI GGI GAY CGI CA 3' oDH18b(SEQIDNO: 11)

5' GCA GAC GGA TCC YΗ GGI YTI GGI GAY AGR CA 3'

An approximately 90 base pair (bp) product (the expected size amplification product for these primers) was seen in the reamplifications of the yeast genomic and human

PBMC cDNA primary reactions. No 90 bp product was seen in the reamplification of the primary reaction on rat T-cell cDNA and this reaction was not analyzed further.

In addition to the approximately 90 bp product, several other non-specific bands were also present, though significantly fewer than were observed when the primary reactions were reamplified with oDH17a/oDH16. While the approximately 90 bp product was present in both the oDH18a/oDH16 and oDH18b/oDH16 reamplifications ofthe yeast genomic DNA primary reactions, only the oDH18a/oDH16 reaction yielded the appropriate size fragment during reamplification of the human PMBC cDNA primary reaction. This was presumed to reflect codon usage in the human gene (compare primers oDH18a and oDH18b). The approximately 90 bp product from the oDH18a/oDH16 reamplification of the human PMBC cDNA primary reaction was gel purified and subcloned into the pBluescript SKπ+ cloning vector (Stratagene, La Jolla, California) and sequenced.

Analysis of the sequence encoded by the 90 bp product indicated that the deduced amino acid sequence was similar to both S. cerevisiae MEC1 and S. pombe rad3+, but was not identical to either. To identify a larger region of coding sequence and extend the sequence comparison, a non-degenerate oligonucleotide, oDH235' GACGCAGAATTCACCAGTCAAAGAATCAAAGAG 3' (SEQ ID NO:

12), was synthesized for use in additional amplification reactions. Reamplification of the purified PBMC cDNA primary reaction with oDH17a/oDH23 led to the production of an amplification product of 174 bp. This fragment was then purified, subcloned and sequenced as described above. Computer analysis of the conceptual translation product confirmed its relationship (similar but not identical) to MEC1 and rad3+. This PCR fragment was then used as a probe to screen a plasmid library containing macrophage cDNA using the following hybridization conditions: incubation of nitrocellulose filters with radiolabelled probes in 3X SSC, 5X Denhardt's, 0.1 % sarcosyl, 20mM NaPO₄ pH 6.8, 100 ug/ml single stranded salmon speπn DNA, for 18 to 24 hours at 65°C. Washes were done 3 times in 0.2X SSC,

0.1% SDS at 65°C for 30 minutes (with changes of wash buffer). Four positive clones were isolated, and the nucleotide sequence ofeach was determined. Computer analysis of the four sequences demonstrated that they were overlapping clones derived from a locus with homology to the rad3+ gene from S. pombe. Clone 517 (ATCC 69950) contained a 2.8 kbp insert and its DNA and deduced amino acid sequence are set out in SEQ ID NOs: 3 and 4, respectively. The clone contained an open reading frame encoding an amino terminal truncated protein product of 870 amino acids which were 39% identical to the COOH-terminus of rad3+. The protein product of the cDNA insert was named MCCS1β.

The sequence of clone 517 was used to design the oligonucleotides, mo3 5'-CTACAGAGCCAAGGAG-3' (SEQ ID NO: 13) and mo6 5'-TCGAGCTATGCTACTAGTGGGC-3' (SEQ ID NO: 14), which were used to generate a probe using a gel purified EcoRI fragment derived from clone 517 as a template. The PCR conditions were as follows: 50 ng DNA fragment, IX PCR buffer (Perkin-Elmer Cetus), 1.5mM MgCl₂, 200μM dATP, dGTP, and TTP, 1μM dCTP, 50μCi α³²P-dCTP, 10ng/ml each oligonucleotide, 1UAmpliTaq (Perkin-Elmer Cetus). The reaction was performed in a Perkin-Elmer Cetus Thermocycler Model

480 for an initial denaturing cycle at 94°C for 4 minutes followed by 20 cycles of 94°C for 15 seconds, 60°C for 15 seconds, 72°C for 30 seconds. Unincorporated nucleotides were removed using a Stratagene Nuc-trap Push Column.

Since Northern blot analyses showed that the expression ofthe mRNA corresponding to clone 517 was highest in testis, one million clones from a human testis cDNA library (Stratagene #939202) were screened with the PCR-generated probe and eleven clones were obtained. The two longest clones, HT2 and HT9, were chosen for analysis. HT2 contained a 4.7 Kb insert (corresponding to nucleotide 2974 of SEQ ID NO: 30 and extending further downstream than SEQ ID NO: 1) and HT9 contained a 5485 bp insert (corresponding to nucleotides 2152 to 7624 of SEQ

ID NO: 30). Nucleotide sequence analysis revealed that in the region common to both cDNA clones there was a single base pair insertion of a T at nucleotide 3233 in HT9. This nucleotide insertion causes the predicted amino acid reading frame to shift and then terminate and is believed to be an error introduced by reverse transcriptase in clone HT9.

In order to isolate a clone containing an additional 2.5 Kb, one million clones from each of three additional cDNA libraries were screened: a human fetal brain cDNA library (Stratagene #93206), a human heart cDNA library (Stratagene # 936207), and a human aorta cDNA library (Clontech Laboratories #HL1136a, Palo Alto, California). The sequence of the most 5' region ofHT9 was utilized to design and synthesize two oligonucleotides, oHT9-l 5'-CCTAGTCCAGTAAAACTTGC-3' (SEQ ID NO: 15) and oHT9-45'-TTTGCGGCCCTTCCAATATC-3' (SEQ ID NO: 16) which were used to generate a 317 bp PCR probe under conditions described for generating the probe above. While no positive clones were isolated from the heart or aorta cDNA libraries, two positive clones were obtained from the fetal brain library. One of these clones, HFB2, included a cDNA 4.5 Kb insert which included approximately 2300 bp of additional sequence. The HFB2 insert corresponds to nucleotides 1 to 3194 of SEQ ID NO: 30.

A composite cDNA encoding MCCS1α was constructed from clones HFB2, HT9 and HT2. The three clones werejoined together by digesting HFB2 with the restriction enzymes Kpnl and Sail to generate a fragment to comprise the 5' end of the composite clone, digesting HT9 with Kpnl and NotI to generate a fragment to comprise the 3' end of the composite clone, and then ligating isolated fragments to the vector pBS SK- (Stratagene) that had been digested with Sail and NotI. The region of the HT9 fragment containing the one nucleotide insertion was replaced with an EcoRV fragment containing nucleotides 3174 to 5282 of clone HT2. The final plasmid containing a 7621 bp insert was named pBSHFB2HT2-27 (ATCC 69951). The DNA and deduced amino acid sequence of the insert are presented in SEQ ID NOs: 1 and 2, respectively. The coding domain of the cDNA initiates with an ATG at nucleotide 333 and ends with a termination codon at nucleotide 7560 predicting a coding sequence of 2409 amino acids and protein of 265 kD. The protein product of the cDNA insert was named MCCS1α. Subsequent sequence analysis of the insert in plasmid pBSHFB2HT2-27 (ATCC 69951) revealed sequencing errors in SEQ ID NO: 1. Corrected DNA and deduced amino acid sequences of the insert are set out in SEQ ID NOs: 23 and 24, respectively. Even further sequence anaysis of insert in plasmid pBSHFB2HT2-27 revealed sequencing error in SEQ ID NO: 23. At nucleotide position 6317 (SEQ ID NO: 23) a "G" was erroneously included and between positions 6338 and 6339 the sequence was missing an "A". The corrected sequences of MCCS1α are provided in SEQ ID NOs: 30 and 31.

Comparison ofthe predicted amino acid sequence ofMCCS1α with the partial amino acid sequence of MCCS1β predicted from clone 517 revealed the presence of a seventy amino acid deletion in the MCCS1α product. The MCCS1β clone 517 amino acid sequence corresponds to MCCS1α amino acids 1611 to 2410 of SEQ ID NO: 31. The seventy amino acid deletion in MCCS1α (i.e. , where the seventy amino acids would be inserted to generate a product identical to MCCS1β) occurs between amino acids 2065 and 2066 in SEQ ID NO: 31, seventeen amino acids upstream from the kinase domain. Since both clones maintain an open reading frame, cDNA clone pBSHFB2HT2-27 was apparently generated from alternatively spliced mRNA. The carboxyl terminal domains containing the kinase domains are identical in MCCS1α (amino acids 2083 to 2410 of SEQ ID NO: 31) and MCCS1β clone (amino acids 543 to 870 of SEQ ID NO: 4).

A composite clone containing the complete coding sequence of MCCS1β (with the seventy amino acid insert) is presented in SEQ ID NO: 32. The amino acid sequence deduced from the clone is presented in SEQ ID NO: 33. This clone is constructed by replacing the sequence between the BSTXI site, which cleaves after nucleotide 3229, and the NotI site in the polylinker sequence at the 3' end of pBSHFB2HT2-27 (SEQ ID NO: 1) with the sequence contained in HT2 between the BstXI site and the NotI site at the 3' end ofHT2. Thus this clone contains sequences that are identical to MCCS1α nucleotides 1 to 5159 of SEQ ID NO: 1 (encoding amino acids 1 to 1609 of SEQ ID NO: 2) linked to sequences that are identical to clone 517 nucleotides 1 to 2610 of SEQ ID NO: 3 (encoding amino acids 1 to 870 of SEQ ID NO: 4). As noted above, subsequent sequence analysis revealed errors in nucleotides 1 to 5159 of SEQ ID NO: 1. Corrected MCCS1β DNA and deduced amino acid sequences that include the same corrections that appear in MCCS1α SEQ ID NOs: 23 and 24 are set out in SEQ ID NOs: 25 and 26. The SEQ ID NO: 25 clone represents a cDNA encoding a full length MCCS1βkinase. Further sequences for MCCS1βincluding corrections of errors identified in resequencing the MCCS1α clone are presented in SEQ ID NOs: 32 and 33.

The MCCS1 products can be divided into three regions based on similarity to other PIK-related kinases: an amino terminal domain (MCCS1α amino acids 1 to 1081 of SEQ ID NO: 31 and MCCS1βamino acids 1 to 1150 of SEQ ID NO: 33), a region with similarity to rad3+ (MCCS1α amino acids 1082 to 2082 of SEQ ID NO: 31 and MCSS1β amino acids 1151 to 2151 of SEQ ID NO: 33) and a

PIK domain (MCCS1α amino acids 2083 to 2410 of SEQ ID NO: 31 and MCCS1β amino acids 2152 to 2480 ofSEQ ID NO: 33) including a kinase domain. The amino terminal region and rad3+ region are regulatory domains that modulate the kinase activity of the enzyme and are involved in interactions with associated proteins.

Results of comparisons of the nucleotide and amino acid sequence of

MCCS1α and MCCS1β to the sequences of other PIK-related and non-PIK-related kinases are shown in Table 1. Specifically, the 3' end ofMCCS1α (nucleotides 6579 to 7562 of SEQ ID NO: 30 encoding the kinase domain), the 3' end of MCCS1β (nucleotides 1627 to 2379 of SEQ ID NO: 32 encoding the kinase domain), the rad3+ domain of MCCSlα (nucleotides 3576 to 6578 of SEQ ID NO: 30), and the rad3+ domain of MCCS1β (clone 517 nucleotides 1 to 1626 of SEQ ID NO: 3) were compared to the analogous region in human ATM [Savitsky et al., supra], human DNA-PK [Huntley et al., Cell, 82: 849-856 (1995)], human FRAP [Brown et al., supra], human p110 [Hu et al., Mol. Cell. Biol., 13(12): 7677-7688 (1993)], S. cerevisiae MECl [Weinert et al., Genes Dev., 8(6): 652-665 (1994), S. pombe rad3+ [Seaton et al., supra and Hari et al., Cell, 82: 815-821 (1995)] and an cAMP-dependent protein kinase (PKA) [Beebe et al., Mol. Endocrinol., 4(3): 465-475

(1990)]. Percent identity of nucleotides is shown in the top line, percent identity of amino acids is shown in the middle line, and percent similarity of amino acids (i.e., including identical amino acids and conservative variations in amino acids) is shown in the bottom line for each kinase in Table 1. Conservative variation as used herein denotes biologically similar residues. Examples ofconservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like. In the Table, "ND" indicates a value was not determined either because the nucleotide sequence encoding the kinase (i.e., rad3+) was not publically available or because the kinase (i.e., FRAP, p110β, or PKA) lacks the particular domain being compared.

Example 2

The MCCS1 gene was mapped to chromosome 3 by a PCR-based assay. Human/rodent somatic cell hybrids containing various human chromosome panels available from the NIGMS Human Genetic Mutant Cell Repository [Drwinga et al., Genomics, 16: 311-314 (1993)] were used as templates.

Two oligonucleotide primers oDH23 (SEQ ID NO: 12) and oDH265' TGGTTTCTGAGAACATTCCCTGA 3' (SEQ ID NO: 19) based on the MCCSlα cDNA sequence were utilized to amplify a portion of the gene. The primers generate 237 bp PCR products. PCR conditions consisted of 50 ng genomic DNA, 0.5 μg of each primer, 200 μM dNTPs, 1.5mM MgCl₂, IX PCR buffer (Perkin Elmer-Cetus), and 1 unit of Amplitaq polymerase (Perkin-Elmer Cetus) in a 25 μl reaction volume. The samples were denatured for 4 minutes and then cycled 35 times with denaturing, annealing, and extension times of 45 seconds, 30 seconds, and 45 seconds, respectively, in a Model 480 Cetus Thermocycler. Five μl of the resulting PCR product was electrophoresed on a 3% agarose gel and stained with ethidium bromide.

DNA corresponding to the human/rodent chromosome 3 hybrid yielded a positive amplification product.

In a second set of amplification reactions, the same oligonucleotide primers were used to sublocalize the MCCSl gene to a specific region on chromosome 3. The templates for these amplifications consisted of DNA samples from patients with chromosome 3 truncations [Leach et al. , Genomics, 24: 549-556 (1994)]. Amplifications were performed as described in the foregoing paragraph. The pattern ofpositive amplification products narrowed the localization to the interval between q21 and q25.1. Example 3

Polynucleotides encoding carboxyl terminal portions ofthe PIK-related kinase MCCS1β were expressed by recombinant techniques in E. coli.

Two E. coli expression plasmids were constructed that expressed either the COOH-terminal 423 or 571 amino acid residues of the kinase in the Pinpoint fusion protein expression/purification system (Promega, Madison, Wisconsin).

Briefly, DNA sequences encoding the COOH-terminal portion of the kinase (nucleotides 1339 to 2630 or nucleotides 898 to 2630 of SEQ ID NO: 3) were fused in frame to the COOH-terminus ofa 13 kD peptide derived from the transcarboxylase complex from propionibacterium shermanii. This region undergoes biotination in E. coli, and thus provides a means for monitoring expression and purification of the fusion proteins. Expression was driven from the tac promoter in pinpoint Xa3.

Fusion protein expression was induced with 0.1mM IPTG and confirmed using streptavidin alkaline phosphatase in a pseudo-Western format as described by the manufacturer.

Example 4

Recombinant versions of MCCS1 may also expressed in yeast or in

SF9 insect cells using a baculovirus expression system. The FRAP kinase has been expressed, purified and is enzymatically active after expression in the baculovirus system [Brown et al. , supra].

The coding region of MCCS1 is fused at the amino terminus to a heterologous peptide sequence, such as the FLAG tag MDYKDDDDK (SEQ ID NO:

20) or a six-histidine tag, and reconstructed into the appropriate vectors. Once expressed in insect cells, a monoclonal antibody that recognizes the FLAG tag (Eastman Kodak, Rochester, New York) is used to purify large quantities of the FLAG-PIK-related kinase fusion protein. Infected insect cells are incubated for 48 hours and lysed in lysis buffer (25mM 2-glycerolphosphate, 50mM sodium phosphate pH 7.2, 0.5% Triton-X 100, 2mM EDTA, 2mM EGTA, 25 mM sodium fluoride, 100μM sodium vanadate, 1mM PMSF, 1μg/ml leupeptin, 1μg/ml pepstatin, 1mM benzamidine, and 2mM DTT). Expressed FLAG fusion proteins are purified over a column containing anti-FLAG antibody M2 affinity resin (Eastman Kodak). The column is washed with 20 column volumes of lysis buffer, then 5 column volumes of0.5M lithium chloride, 50mM Tris pH 7.6, 1mM DTT, and then eluted either with 0.1M glycine pH 3.0 followed by immediate neutralization or by competitive elution with the FLAG peptide. For six-histidine tagged proteins, Ni-NTA agarose (Qiagen) is used for protein purification. Shortly after the filing of parent application U.S.S.N.08/558,666, a gene identified as ATR was described by Antony M. Carr and co-workers (personal communications). ATR appears to encode the same or a closely related protein to MCCS1 based on a comparison of amino acid sequences between ATR and MCCS1. The DNA and deduced amino acid sequences of ATR are presented in SEQ ID NOs:

28 and 29, respectively. The sequence differences between ATR and MCCS1β are as follows. ATR includes an additional 98 amino acid residues at the N-terminus. At nucleotide position 1284 (SEQ ID NO: 32) there is a conservative base change from "A" in MCCS1β to "T" in ATR and at nucleotide position 4176, there is an additional conservative base change from "C" in MCCS1β to "T" in ATR.

The FLAG tag was fused at the amino-terminus of a truncated ATR molecule which lacked the first sixty-six ATR amino acids. The FLAG tag was added by PCR as follows. The oligos FLAG-ATR

(5'-CGGGATCCGCCATGGACTACAAGGACGATGACAAGATGTTGCTTGATTTC-3). And HFB24 (5'CTTAAGCCGCATGAGCACACCGTC-3') were used in the following PCR reaction: 100ng of pcDNAATR (obtained from Antony M. Carr) as template; IX PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCl₂, 200μM each of dATP, dGTP, dCTP, and TTP, 10 ng/μl of each primer; 1U AmpliTaq (Perkin-Elmer Cetus). The reaction was denatured at 94°C for 4 minutes followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 72°C for 30 seconds. The resulting approximately 800 bp PCR product was digested with BamHI and NheI and was ligated to the 10kb fragment of the mammalian ATR expression plasmid, pcDNAATR digested with BamHI and BstXI along with the remainder of the ATR coding sequences contained on a 2.5 kb BstXI to NheI fragment. Sequence analysis confirmed the addition of the FLAG tag. The insert contained within this plasmid was then used to construct a baculovirus expression plasmid that would express the FLAG tagged ATR truncate. The 5' end of ATR contained on a BamHI to BstXI fragment and the 3' end of ATR contained on a BstXI to Sail fragment derived from pBTM ATR were ligated to the baculovirus expression vector, pFB (Gibco/BRL) that had been digested with BamHI and SalI. This plasmid was designated pFMBCCSβFLAG. The full coding region of ATR was fused at the amino terminus to the six histidine tag by PCR. Oligonucleotides MCCSόhis

(5'-CGGGATCCAGCATGCATCACCATCACCATCACATGGGGGAACATGGGC-3') and FrplR ("5'-CATGACCACTGGCCATTCCACACG-3') were used in a PCR reaction to add the six histidine tag to sequences encoding the amino-terminus of

ATR. PCR conditions were as follows: 100 ng of PstA 12ATR (obtained from Antony M. Carr) was used as template; IX PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCl₂, 200μM each ofdATP, dGTP, dCTP, and TTP, 10 ng/μl ofeach primer; 1U AmpliTaq (Perkine-Elmer Cetus). The reaction was denatured at 94°C for 4 minutes followed by 25 cycles of 94°C for 30 seconds, 60°C for 30 seconds and

72°C for 30 seconds. The approximately 800 bp PCR product was digested with BamHI and MscI and ligated to two other fragments: a 10kb fragment from pcDNAATR digested with BamHI and BstXI and an approximately 3 kb MscI to BstXI fragment containing the remainder ofthe ATR coding sequence. The addition of the six histidine tag was verified by sequence analysis. The resulting plasmid encoding a six-histidine tagged full length ATR molecule was designated pcDNA6his ATR.

To construct a baculovirus expression plasmid that expressed the entire coding sequence of ATR, the 1.2 kb BamHI to Agel fragment from pFBMCCSβFLAG was ligated to the BamHI to Agel fragment from ρcDNA6his

ATR. The resulting plasmid, designated pFB/HisX6MCCS-1 plasmid was transformed into the E.coli strain, DH5α (Gibco/BRL) for screening ofrecombinants. This plasmid was purified by using the Promega "Wizard" mini-prep kit, then transformed into E. coli αSF9 cells (Invitrogen) using the Cellfectin protocol described by Gibco/BRL.

Forty eight hours after transfection, the SF9 cell pellet and baculovirus produced by the transfected cells were harvested. The virus was stored at 4°C in Grace's Complete media containing 10% FBS, Pennicillin-Streptomycin, and Gentamicin. This viral prep was used to make a high liter (P2) virus stock. The P2 virus stock was used to infect a 50 ml culture of SF9 cells. The cells were collected

48 hours after infection and centrifuged at low speed to pellet the cells without lysis. The cell pellet was stored at -20°C for 24 hours before lysis. The cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 8.0; 500 mM NaCl; 1 % NP40; 100 μm PMSF). Expression of ATR was confirmed by immunoblot using the polyclonal antibody anti-AgDH2 as a probe. The FBHisXό ATR baculovirus produced an approximately 300 kDa protein that was immunoreactive with anti-AgDH2 antibodies and comigrated with a protein in a mouse testes cell extract.

The P2 virus stock was also used to infect a 2 liter culture ofSF9 cells. The cells were collected 48 hours after infection, centrifuged at low speed to pellet the cells without lysis and stored at -20°C. A cell pellet from 150 mis of this culture was lysed in 7.5 ml of lysis buffer (50mM NaPO, pH7.2; 0.5% NP-40; 10mM imidazole, 25mM NaF, 100μM Na₃VO₄; 0.5mM AEBSF; 1 μg/ml leupeptin; 1μg/ml pepstatin A) and incubated on ice for 15 minutes. The lysate was then centrifuged for 30 minutes at 10,000 × g. The supernatant was removed and any DNA in the lysate resulting from broken nuclei was sheared by aspirating through an 20 gauge needle. Particulate matter was then removed by filtering through a 0.8 micron filter followed by a 0.2 micron filter. This cleared lysate was adjusted to contain 5 mM β-mercaptoethanol and 0.4 M NaCl. A 1 ml Ni-NTA-agarose column (Qiagen) was equilibrated in Buffer A (0.4 M NaCl; 5 mM β-mercaptoethanol; 0.1 % Triton X-100; 50 mM NaPO₄10 mM imidazole; 25 mM NaF, 100 μM Na₃VO₄; 0.5 mM AEBSF; 1 μg/ml leupeptin; 1 μg/ml pepstatin A) prior to loading the cleared lysate. The sample was loaded at a flow rate of 0.25 ml/minute, washed 5 ml of Buffer A and then eluted in 10 ml of a gradient of 50 to 500 mM imidazole in Buffer A. One half ml fractions were collected and was assayed for kinase activity as follows. Five μl of each fraction was incubated in kinase buffer, 10 μCi ³²PγATP, 10 μM ATP, and 5 μg of substrate PHAS-1 (Stratagene) and incubated at 37°C for 20 minutes. The reaction was then spotted onto phosphocellulose spin columns and centrifuged at

2500× g, washed twice with 0.5 ml of 75 mM phosphoric acid and once with 0.5 ml absolute ethanol. The phosphocellulose disks were then transferred to scintillation vials and the counts per minutes incorporated into the PHAS-1 proteins were recorded. Fractions 4 through 9 were found to contain activity toward PHAS-1 and immunoblot analysis confirmed that ATR was also present in the same fractions. MCCS1 encoding plasmid DNA was transformed into an esr1-1 diploid yeast strain (Matα leu2-1 his4-4 can1 ura3 cyh2 ade6ade2 esr1-1/MATα Ieu2-27his4 trp1 met2 ade2 esr1-1), and cells were grown to mid-log phase in either galactose or glucose containing medium. Cells were pelleted, washed and all steps performed at 4°C. Cell pastes were resuspended in buffer (20 mM Tris at pH 8.0, 300 mM NaCl,

10% glycerol, 0.1 mM PMSF, 0.25 mg/ml pepstatin, leupeptin, and aprotinin) and lysed in a French Press or using glass beads. Lysis was verified by microscopy following a low-speed (10K) spin and a high-speed spin (100K), and the supernatant was loaded onto a 1.5 ml Ni-NTA agarose (Qiagen, Inc., Chatsworth, CA) column prewashed in lx buffer. The column was washed with six column volumes ofbuffer.

The column was eluted stepwise with 8 ml of 10 mM, 50 mM, 100 mM, and 250 mM imidazole in buffer. Fractions were collected and Western analysis was performed using 15 μl of each elution peak. Kinase activity was measured as described above. Example 5

Polyclonal and monoclonal antibodies specific for MCCS1 were generated by standard techniques in the art.

Twodifferentbacterialexpressionplasmids, pGEX1-MEC andpGEX3-MEC, were constructed for the recombinant production of portions of the MCCS1 polypeptide as fusions to the COOH-terminus of glutathione S-transferase (GST).

Both plasmids were used for the generation of antigens AgDH-2 and AgDH-3, from pGEX1-MEC and pGEX3-MEC respectively for use in a standard immunization protocol. pGEX1-MEC contains an EcoRI fragment encoding amino acid residues 566 to 870 of SEQ ID NO: 4 fused to GST in the pGEX1 vector (Pharmacia Biotech, Milwaukee, Wisconsin); pGEX3-MEC contains an Eco Rl fragment encoding amino acid residues 118 to 567 of SEQ ID NO: 4 fused to GST in the pGEX3 vector (Pharmacia Biotech). Induction of the pGEX tac promoter with 0.1mM IPTG led to high level expression of each fusion protein in an insoluble form (inclusion bodies). Following lysis of induced cultures with a French pressure cell, AgDH-2 and AgDH-3 extracts were centrifuged through a 35% sucrose solution containing 0.1M NaCl, 0.01M Tris pH7.5, and 0.001M EDTA (STE). Pellets were then washed twice and resuspended in STE.

For the generation of polyclonal antisera in rabbits, AgDH-2 and AgDH-3 were further purified using preparative SDS polyacrylamide gel electrophoresis and electroelution of each antigen from gel slices. Primary immunization of female New Zealand White rabbits was with 200 μg of each antigen mixed with complete Freund's adjuvant injected at multiple sites subcutaneously. Subsequent immunizations were with 100 μg antigen mixed with incomplete Freund's adjuvant at approximately 21 day intervals, and test bleeds were taken after immunizations 3, 4 and 5. Western blot analysis of extracts of human testis tissue demonstrates antibody reactivity against an approximately 270 kD protein in immune but not preimmune antisera. In addition, the immune sera showed reactivity against the MCCSl pinpoint fusion proteins described in Example 3, providing evidence of the generation of MCCS1-specific antibodies.

The MCCS1-specific antibodies were purified as follows. Inclusion body preparations of AgDH-2 and AgDH-3 were coupled to cyanogen bromide (CNBr)-activated Sepharose (Pharmacia, Alameda, CA). Two mg of antigen were solubilized in 1 % SDS (4.5 ml final volume) and dialyzed overnight against Coupling Buffer (0.1M NaHCO₃/0.1 % SDS). 0.5 ml of 5M NaCl were added to each antigen preparation prior to incubation with the CNBr Sepharose. 0.4 gm of freeze-dried

CNBr Sepharose (per antigen) were resuspended in 1 mM HCl and washed in a scintered glass funnel with 250 ml 1 mM HCl added in several aliquots over 15 minutes. The HCl-washed CNBr Sepharose was then removed to a 15 ml snap cap tube and washed twice with 5 ml of Coupling Buffer. Dialyzed antigen preps were added to the washed Sepharose and then incubated at room temperature for 1.5 hours on a slowly rotating wheel. The Sepharose was washed once with 5 ml of Coupling Buffer, once with 10 ml of 0.1M Tris pH8.0, and then incubated in 10 ml 0.1M Tris 8.0 for 2 hours at room temperature to block any remaining reactive groups on the resin. Coupling efficiency was 60-80% as judged by SDS-PAGE analysis. The antigen columns were then washed with 15 ml of 6M Guanidine HCl (to remove uncoupled antigen), 25 ml of Buffer A (50mM Tris pH 7.4), 15 ml of Buffer B (4.5M MgCl₂/lmg/ml BSA/50mM Tris 7.4), and then 50 ml of Buffer A. Thirty ml of rabbit serum from immunized animals (rabbit 4747 immunized with AgDH-3 and rabbit 4779 immunized with AgDH-2) were passed over the appropriate antigen column over the course of 3 hours. The columns were then washed with 20 ml of Buffer A, 40 ml of 1M Guanidine HCl, and then equilibrated with an additional 20 ml of Buffer A. Anti-AgDH-3 or Anti-AgDH-2 antibodies were then eluted off the antigen columns with 10 ml of Buffer B. One ml fractions were collected, IgG-containing fractions were pooled and dialyzed against 1 L of phosphate buffered saline (PBS) for 3 hours, and then overnight against 1 L of PBS containing 35% glycerol.

Antipeptide antibodies were generated against the human ATM protein by coupling a 15-amino-acid peptide (residues 1359-1373) to Keyhole Limpet Hemocyanin-using EDC as described by the manufacturer (Pierce), followed by injection of the coupled immunogen into rabbits. The antibodies were first precipitated from the serum (#6076) with an equal volume of saturated ammonium chloride followed by resuspension and dialysis against PBS. Affinity purification was carried out using a peptide column prepared by coupling the antigenic peptide to CNBr-activated Sepharose (Pharmacia) as described by the manufacturer. The antibodies were then bound to the peptide column and washed with 2 m KCl-PBS. Elution was carried out with 20 ml S m Nal (in 1 mM sodium thiosulfate), which was dialyzed immediately against PBS.

To generate monoclonal antibodies, female Balb/c mice were immunized with 50 ug AgDH-2 or AgDH-3. Additional mice were immunized with 25 to 50 ug AgDH-2 or AgDH-3 that had been combined with an equal molar ratio of mAb 61F3B, a monoclonal antibody with specific reactivity to GST. A third group of mice were immunized with SDS polyacrylamide gel slices containing

AgDH-2 or AgDH-3. The immunogen for each group of mice was prepared in complete Freund's adjuvant, with subsequent boosts (25 ug antigen in incomplete Freund's) at about 21 day intervals. Cell lines producing monoclonal antibodies were isolated as follows. Briefly a single cell suspension was formed by grinding immunized mouse spleen in serum free RPMI 1640, supplemented with 2mM L-glutamine, ImM sodium pyruvate, 100 units/ml penicillin, and 100 μg/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension was filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free RPMI. Thymocytes taken from three naive Balb/c mice were prepared in this manner.

NS-1 myeloma cells kept in log phase in RPMI with 11 % fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described in the foregoing paragraph. After washing, each cell suspension was brought to a final volume of 10 ml in serum free RPMI, and 10 μl was diluted 10:100. Twenty μl of each dilution was removed, mixed with 20 μl 0.4% trypan blue stain in 0.85% saline (Gibco), loaded onto a hemacytometer and counted.

Two × 10⁸ spleen cells were combined with 4 × 10⁷ NS-1 cells, centrifuged, and the supernatant was aspirated. The cell pellet was dislodged by tapping the tube and 2 ml of 37°C PEG 1500 (50% in 75mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes. An additional 16 ml RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI containing 15% FBS, 100 μM sodium hypoxanthine, 0.4μM aminopterin, 16μM thymidine (HAT) (Gibco), 25 units/ml IL-6 (Mallinckrodt, Folcrost, Pennsylvania), and 1.5 ×

10⁶ thymocytes/ml. The suspension was dispensed into ten 96-well flat bottom tissue culture plates at 200 μl/well. Cells in plates were fed 3 to 4 times between fusing and screening by aspirating approximately half the medium from each well with an 18 G needle and replenishing plating medium described above except containing 10 units/ml IL-6 and lacking thymocytes.

Fusions were screened when cell growth reached 60-80% confluency (day 7 to 9) by ELISA on AgDH2 versus AgDH3. Immunlon 4 plates (Dynatech, Cambridge, MA) were coated at 4°C overnight with 100 ng/well protein in 30mM carbonate buffer, pH 9.6. Plates were blocked with 100 μg/well 0.5% fish skin gelatin in PBS for one hour at 37°C, washed 3 times with PBS, 0.05% Tween 20

(PBST) and 50 μl culture supernatant is added. After incubation at 37° C for 30 minutes, and washing as described above, 50 μl of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, PA) diluted 1:10,000 in PBST was added. Plates were incubated as above, washed 4 times with PBST and 100 μl substrate consisting of 100 μg/ml of tetramethylbenzidine and 0.15 μl/ml H₂O₂ in 100mM sodium acetate, pH 5.5, was added. The color reaction was stopped in 5-10 minutes with the addition of 50 μl of 15% H₂SO₄. A₄₉₀ was read on a plate reader.

Fifty three pools of hybridomas that were positive in an ELISA were screened for the ability to immunoblot or immunoprecipitate MCCS from a mouse testes cell lysate. Immunoblot analysis using the mouse testes extract is described in Example 6. Immunoprecipitations was performed as follows. A six percent SDS polyacrylamide gel was run and transferred to Immobilon-PVDF in 192 mM glycine, 25 mM Tris base, 0.1% SDS, 20% methanol, then blocked for 1 hour in 5% powdered nonfat milk, 20 mM Tris ph 7.5, 100 mM NaCl 0.1 % Tween 20, and cut into the appropriate number of strips. The primary antibody (well supernatant) was diluted in the above block solution and incubated for one hour at room temperature, washed four times in block minus milk, incubated in goat anti-mouse IgG (H+L) HRP (BioRad #170-6516), washed again in block solution minus milk, transfered to NEN Renaissance ECL reagent and developed for 5 minutes.

Immunoprecipitation was performed as follows. Fifty μl of hybridoma supernatant was incubated for one hour on ice with 300 μg of testes cell lysate prepared as described in Example 6. Thirty μl of a 50% slurry of protein A agarose (Pierce, Rockford, IL), prebound to a rabbit anti-mouse bridging antibody (5 μg/reaction) (Pierce) was added and incubated at 4°C with rocking. The immune complexes were washed three times in lysis buffer and the antigen/antibody complex eluted by boiling in SDS sample buffer (2% SDS, 20 mM Tris pH 6.8, 20% glycerol,

0.001% bromphenol blue). The resulting supernatant was separated on a 6% SDS polyacrylamide gel and transferred to Immobilon-PVDF (Millipore) and an immunoblot was performed using affinity purified rabbit anti-Ag DH2 polyclonal antiserum. Four hybridomas were cloned and characterized in immunoblots, immunoprecipitations and in immunoprecipitation/kinase assays as described in

Example 6. The four hybridoma cell lines were designated 224B, 224C (ATCC HB 12233), 224F (ATCC HB 12234) and 224G. All four monoclonal antibodies recognized MCCSl by immunoblot and immunoprecipitation.

Example 6

MCCS1 associated protein kinase activity was immunoprecipitated using the MCCS1-specific polyclonal antibodies described in Example 5.

Extracts were made from fresh testes tissue isolated from Balb/c mice. Minced testes were homogenized on ice with 10-15 strokes of a tight fitting dounce homogenizer in Lysis Buffer (50 mM NaPO4, pH 7.2; 0.5% TritonX-100; 2 mM EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM phenylmethylsulfonyl fluoride [PMSF]; 1 μg/ml leupeptin; 1 μg/ml pepstatin A; 2 mM

DTT) and incubated on ice for 30 minutes. The lysate was centrifuged at 13,000×g rpm for 10 minutes at 4° C in a TL-100 table-top ultracentrifuge (Beckman) to remove unbroken cells and other insoluble material. Aliquots of cell lysate were snap frozen in liquid N₂ and stored at -70°C. Five hundred ug of testes extract was incubated with either 5 ug of affinity purified anti-AgDH-2 polyclonal antibody or 5 ug purified rabbit IgG (Zymed, So. San Francisco, CA) in 1 ml of Lysis buffer for one hour on ice in microcentrifuge tubes. Thirty μl of protein A sepharose beads (Repligen, Cambridge, MA) (washed in Lysis buffer) were added to the extracts, and then incubated for an additional 30 minutes at 4° C on a rocking platform. The immune complex/Protein A sepharose beads were washed four times with 1 ml of

Lysis buffer, one time with 1 ml Kinase Buffer (25 mM Hepes pH 7.7; 50 mM KCl; 10 mM MgCl₂; 0.1 % NP-40; 2% glycerol; 1 mM DTT), and then incubated in 20 ul Kinase Buffer with 10 μCi ATP [50 Ci/mmol]) for 20 minutes at 37°C. The kinase reactions were stopped with 20 μl 2X SDS sample buffer and heated to 100°C prior to separation on 6% polyacrylamide gels. Gels were fixed in 20% methanol/7% Acetic acid, and then dried onto Whatman 3MM paper prior to autoradiography. While little or no phosphorylation was evident in control immunoprecipitations, immunoprecipitations using anti-AgDH-2 antibody contained two majorphosphorylated bands at approximately 300 kD and approximately 180 kD. In addition, there were several minor phosphorylation products, including one which comigrated with the MCCS1 protein itself as demonstrated by Western blot analysis (see Example 8 for Western blot description.) Phosphoaminoacid analysis of the approximately 300 kD protein identified the presence of phosphoserine residues. Addition of 5 ug of AgDH-2 (but not AgDH-3) dramatically reduced or eliminated the MCCS1-associated kinase activity found in the immunoprecipitates. Example 7

The expression pattern of MCCS1 in various human tissues was examined by Northern blot hybridization.

Nylon membranes containing 2 μg of size-fractionated polyA+ RNA from a variety of human tissue sources were obtained from Clontech Laboratories, Inc., and the hybridization protocol supplied by the manufacturer was followed precisely, except that the final wash was performed at 55° C, rather than 50° C, to minimize the possibility of cross-hybridization to related sequences. The ³²P-labelled DNA hybridization probe used was generated by PCR. A DNA encoding the COOH-terminal 30% of MCCS1α was used as a template to amplify a 1.3 kb fragment in the presence of³²P-dCTP using primers 279-35'TGGATGATGACAGCTGTGTC 3'

(SEQ ID NO: 21) and 279-65'TGTAGTCGCTGCTCAATGTC3' (SEQ ID NO: 22).

Results of the Northern blots show that MCCS1 is expressed as an approximately 9 kb mRNA in a wide variety of human tissues. Testis tissue contains the highest level of MCCS1 mRNA, though the transcript is also expressed in small intestine, ovary, prostate, thymus, spleen, heart, peripheral blood lymphocytes, colon, brain, placenta, skeletal muscle, kidney and pancreas.

Expression of MCCS1 mRNA in human cancer cell lines was also examined using a human cancer cell line RNA blot obtained from Clonetech. The RNA blot contained RNA from the cell lines HL-60 (promyelocytic leukemia), HeLa (cervical carcinoma), K-562 (chronic myelogenous leukemia), MOLT-4

(lymphoblastic leukemia), Raji (Burkitt's lymphoma), SW480 (colorectal adenocarcinoma), A549 (lung carcinoma), and G361 (melanoma). Northern blot analysis was performed as directed by the manufacturer with hybridization being carried out at 65°C using a 2.0kb Kpnl-Sall fragment of the MCCS1 partial clone HFB2. Expression was observed in the HL-60, HeLa, K-562, Raji, SW480, and

G361 cell lines with the highest level of expression occurring in the G361 cell line. Detectable but low levels of expression were observed in the MOLT-4 and A549 cell lines.

Example 8

The expression ofMCCS1 mRNA and protein in normal and irradiated mouse testes and in mouse embryos was examined by in situ hybridization, immunostaining and/or immunoblotting.

In situ Hybridization

Normal and irradiated mouse testes were harvested from male Balb/c mice. The tissues were sectioned at 6μm thickness, picked up on Superfrost Plus^® (VWR Scientific) slides and allowed to air-dry at room temperature overnight. Sections were stored at -70° C if not immediately used. The tissue sections were fixed in 4% paraformaldehyde (Sigma) in PBS for 20 minutes at 4° C, dehydrated (70%, 95%, 100% ethanol) for 1 minute at 4° C in each grade, then allowed to air dry for 30 minutes at room temperature. The slides were acetylated in a solution of0.25 % (v/v) acetic anhydride (Sigma)/0. IM triethanolamine pH 8.0 for 10 minutes at room temperature with stirring, rinsed in 0.2X SSC for 10 minutes at room temperature with stirring, and dehydrated and air dried as described above. The tissues were hybridized in situ with digoxigenin-labeled single-stranded mRNA generated from murine MCCS1 DNA by in vitro RNA transcription incorporating digoxigen-UTP (Boehringer Mannheim). The labeled riboprobes (see sequence in SEQ ID NO: 27)

(lμg/section) and diethylpyrocarbonate (depc)-treated water were added to hybridization buffer with a final concentration of 50% formamide, 0.3 M NaCl, 20 mM Tris pH 7.5, 10% dextran sulfate, IX Denhardt's solution, 100 mM dithiothreitol (DTT) and 5 mM EDTA, and 20 μl of the solution was applied to each section and covered with a sterile, RNase-free 22 × 22 cover slip. The mRNA in both the section and the probe solution was denatured by heating the slides to 85°C for 10 minutes in an oven. Hybridization was carried out overnight (12-16 hours) at 50° C.

After hybridization, sections were washed for 1 hour at room temperature in 4X SSC/10 mM DTT, then for 30 minutes at 50° C in 50% formamide/2X SSC/10 mM DTT, 30 minutes at 37° C in a solution of 500 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA, pH 7.5 (NTE buffer), 30 minutes at 37°C in a bath of 10 μg/mL RNase A (Boehringer Mannheim) in NTE buffer, 15 minutes at 37°C in NTE buffer, 15 minutes at room temperature in 2X SSC, 15 minutes at room temperature in 0.1X SSC, and 2 minutes at room temperature in 100 mM Tris-HCl, 150 mM NaCl, pH 7.5 (Buffer 1). To detect the labeled riboprobes, the sections were blocked for 30 minutes at room temperature in a solution of 5 % normal sheep serum (Harlan Bioproducts for Science, Indianapolis, IN) and 0.3% Triton X-100 (Sigma) in Buffer 1 with gentle stirring, after which 150 μl/section of sheep αDigoxigenin-gold conjugate (Goldmark Biologicals, Philipburg, Pa) was applied to the tissues and incubated for 2 hours at room temperature. The slides were then washed three times for 5 minutes in Buffer 1, five times for 3 minutes in sterile deionized water, the excess liquid blotted off the slide and 2 drops each of silver enhancing and initiating solution (Goldmark Biologicals) applied to each section. The chemical reaction was allowed to proceed for 23 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in

Nuclear Fast Red (Vector), rinsed again in sterile deionized water, air dried overnight at room temperature and mounted with Cytoseal 60 (VWR).

In both normal and irradiated mouse testes signal was observed in the cytoplasm of spermatogonia and spermatocytes. The expression level in irradiated testis was not increased over that seen in normal testis.

Immunostaining

Testis tissue from normal male Balb/c mice was sectioned at 6 μm thickness, picked up on Superfrost Plus^® (VWR Scientific) slides and allowed to air-dry at room temperature overnight. Sections were stored at -70° C if not immediately used. The sections were fixed in cold (4°C) acetone for 10 minutes at room temperature; once the slides were removed from the acetone the reagent was allowed to evaporate from the sections. Each tissue section was blocked with 150 μl of a solution of 30% normal rat serum (Harlan Bioproducts), 5% normal goat serum (Vector Laboratories) and 1 % bovine serum albumin (BSA) (Sigma) in IX TBS for 30 minutes at room temperature. Afterblocking, the solution was gently blotted from the sections and anti-AgDH-3 and anti-AgDH-2 polyclonal antibodies and preimmune sera from the same rabbits were diluted 1:50 and 1:100 in the blocking solution and 100 μl applied to each tissue section and incubated for 30 minutes at 37° C. The antibody solution was blotted gently from the sections and unbound antibody removed from the sections by washing the slides 3 times for 5 minutes each in IX TBS. The excess TBS was blotted from the slide and 100 μl of the biotinylated goat anti-rabbit antibody contained in the Elite Rabbit IgG Vectastain ABC kit (Vector), prepared according to the product insert, were applied to each section and incubated for 15 minutes at 37° C. After incubation, the slides were washed 2 times in IX TBS for 5 minutes in each wash. Next, 100 μl of streptavidin-gold conjugate (Goldmark Biologicals) diluted 1:100 in a solution containing 5% normal rat serum and 1 % BSA was applied to each section and incubated for 1 hour at room temperature. The slides were then washed 3 times in IX TBS for 5 minutes each wash, and 100 μl of 1 % glutaraldehyde (Sigma) in TBS buffer was applied to the slides for 5 minutes at room temperature. The slides were then washed 3 times for 5 minutes each in TBS, then 4 times in sterile deionized water for 3 minutes each. The excess liquid was blotted from each slide and 2 drops each of silver enhancing and initiating solution

(Goldmark Biologicals) were applied to each section. The chemical reaction was allowed to proceed for 13 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in Nuclear Fast Red (Vector), rinsed again in sterile deionized water, air dried overnight at room temperature and mounted with Cytoseal 60 (VWR).

Signal was detected in the spermatogonia and primary spermatocytes with both of the polyclonal antibodies, but not with the preimmune sera from the same animals.

Immunoblotting

Freshly obtained mouse testicles were minced with razor blades in cold

PBS, and a cell suspension was generated using a loose fitting dounce homogenizer. This cell suspension was then boiled with an equal volume of 2X SDS sample buffer. Fifty ug aliquots of each extract were separated on 6% polyacrylamide gels, transferred onto Immobilon membranes (Millipore, Bedford, MA) and analyzed for anti-MCCS1-reactivity using the affinity purified antibodies in Example 5, and HRP-conjugated goat anti-rabbit secondary antibody and the Renaissance Enhanced Chemiluminescence kit (Dupont/NEN, Boston, MA). Extracts prepared from fresh mouse testis contain a high molecular weight species (about 294 kD) that was recognized by both affinity-purified antiserum. No reactivity against this protein was seen with either of the preimmune sera. Importantly, the signal obtained from each affinity purified sera was specifically blocked afterpre-incubation ofthe antibody with the corresponding immunogen.

In summary, high levels of MCCS1 mRNA and protein are detected in mouse testis in the spermatogonia and primary spermatocytes, cells that are in the early stages of meiosis. This suggests that MCCS1 plays an important role in meiotic cell division. Meiosis is a specialized form of cell division that produces germ cells in higher eukaryotes. There are two major characteristics of meiosis that distinguish it from mitosis. Whereas mitotic cell division results in genetically identical cells containing two of each chromosome, meiotic cell division results in cells containing one of each chromosome. Early in meiosis, during the "reduction division" process, sister chromatids pair and undergo reciprocal recombination at some regions. During this process, these cells are exposed to DNA strand breaks. It is likely that the cellular response to the DNA strand breaks during meiosis is similar to the cellular response found in non-germ cells in response to IR-induced DNA damage. This interpretation is further substantiated by studies that demonstrate the MEC1 is upregulated 10 to 20 fold during sporulation, indicating an important role for MCCS1 during meiosis in addition to its role in DNA repair.

Example 9

In order to identify the cells within the developing mouse testis that express MCCS1, Western blot analysis of MCCS1 expression within populations of meiotic cells was performed. Extracts of purified pachytene spermatocytes, round spermatids, condensing spermatids, and epididymal sperm cells were examined for

MCCS1 expression as described above in Example 8.

Pachytene spermatocytes, round, and condensing spermatids were prepared from decapsulated testes of adult mice by sequential dissociation with collagenase and trypsin-DNase 1. The cells were separated into discrete populations by sedimentation velocity at unit gravity in 2-4% BSA gradients in Enriched Krebs

Ringer Bicarbonate Medium (EKRB). The pachytene spermatocyte and round spermatid populations were each at least 85% pure, while the condensing spermatid population was about 40-50% pure (contaminated primarily with enucleated residual bodies and some round spermatids). Sperm were obtained from the cauda epididymides. Purified populations of spermatogenic cells were dissolved directly in SDS-sample buffer containing 40 mM DTT, heated to 100°C for 5 minutes, and the amount of protein in each sample determined by the Amido-Black procedure.

The highest levels of MCCS1 protein were found in pachytene spermatocytes, with the level dropping significantly in round spermatids. MCCS1 protein levels were barely detectable lower in the condensing spermatid population, and this may reflect the presence of round spermatids in the preparation (see above).

No MCCS1 protein was detected in epididymal sperm. The Western analysis thus corroborates the immunocytochemical data, and suggests a role for MCCS1 in meiotic cells.

Example 10

Substrates of MCCS1 and proteins that interact with MCCS1 (for example, members of the cell cycle checkpoint pathway and proteins that localize MCCS1 in cells) may be identified by various assays.

A. Identification of Substrates

Substrates of MCCS1 may be identified by incorporating test compounds in assays for kinase activity. MCCS1 kinase is resuspended in 20 μl kinase buffer (25mM Hepes pH7.4, 25mM KCl, 10mM MgC12, ImM DTT, 2% glycerol, 0.1 % NP40, 0.5mM ATP, 10 uCI gamma ³²P-ATP) and incubated for 30 minutes, either in the presence or absence of 4 μg test compound (e.g., casein, histone H1 , or appropriate substrate peptide). Reactions are separated on 12% PAGE gels and dried onto Whatman paper prior to autoradiography. Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate indicates that the test compound is a substrate of the kinase.

The protein PHAS-1 has been identified as an in vitro substrate ofATR (Example 4). PHAS-1 is a heat and acid-stable protein that phosphorylated at several sites in vivo in response to insulin and growth factors. PHAS-1 binds to the mRNA cap binding factor, EIF-4E, and prevents translation of capped mRNAs. Phosphorylation of PHAS-1 at a specific serine residue results in dissociation of PHAS-1 form EIF-4E and thus releasing the inhibition of translation of capped mRNAs. This mechanism allows for a rapid synthesis of protein in response to a particular stimulus. PHAS-1 may be phosphorylated by several protein kinases in vivo including a protein kinase that is sensitive to rapamycin. Since the rapamycin-sensitive protein kinase, FRAP, is related to ATR, it would be reasonable to assume that there might be an overlap in substrate specificity between FRAP and ATR and that PHAS-1 is a substrate for both of these protein kinases in vitro. To test this hypothesis, ATR that was immunoprecipitated from a mouse testes cell extract orHis-tagged ATR purified from baculovirus-infected SF9 cells (Example 4) was incubated with 10 μg PHAS-1 (Stratagene) in kinase buffer (25 mM Hepes pH 7.4, 25 mM KCl, 10 mM MgCl₂, 1 mM DTT, 0.1 % NP-40), 10 μM ATP and 10 _μCi₃₂P_γATP for 20 minutes at 37ºC. Since phosphorylated PHAS-1 was known to bind to phosphocellulose paper, the reaction was spotted onto phosphocellulose spin columns and centrifuged at 2500 × g, washed twice with 0.5 ml of 75 mM phosphoric acid and once with 0.5 ml absolute ethanol. The phosphocellulose disks were then transferred to scintillation vials and the counts per minutes incorporated into the PHAS-1 proteins were recorded. ATR readily phosphorylated PHAS-1 whereas negative controls showed little or no PHAS-1 phosphorylation. To map which residue is phosphorylated, the following peptides representing PHAS-1 sequences containing serine and threonine residues were synthesized.

Peptide PH-1

MSGGSSCQTPSRAIPATRR (SEQ ID NO: 36)

Peptide PH-2

GDYSTTPGGTLFSTTPGGTRR (SEQ ID NO: 37)

Peptide PH-3

ECRNSPVTKTRR (SEQ ID NO: 38)

Peptide PH-4

GVTSPSSDEPRR (SEQ ID NO: 39)

Peptide PH-5

MEASQSHLRR (SEQ ID NO: 40) Peptide PH-6

RRNSPEDKRAGG (SEQ ID NO: 41)

Peptide PH-7

GEESQFEMDIRR (SEQ ID NO: 42)

These peptides are tested in the same kinase reaction to determine which peptide(s) is (are) phosphorylated by ATR. The peptide(s) are then used as substrate for ATR or MCCS1 in assays such as described in Example 11 to identify modulators.

The same kinase reaction was also used to determine if proteins such as histone H1 (Upstate Biotechnology, Inc., Waltham, NY) and myelin basic protein (Gibco BRL, Gaithersburg, MD) which are known to be substrates of other protein kinases are substrates of MCCS1 and ATR. No phosphorylation of histone H1 or myelin basic protein was observed under the conditions of the assay. Moreover, a peptide from p53 known to be a substrate of DNA-PK was also not phosphorylated in the assay.

B. Identification of Interacting Proteins

Interacting proteins may be identified by the following assays.

A first assay contemplated by the invention is a two-hybrid screen. The two-hybrid system was developed in yeast [Chien et al., Proc. Natl. Acad. Sci. USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene. Specifically, a polynucleotide encoding a protein that interacts with MCCSl is isolated by: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS1 and either the DNA binding domain or the activating domain ofthe transcription factor; expressing in the host cells a library of second hybrid DNA sequences encoding second fusions ofpart orall ofputative MCCS1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; detecting binding ofan MCCS1 interacting protein to MCCS1 in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.

Other assays for identifying proteins that interact with MCCS1 may involve immobilizing MCCS1 or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCS1.

Another type of assay for identifying MCCS1 interacting proteins involves immobilizing MCCS1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable ofexciting the fluorescent agent, contacting the immobilized MCCS1 with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the florescent agent. Alternatively, the putative interacting protein may be immobilized and MCCS1 may be labelled in the assay.

Example 11

Modulators of MCCS1 include MCCS1 variants and other molecules. The modulators may affect MCCS1 kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway. Presently preferred regions of MCCS1 which are targets for mutation or the development of selective modulators include the following four regions: the MCCS1α amino terminal effector domain (amino acids 1 to 1081 of SEQ ID NO: 31), the MCCS1β amino terminal effector domain (amino acids 1 to 1150 of SEQ ID NO: 33), the MCCS1α rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS1βrad3+ domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCS1α PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS1β PIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).

MCCS1 variants having mutations in the kinase domain may be useful as a radiosensitizing agents. Mutations specifically contemplated by the invention are, replacement ofthe MCCS1α aspartic acid at amino acid 2241, the asparagine at 2246, and the aspartic acid at 2260 of SEQ ID NO: 31 with alanine or methionine, and the corresponding mutations in MCCS1β. Analogous mutations in the rad3+ gene resulted in yeast hypersensitive to radiation. In addition, mutations in the kinase domain of ATM are found in patients with AT, a disease that causes radiation sensitivity.

Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.

For example, an assay for identifying modulators of MCCS1 kinase activity involves incubating an MCCS1 kinase preparation in kinase buffer with gamma-³²P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. For example, 2 μl ofthe 50 mM imidazole elution pool is added to kinase buffer. (See Example 6.) The reactions are incubated at 37°C for 20 min and samples are analyzed by SDS-PAGE prior to autoradiography or Western analysis.

An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS1 kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS1 kinase.

Moreover, assays for identifying compounds that modulate interaction ofMCCS1 with other proteins may involve: transforming or transferring appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all ofMCCS1 and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA sequence encoding part or all of a protein that interacts with MCCS1 and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS1 and the interacting protein by detecting binding of the interacting protein to MCCS1 in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence ofthe modulating compound. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.

Another type of assay for identifying compounds that modulate the interaction between MCCS1 and an interacting protein involves immobilizing MCCS1 or a natural MCCS1 interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCS1 interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCS1 interaction with the protein.

Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCS1 and an interacting protein involves immobilizing MCCS1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the florescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound. Alternatively, the MCCS1 interacting protein may be immobilized and MCCS1 may be labelled in the assay. Example 12

Cell based complementation assays for identifying modulators of MCCS1 or ATM are described below.

In one type of assay, host cells (for example, esr1-1 yeast cells) are transformed with MCCS1-encoding DNA as is described in Example 4. The esr1-1 yeast strain is normally sensitive to treatment with ultraviolet (UV) light, but esr1-1 yeast cells expressing MCCS1 or ATR are no longer sensitive to treatment with UV light. The transformed yeast cells are exposed to test compounds and the effect of the test compounds on UV sensitivity ofthe transformed host cell is determined. Test compounds that are inhibitors of MCCS1 or ATR activity restore UV sensitivity to the MCCS1 transformed esr1-1 cells. Alternatively, esr1-1 tell double mutant yeast cells are used as host cells instead of esr1-1 yeast cells. The TEL1 gene is homologous to ATM and the TEL1 mutation is described in Morrow, et al., Cell,

#2:831-840 (1995). The invention also specifically contemplates that the esr1-1 or esr1-1 tell double mutant yeast host cells may be transformed with ATM-encoding

DNA (SEQ ID NO: 34).

In an alternative embodiment, the assays include clastogenic agents or events instead of treatment with UV light (e.g. , IR, hydroxyurea, or DNA damaging agents). Appropriate host cells for use in such embodiments would be those that are sensitive to the alternative clastogenic agents or events.

Another type ofcomplementation assay involves the use ofmammalian host cells such as cell lines derived from cells of AT patients. As described above for yeast cells, the mammalian cells are transfected with DNA encoding MCCS1, ATR, or ATM and then exposed to test compounds. Test compounds that are inhibitors of MCCS1, ATR, or ATM activity will restore the phenotype of the untransformed host cell (e.g., sensitivity to IR).

The above assays can be used to identify compounds that inhibit activity of MCCS1, ATR, and ATM or compounds that inhibit activity of only one of the enzymes.

In an alternative type of assay, the yeast or mammalian host cells are transformed with DNA encoding chimeric polypeptides including various combinations of MCCS1 and ATM domains. MCCS1 and ATM show structural similarities, and chimeric polypeptides which comprise portions ofMCCS1 and ATM are useful in elucidating active sites and binding domains of both MCCS1 and ATM. Polynucleotides encoding the chimeras can be prepared by standard molecular biology techniques known to the skilled worker and as exemplified herein. The chimeric polypeptides are expressed in host cells and modulators of the chimeras can be identified by the assays disclosed herein.

Example 13

MCCS1 and ATM are both involved in meiosis I checkpoints. Since MCCS1 is demonstrated herein to have kinase activity, assays were performed to determine if ATM possessed kinase activity. To determine the kinase activity of

ATM, ATM was immunoprecipitated from MRC-5 fibroblasts (ATCC #171-CCL) with polyclonal antisera, 6076. MRC-5 cells are human lung embryonal diploid fibroblasts. MRC-5 cells were obtained from the ATCC at passage 19 and maintained in Minimal Essential Medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 mg/ml streptomycin, and 100 mM MEM non-essential amino acids. Media and media supplements were obtained through Gibco Life Technologies. Cell lines were maintained in a water-saturated 37ºC incubator with 5%C.

MRC-5 cell extracts were prepared by lysis of a 10cm plate of log-phase cells in 0.5 ml of Lysis Buffer I (50 mM NaPO₄, pH 7.2; 0.5 % TritonX-100;

2 mM EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM phenylmethylsulfonyl fluoride [PMSF]; 1 μg/ml leupeptin 1 μg/mlpepstatin A; 2 mM DTT) on ice. Cells were scraped from plates using a rubber spatula then sonicated in a cup horn sonicator (Sonifier 250, Branson Ultrasonics Corp., Danbury, CT) at 100% output for 90 seconds. Lysates were then clarified in a 4°C microfuge for 2 minutes. Preclearing was done by adding 10 μg purified rabbit IgG (Zymed) and 30 μl Protein A Agarose slurry (Pierce) followed by incubation at 4°C for 60 minutes while rocking. To the precleared lysates, 10 μg of affinity purified 6076 antisera (or 10 μg 6076 pre-blocked with 0.04 mg P45 peptide for 30 min.) was added and incubated on ice for 60 minutes. Immunoprecipitates were collected by addition of 30 μl Protein A agarose slurry and incubated with rocking at 4°C for 30 minutes followed by four washes in Lysis Buffer I.

Kinase reactions were carried out by washing the immunoprecipitations once with kinase buffer (25 μM Hepes pH 7.7; 50 mM KCl; 10 mM MgCl₂; 0.1 % NP-40; 2% glycerol; 1 mM DTT), followed by incubation in 20 μl of Kinase Buffer containing 10 μM ATP + 10μCi γ ³²P-ATP [50 Ci/mmol] for 20 minutes at 37°C. Reactions were stopped by the addition of20 μl 2X SDS sample buffer and boiled for 5 minutes prior to separation on 6% SDS polyacrylamide gels. The gels were dried and exposed to x-ray film (Kodak, XAR-5) at -80°C overnight.

10 cm plates of log-phase MRC-5 cells were washed once with PBS then incubated in Dulbeco's Modified Eagle Medium (minus methionine) containing 2% dialyzed fetal bovine serum for 30 minutes. Cells were labeled by adding 200 μCi³⁵S-methionine (1000 Ci/mmol TRAN³⁵S-LABEL, ICN Radiochemicals) for 2 hours. Labeled cells were then washed once with PBS and frozen at -80°C prior to immunoprecipitation.

The incubation of the immunoprecipitated complexes in kinase buffer produced aphosphorylated product with a molecular weight ofapproximately 350,000 that co-migrated with ATM in polyacrylamide gels.

Similar results were obtained for ATR immune complexes immunoprecipitated with anti-AgDH-2 (MCCS1) polyclonal antisera of Example 5.

ATR and ATM thus appear to be able to self-phosphorylate or associate with a protein kinase.

To determine the role of ATR and ATM in meiosis, immunostaining techniques on surface spreads of mouse spermatocytes were utilized to localize ATR and ATM to meiotic chromosomes. Antibodies recognizing ATR and ATM were utilized with mouse antibodies against Corl. Corl is a component of axial/lateral elements of synapsing chromosomes [Dobson et al., J. Cell Sci., 107:2749-2760 (1994)]. Corl chromosomal staining appears when the axial elements begin to form between the sister chromatids of each homolog in leptonema of meiotic prophase, prior to the initiation of synapsis. As homologous bivalents synapse, the axial elements from the two homologs align and a central element forms between them, completing the structure called the synaptonemal complex (SC). When short stretches of Cor1 begin to appear prior to any evidence of synapsis, neither ATR nor ATM is detectable. As homologs start synapsis, both proteins were seen at pairing forks; however, the location and behavior of the two proteins differed markedly. In normal zygotene nuclei, the stage during which homologs synapse, ATR was present in small amounts and transiently at discrete foci along the asynapsed (unpaired) axes. As homologs synapse, ATR disappeared from these locations. However, at regions delayed in synapsis, often seen near the proximal ends of autosomal bivalents, there was an accumulation of ATR foci along the unsynapsed axes. ATR was detected at similar locations on the two axial elements. In nuclei where an entire autosome fails to find its homologous pairing partner, ATR foci were detected along the entire lengths of these asynapsed axis. In males, where the X chromosome has no homolog, ATR foci were localized along the unpaired axis.

ATM was also visualized as foci and was first detected during zygonema as homologs synapse, but ATM localization was different than ATR.

ATM was first observed along synapsed axes when homologous autosomal axial elements come into contact. However, during mid-pachynema, after autosomal synapsis has been completed, ATM foci appeared on the X chromosome axis. ATM localization persisted on fully synapsed bivalents into pachynema, a substage that lasts 3 days in mouse oocytes and 6 days in mouse spermatocytes. During pachynema, the number of foci drops gradually, stabilizing briefly in mid-pachynema before eventually disappearing mid-to late pachynema. Thus, ATR and ATM protein kinases play important and complementary roles at distinct stages in meiosis I.

The involvement of ATR appears to be transient during early meiotic prophase while the role ofATM appears to be more prolonged. However, both ATR and ATM coordinate the various events of meiotic prophase by performing similar checkpoint functions.

The foregoing illustrative examples relate to presently preferred embodiments of the invention and numerous modifications and variations thereof are expected to occur to those skilled in the art. Thus only such limitations as appear in the appended claims should be placed upon the scope of the present invention.

.

Claims

CLAIMS We claim:

1 . A purified and isolated polynucleotide comprising a polynucleotide encoding the PIK-related kinase MCCS1α amino acid sequence set out in SEQ ID NO: 31 .

2. A purified and isolated polynucleotide comprising a polynucleotide encoding the PIK-related kinase MCCS1 β amino acid sequence set out in SEQ ID NO: 33.

3. The polynucleotide of claim 1 or 2 which is a DNA.

4. The DNA of claim 3 which is a cDNA.

5. A MCCS1α cDNA consisting of the DNA sequence set out in SEQ ID NO: 30.

6. A MCCS 1/5 DNA consisting of the DNA sequence set out in SEQ ID NO: 32.

7. The DNA of claim 3 which is a genomic DNA.

8. An RNA transcript of the DNA of claim 3.

9. The DNA of claim 3 which is a wholly or partially chemically synthesized DNA.

10. A DNA comprising a DNA encoding a full length mammalian MCCS1 kinase selected from the group consisting of:

a) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 30;

b) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 3; and

c) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 32.

1 1. A vector comprising a DNA according to claim 3 or 10.

12. The vector of claim 1 1 wherein said DNA is operatively linked to an expression control DNA sequence.

13. A host cell stably transformed or transfected with a DNA according to claim 3 or 10 in a manner allowing the expression in said host cell of the MCCS1 kinase.

14. A method for producing the PIK-related kinase MCCS1 , said method comprising growing a host cell according to claim 1 1 in a suitable nutrient medium and isolating the MCCS1 kinase from said cell or the medium of its growth.

15. A purified and isolated polypeptide comprising the PIK-related kinase MCCS1 α amino acid sequence consisting of SEQ ID NO: 31.

16. A purified and isolated polypeptide comprising the PIK-related kinase MCCS1β amino acid sequence consisting of SEQ ID NO: 33.

17. A polypeptide or peptide capable of specifically binding to PIK-related kinase MCCS1.

18. An antibody product according to claim 17.

19. A monoclonal antibody according to claim 18.

20. A hybridoma cell line producing a monoclonal antibody according to claim 19.

21. An assay for identifying modulators of MCCS1 kinase activity comprising the steps of:

a) incubating a MCCS1 kinase preparation in kinase buffer with gamma-³²P-ATP and an exogenous kinase substrate in the presence and absence of a test compound, and

b) measuring the moles of phosphate transferred to said substrate; wherein an increase in the moles of ³²P-phosphate transferred to said substrate in presence of said test compound compared to the moles of ³²P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an activator of said MCCS1 kinase and a decrease in the moles of ³²P-phosphate transferred to said substrate in presence of said test compound compared to the moles of ³²P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an inhibitor of said MCCS1 kinase.

22. The hybridoma cell line 224C.

23. The hybridoma cell line 224F.

24. A method of identifying a compound that inhibits MCCS 1 comprising the steps of:

a) expressing MCCS1 in a genetically altered cell, thereby decreasing the sensitivity of the cell to DNA damage, said sensitivity being associated with the genetic alteration;

b) exposing the genetically altered cell of step (a) to DNA damaging treatment in the presence and absence of a test modulator compound;

c) measuring the sensitivity of the cell to DNA damage; and d) identifying a test compound that restores the sensitivity of the cell to DNA damage as an inhibitor of MCCS1 activity.

25. A method of identifying a compound that inhibits ATM comprising the steps of:

a) expressing ATM in a genetically altered cell, thereby decreasing the sensitivity of the cell to DNA damage, said sensitivity being associated with the genetic alteration;

b) exposing the genetically altered cell of step (a) to DNA damaging treatment in the presence and absence of a test modulator compound;

c) measuring the sensitivity of the cell to DNA damage; and d) identifying a test compound that restores the sensitivity of the cell to DNA damage as an inhibitor of ATM activity.

26. An assay for identifying modulators of ATM kinase activity comprising the steps of:

a) incubating a ATM kinase preparation in kinase buffer with gamma-³²P-ATP and an exogenous kinase substrate in the presence and absence of a test compound, and

b) measuring the moles of phosphate transferred to said substrate; wherein an increase in the moles of ³²P-phosphate transferred to said substrate in presence of said test compound compared to the moles of ³²P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an activator of said ATM kinase and a decrease in the moles of ³²P-phosphate transferred to said substrate in presence of said test compound compared to the moles of ³²P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an inhibitor of said ATM kinase.