WO1992004470A1 - Electrochemical denaturation of double-stranded nucleic acid - Google Patents
Electrochemical denaturation of double-stranded nucleic acid Download PDFInfo
- Publication number
- WO1992004470A1 WO1992004470A1 PCT/GB1991/001563 GB9101563W WO9204470A1 WO 1992004470 A1 WO1992004470 A1 WO 1992004470A1 GB 9101563 W GB9101563 W GB 9101563W WO 9204470 A1 WO9204470 A1 WO 9204470A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- electrode
- dna
- denaturation
- probe
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6862—Ligase chain reaction [LCR]
Definitions
- This invention relates to processes for the treatment of nucleic acid material in order to effect a complete or partial change from double stranded form to single stranded form and to processes of amplifying or detecting nucleic -ids involving such cenaturation processes.
- Double str ⁇ .-ded DNA (deoxyribonucleic acid) and DNA/RNA [ ribonucleic acid) and RNA/RNA complexes in the familiar double helical configuration are stable molecules that, in vitro , require aggressive conditions to separate the complementary strands of the nucleic acid.
- Known methods that are commonly employed for strand separation require the use of high temperatures of at least 60° Celsius and often 100° Celsius for extended periods of ten minutes or more or use an alkaline pH of 11 or higher.
- Other methods include the use of helicase enzymes such as Rep protein of E. coli that can catalyse the unwinding of the DNA in an unknown way, or binding proteins such as 32-protein of E. coli phage T4 that act to stabilise the single stranded form of DNA.
- the denatured single stranded DNA produced by the known processes of heat or alkali is used commonly for hybridisation studies or is subjected to amplification cycles.
- US Patent No 4683202 discloses a process for amplifying and detecting a target nucleic acid sequence contained in a nucleic acid or mixture thereof by separating the complementary strands of the nucleic acid, hybridising with specific oligonucleotide primers, extending the primers with a polymerase to form complementary primer extension products and then using hose extension products for the further synthesis of the desired nucleic acid sequence by allowing hybridisation with the specific oligonucleotides primers to take place again.
- the process can be carried out repetitively to generate large quantities of the required nucleic acid sequence from even a single molecule of the starting material.
- Separation of the complementary strands of the nucleic acid is achieved preferably by thermal denaturation in successive cycles, since only the thermal process offers simple reversibility of the denaturation process to reform the double stranded nucleic acid, in order to continue the amplification cycle.
- the need for thermal cycling of the reaction mixture limits the speed at which the multiplication process can be carried out owing to the slowness of typical heating and cooling systems. It also requires the use of special heat resistant polymerase enzymes from thermophilic organisms for the primer extension step if the continuous addition of heat labile enzyme is to be avoided.
- thermophilic polymerases in use today have a lower fidelity ie. make more errors in copying DNA than do enzymes from mesophiles. It is also the case that thermophilic enzymes such as TAQ polymerase have a lower turnover number than heat labile enzymes such as the Klenow polymerase from E. coli .
- N. L. Palacek discloses the electrochemical reduction of adenine and cytosine in thermally denatured single stranded DNA at about -(minus) 1.5V on the surface of a mercury electrode. This reduction process also requires a prior protonation and therefore takes place at a pH below 7.0. The primary reduction sites of adenine and cytosine form part of the hydrogen bonds in the Watson-Crick base pairs.
- Palacek was unable to demonstrate reduction of adenine and cytosine in intact, native double stranded DNA at the mercury electrode.
- Palacek has further demonstrated that to a very limited extent the DNA double helix is opened on the surface of the mercury electrode at a narrow range of potentials centred at -(minus)1.2 V in a slow process involving an appreciable part of the DNA molecule.
- This change in the helical structure of the DNA is thought to be due to prolonged interacr.on with the electrode charged to certain potentials and is not thought to be a process involving electron transfer to the DNA. No accumulation of single stranded DNA in the working solution was obtained and no practical utility fcr the phenomenon was suggested.
- the mechanism of opening of the helix is postulated to be anchoring of the polynucleotide chain via the hydrophobic bases to the electrode surface after which the negatively charged phosphate residues of the DNA are strongly repelled from the electrode surface at an applied potential close to -(minus)1.2 V, the strand separation being brought about as a result of the electric field provided by the cathode.
- the nucleotide base sequence of the DNA on the electrode is accessible from solution.
- the bases themselves are tightly bound to the mercury surface.
- a mercury electrode is a complex system and the electrode can only be operated in the research laboratory with trained technical staff.
- H W Nurnberg discloses partial helix opening of adsorbed regions of native DNA to a mercury electrode surface to form a so-called ladder structure.
- the DNA is effectively inseparably bound- to or adsorbed onto the electrode surface.
- the denatured DNA is of no use for any subsequent process of amplification or hybridisation analysis.
- the denatured DNA must be accessible to subsequent processes and this is conveniently achieved if the single stranded DNA is available in free solution or is associated with the electrode in some way but remains accessible to further processes.
- the present invention provides a process for denaturing double-stranded nucleic acid which comprises operating on solution containing nucleic acid with an electrode under conditions such as to convert a substantial portion of said nucleic acid to a wholly or partially single stranded form.
- the process is found to be readily reversible.
- polymerase chain reaction processes exemplified hereafter, it is shown that the denatured DNA produced by the denaturing process of the invention is immediately in a suitable state for primer hybridisation and extension.
- samples of denatured DNA produced using a negative voltage electrode can be caused or encouraged to renature by reversal of the voltage or by incubation at a higher temperature to encourage reannealing.
- the single stranded nucleic acid produced is free from the electrode, e.g. in solution.
- the nucleic acid may be immobilised on the electrode in double or single stranded form prior to the application of the electric potential, e.g. attached by the end or a small portion intermediate the ends of the nucleic acid chain, so as to leave substantial segments of the nucleic acid molecules freely pendant from the electrode surface before and after denaturation.
- a potential of from -0.5 to -1.5 V is applied to said working electrode with respect to the solution, more preferably from -0.8 to -1.1 V, e.g. about -1.0 V.
- Working electrode voltages are given throughout as if measured or as actually measured relative to a calomel reference electrode (BDH No. 309.1030.02).
- a reference electrode may be contacted with said solution and a voltage may be applied between said electrode and said counter-electrode so as to achieve a desired controlled voltage between said electrode and said reference electrode.
- the electrodes may be connected by a potentiostat circuit as is known in the electrochemical art.
- the ionic strength of said solution is preferably no more than 250 mM, more preferably no more than 100 mM. As it has been found that the rate of denaturation increases as the ionic strength is decreased, the said ionic strength is still more preferably no more than 50 mM, e.g. no more than 25 mM or even no more than 5 mM. Generally, the lower the ionic strength, the more rapid is the denaturation. However, in calculating ionic strength for these purposes it may be appropriate to ignore the contribution to ionic strength of any component which acts as a promoter as described below.
- the solution ma" contain or the electrode may have on its surface a promoter cuu.pound which assists said denaturation.
- the invented process can t 2 place in a solution containing only the electrode and tue nucleic acid dissolved in water optionally containing a suitable buffer, the process can be facilitated by the presence in the solution containing the nucleic acid of such a promoter compound.
- the compound may act as a promoter serving either to destabilise the double-stranded nucleic acid, for instance by interca ' ⁇ tion into the double helix, or to stabilise the single- randed form, or else to facilitate interaction between the electrode surface and the nucleic acid.
- the promoter may be any inorganic or organic molecule which increases the rate or extent of denaturation of the DNA double helix. It should be soluble in the chosen solvent. It preferably does not affect or interfere with DNA or other materials (such as enzymes or oligonucleot: - probes ) which may be present in the solution. Alternati " r the promoter may be immobilised to or included in the material from which the electrode is constructed.
- the promoter may be a water soluble compound of the bipyridyl series, especially a viologen such as methyl viologen or a salt thereof.
- the positively charged viologen molecules interact between the r jatively charged DNA and the negatively charged cathode to reuuce electrostatic repulsion therebetween and hence to promote the approach of the DNA to the electrode surface where the electrical field is at its strongest.
- promoters compounds having spaced positively charged centres, e.g. bipolar positively charged compounds.
- the spacing between the positively charged centres is similar to that in viologens.
- suitable viologens include ethyl viologen isopropyl viologen and benzyl viologen.
- the process may be carried out in an electrochemical cell of the type described by C. J. Stanley, M. Cardosi and A.P.F Turner "Amperometric Enzyme Amplified Immunoassays" J. Immunol. Meth (1988) 112, 153-161 in which there is a working electrode, a counter electrode and optionally a reference electrode.
- the working electrode at or by which the denaturing nucleic acid is effected may be of any convenient material e.g. a noble metal such as gold or platinum, or a glassy carbon electrode.
- the electrode may be a so called "modified electrode” in which the denaturing is promoted by a compound coated onto, or adsorbed onto, or incorporated into the structure of the electrode which is otherwise of an inert but conducting material.
- the working, counter and reference electrodes may be formed on a single surface e.g. a flat surface by any printing method such as thick film screen printing, ink jet printing, or by using a photo-resist followed by etching. It is also possible that the working and reference electrodes can be combined on the flat surface leading to a two electrode configuration where the reference also acts as the counter.
- the electrodes may be formed on the inside surface of a well which is adapted to hold liquid, such a well could be the well known 96 well or Microtitre plate, it may also be a test tube or other vessel. Electrode arrays in Microtitre plates or other moulded or thermoformed plastic materials may be provided for multiple nucleic acid denaturation experiments.
- the strand separation may be carried out in an aqueous medium or in a mixture of water with an organic solvent such as dimethylformamide.
- the use of polar solvents other than water or non-polar solvents is also acceptable but is not preferred.
- the process may be carried out at ambient temperatures or if desired temperatures up to adjacent the pre-melting temperature of the nucleic acid.
- the process may be carried out at pH's of from 3 to 10 conveniently about 7. Generally, more rapid denaturation is obtained at lower pH. For some purposes therefore a pH somewhat b- low neutral, e.g about pH 5.5 may be preferred.
- the nucleic acid may be dissolved in an aqueous solution containing a buffer whose nature and ionic strength are such as not to interfere with the strand separation process.
- the denaturing process according to the invention may be incorporated as a step in a number of more complex processes, e.g. procedures involving the analysis and or the amplification of nucleic acid. Some examples of such applications are described below.
- the invention includes a process for detecting the presence or absence of a predetermined nucleic acid sequence in a sample which comprises: denaturing a sample double- stranded nucleic acid by means of a voltage applied to the sample in a " "lution by means of a" electrode; hybridising -he denatured nucleic acid with an o __.gonucleotide probe for the sequence; and determining whether the said hybridisation has occurred.
- the invented process has application in DNA and RNA hybridisation where a specific gene sequence is ' to be identified e.g. specific to a particular organism or specific to a particular hereditary disease of which sickle cell anaemia is an example.
- telomere sequence To detect a specific sequence it is first necessary to prepare a sample of DNA, preferably of purified DNA, means for which are known, which is in native double stranded form. It is then necessary to convert the double stranded DNA to single stranded form before a hybridisation step with a labelled nucleotide probe which has a complementary sequence to the DNA sample can take place.
- the denaturation process of the invention can be used for this purpose in a preferred manner by carrying out the following steps: denaturing a sample of DNA by applying a voltage by means of an electrode to the sample DNA with optionally a promoter in solution or bound to or part of the structure of the electrode; hybridising the denatured DNA with a directly labelled or indirectly labelled nucleotide probe complementary to the sequence of interest; and - determining whether the hybridisation has occurred, which determination may be by detecting the presence of the probe, the probe being directly radio-labelled, fluorescent labelled, chemiluminescent labelled or enzyme-labelled or being an indirectly labelled probe which carries biotin for example to which a labelled avidin or avidin type molecule can be bound later.
- a typical DNA probe assay it is customary to immobilise the sample DNA to a membrane surface which may be composed of neutral or charged nylon or nitrocellulose.
- the immobilisation is achieved by charge interactions or by baking the membrane containing DNA in an oven.
- the sample DNA can be heated to high temperature to ensure conversion to single stranded form before binding to the membrane or it can be treated with alkali once on the membrane to ensure conversion to the single stranded form.
- the disadvantages of the present methods are: heating to high temperatures to create single stranded DNA can cause damage to the sample DNA itself. - the use of alkali requires an additional step of neutralisation before hybridisation with the labelled probe can take place.
- One improved method for carrying out DNA probe hybridisation assays is the so called "sandwich” technique where a specific oligonucleotide is immobilised on a surface.
- the surface having the specific oligonucleotide thereon is then hybridised with a solution containing the target DNA in a single-stranded form, after which a second labelled oligonucleotide is then added which also hybridises to the target DNA.
- the surface is then washed to remove unbound labelled oligonucleotide, after which any label which has become bound to target DNA on the surface can be detected later.
- This procedure can be simplified by using the denaturing process of the invention to denature the double-stranded DNA into the required single-stranded DNA.
- the working electrode, counter electrode and optionally a reference electrode and/or a promoter can be incorporated into a test tube or a well in which the DNA probe assay is to be carried out.
- the DNA sample and oligonucleotide probes can then be added and the voltage applied to denature the DNA.
- the resulting single-stranded DNA is hybridised with the specific oligonucleotide immobilised on the surface after which the remaining stages of a sandwich assay are carried out. All the above steps can take place without a need for high temperatures or addition of alkali reagents as in the conventional process.
- the electrochemical denaturation of DNA can be used in the amplification of nucleic acids, e.g. in a polymerase chain reaction or ligase chain reaction amplification procedure.
- the present invention provides a process for replicating a nucleic acid which comprises: separating the strands of a sample double stranded nucleic acid in solution under the influence of an electrical voltage applied to the solution from an electrode; hybridising the separated strands of the nucleic acid with at least one oligonucleotide primer that hybridises with at least one of the strands of the denatured nucleic acid; synthesising an extension product of the or each primer which is sufficiently complementary to the respective strand of the nucleic acid to hybridise therewith; and separating the or each extension product from the nucleic acid strand with which it is hybridised to obtain the extension product.
- a polymerase mediated replication procedure e.g. a polymerase chain reaction procedure
- Once the primer is in position on a first of the target strands rehybridisation of the target strands in the primer region will be prevented and the other target strand may be progressively displaced by extension of the primer or by further temporary weakening or separation processes.
- the said amplification process further comprises repeating the procedure defined above cyclicly, e.g. for more than 10 cycles, e.g. up to 20 or 30 cycles.
- the hybridisation step is preferably carried out using two primers which are complementary to different strands of the nucleic acid.
- the denaturation to obtain the extension products as well as the original denaturing of the target nucleic acid is preferably carried out by applying to the solution of the nucleic acid a voltage from an electrode.
- the process may be a standard or classical PCR process for amplifying at least one specific nucleic acid sequence contained in a nucleic acid or a mixture of nucleic acids wherein each nucleic acid consists of two separate complementary strands, of equal or unequal length, which process comprises:
- step (c) treating the single-stranded molecules generated from step (b) with the primers of step (a) under conditions such that a primer extension product is synthesised using each of the single strands produced in step (b) as a template.
- the process may be any variant of the classical or standard PCR process, e.g. the so-called “inverted” or “inverse” PCR process or the "anchored” PCR process.
- the invention therefore includes an amplification process as described above in which a primer is hybridised to a circular nucleic acid and is extended to form a duplex which is denatured by the denaturing process of the invention, the amplification process optionally being repeated through one or more additional cycles.
- the invention includes a process for amplifying a target sequence of nucleic acid comprising hybridisation, amplification and denaturation of nucleic acid (e.g. cycles of hybridising and denaturing) wherein said denaturation is produced by operating on a solution containing said nucleic acid with an electrode.
- the process of the invention is applicable to the ligase chain reaction. Accordingly, the invention includes a process for amplifying a target nucleic acid comprising the steps of:
- the first and second of said probes are primary probes, and the third and fourth of said probes are secondary nucleic acid probes; ii) the first probe is a single strand capable of hybridising to a first segment of a primary strand of the target nucleic acid; iii) the second probe is a single strand capable of hybridising to a second segment of said primary strand of the target nucleic acid; iv) the 5' end of the first segment of said primary strand of the target is positioned relative to the 3 ' end of the second segment of said primary strand of the target to enable joining of the 3' end of the first probe to the 5' end of the second probe, when said probes are hybridised to said primary strand of said target nucleic acid; v) the third probe is capable of hybridising to the first probe; and iv) the fourth probe is capable of hybridising to the second probe; and (c) repeatedly or continuously: i)
- the denaturation of the DNA to allow subsequent hybridisation with the primers can be carried out by the application of an appropriate potential to the electrode.
- the process may be carried out stepwise involving successive cycles of denaturation or renaturation as in the existing thermal methods of PCR and LCR, but it is also possible for it to be carried out continuously since the process of chain extension or ligation by the enzyme and subsequent strand separation by the electrochemical process can continue in the same reaction as nucleic acid molecules in single-stranded form will be free to hybridise with primers once they leave the denaturing influence of the electrode.
- the primer will hybridise with the DNA an extension or ligation product will be synthesised.
- the electrochemical DNA amplification technique can be used analytically to detect and analyse a very small sample of DNA eg a single copy gene in an animal cell or a single cell of a bacterium.
- the invention includes a kit for use in a process of detecting the presence or absence of a predetermined nucleic acid sequence in a sample which kit comprises, an electrode, a counter electrode and optionally a reference electrode, and an oligonucleotide probe for said sequence.
- the probe may be labelled in any of the ways discussed above.
- the invention also includes a kit for use in a process of nucleic acid amplification compr. ing an electrode, a counter electrode and optionally a reference electrode, and at least one primer for use in a PCR procedure, or at least one primer for use in an LCR procedure, and/or a polymerase or a ligase, and/or nucleotides suitable for use in a PCR process.
- kits includes a cell containing the electrodes.
- the kits include a suitable buffer for use in the detection or amplification procedure.
- Figure 1 is a diagram of an electrochemical cell used for denaturation of DNA
- Figure 2 is a drawing of an electropnoresis gel showing the movement of single and double stranded DNA
- Figure 3 i. c a diagram of a electrophoresis gel showing the electrical denaturation of calf thymus DNA in the absence of any promoter such as methyl viologen;
- Figure 4 is a diagram of a electrophoresis gel " showing the renaturation of denatured calf thymus DNA
- Figure 5 is a drawing of an electrophoresis gel showing the time course of the thermal denaturation of linear double stranded DNA from the bacteriophage M13;
- Figure 6 is a drawing of an electrophoresis gel showing the time course of the electrical denaturation of linear M13 DNA
- Figure 7 is a drawing of an electrophoresis gel showing a comparison of a thermally amplified segment of M13 with an equivalent electrically amplified segment of M13 in the presence of methyl viologen;
- Figure 8 is a drawing of an electrophoresis gel showing a comparison of a thermally amplified segment of M13 with an equivalent electrically amplified segment in the absence of methyl viologen.
- Figure 9 is a drawing of an electrophoresis gel showing a fragment of 'bluescript' DNA amplified using electrical PCR in the presence of methyl viologen; and Figure 10 is a drawing of an electrophoresis gel showing amplified fragments of two 'bluescript' DNA's produced by electrical PCR in the absence of methyl viologen.
- FIG. 1 there is shown a cell structure 10 comprising a working compartment 12 in which there is a body of DNA-containing solution, a working electrode 14, a counter electrode 16, a FiVac seal 19, a Kwik fit adaptor 21 and a magnetic stirrer 18.
- a reference electrode 20 in a separate side arm is connected via a "luggin" capillary 23 to the solution in the sample 12.
- the working electrode, counter electrode and reference electrode are connected together in a potentiostat arrangement so that a constant voltage is maintained between the working electrode 14 and the reference electrode 20.
- potentiostat arrangements are well known (see for example "Instrumental Methods in Electrochemistry” by the Victoria Electrochemistry Group, 1985, John Wiley and Sons, p 19) .
- the electrode 14 is a circular glassy carbon rod of diameter 0.5 cm, narrowing to 0.25 cm at a height of lOmM, and having an overall length of 9 cm inside a teflon sleeve of outside diameter 0.8cm (supplied by Oxford Electrodes, 18 Alexander Place, Abingdon, Oxon), and the reference electrode 16 is a 2 mm pin calomel (supplied by BDH No 309/1030/02).
- the counter electrode is supported by a wire which is soldered to a brass sleeve 25 above the adaptor and passes down and exits the teflon sleeve 20 mm from the base of the working electrode.
- the wire attaches to a cylindrical platinum mesh counter-electrode supplied by Oxford Electrodes which annularly surrounds the working electrode.
- EXAMPLE 1 In this example of DNA denaturation, the two met- is of thermal and electrical denaturation have been compare*-. To achieve electrical denaturation, 1.60 ml of a solution of methyl viologen dichloride at lmg/ml in distilled water (adjusted to pH 7 by titration with 0.1 M sodium hydroxide) was added to the working compartment of the electrochemical cell described above. The reference arm of the cell in which the reference electrode 20 resides contained 0.4 ml of this solution.
- the total ionic strength of the solution was calculated to be approximately 5 mM.
- a voltage of -(minus )1.0 V was applied between the working electrode and the reference electrode.
- the electrochemical cell was left for 16 hour ⁇ t room temperature (22°C) with continuous gentle stirring. On applying the potential to the working electrode 14 the blue colour of reduced methyl viologen was observed in the immediate vicinity of the working electrode.
- the DNA solution at 1 mg/ml in distilled water was heated to 100°C for 10 minutes in a boiling water bath.
- the tube containing the thermally denatured DNA was then removed from the water bath and placed immediately into a beaker containing an ice/water mix to ensure rapid cooling to prevent renaturation of the sample back to the double stranded form.
- a 100 ⁇ l sample of the thermally denatured DNA solution was prepared for gel electrophoresis by mixture with 20 ⁇ l of gel loading buffer which contained 0.25% (w/v) bromophenol blue, 0.25 % (w/v) xylene cyanol and 30 % (w/v) glycerol.
- Native intact calf thymus DNA was also prepared for gel electrophoresis by mixing 100 ⁇ l of the starting solution of DNA (before thermal or denaturation) with 20 ⁇ l of gel loading buffer and stored on ice until required.
- the gel (a section of which is shown in Figure 2) had a number of wells 30 into which the samples could be loaded, and 10 ⁇ l samples were placed into individual wells.
- the gel had a total volume of 50 ml and was 10 cm wide and 75 cm long; it was 0.5 % (w/v) agarose in 0.089 M tris buffer pH 8.0 containing 0.1 M borate and 0.01 M sodium EDTA.
- the gel was run for 85 minutes at an applied constant voltage of 55 volts using a power supply from Pharmacia No 500/400.
- the gel was then removed from the electrophoresis apparatus and stained by addition of Q.75 ml of ethidium bromide (Pharmacia No 1840- 501, lot 9503860E) at 20 ⁇ g/ml in distilled water. After staining for 30 minutes the gel was washed in distilled water.
- Q.75 ml of ethidium bromide Pharmacia No 1840- 501, lot 9503860E
- the stained gel was trans-illuminated with ultraviolet light and then photographed with a Polaroid instant camera system using a red filter to reduce background from the UV source.
- the gel shown in Figure 1 has samples A, B and C.
- Sample A was the starting material used in the test (calf thymus DNA).
- Sample B was a sample of calf thymus DNA which had been electrically denatured according to the invention and sample C was a sample of thermally denatured DNA.
- the DNA stain ethidium bromide becomes fluorescent when it intercalates into the double helical structure of intact native DNA. Hence it can be used to identify the double stranded DNA in Figure 1. As the DNA is denatured it becomes progressively single stranded and the efficiency of staining with ethidium bromide decreases.
- Example 1 was repeated as before, but DNA samples were taken after 15 minutes, 3 hours and 22 hours treatment in the electrochemical cell in order to provide a time course of the denaturation of the DNA.
- the potentiostat was switched to a dummy cell represented by a resistor.
- a gradual progressive denaturation of the DNA into the faster migr ⁇ ing form on the gel was observed.
- the gel pattern after 15 minutes (not shown) is interpreted to represent a mixture of partially and fully denatured " DNA but no evidence of wholly native DNA was seen, a ⁇ in later samples the proportion of fully denatured DNA continue ' to increase.
- EXAMPLE 3 EXAMPLE 3
- Figure 3 shows the results of an electrical DNA denaturation carried out according to the methods described above but without the inclusion of the methyl viologen promoter.
- the ionic strength was less than 1 mM and the calf thymus DNA concentration was 70 ⁇ g/ml.
- the electrochemical cell was left for a total of 20 hours at ambient temperature (22°C) with continuous gentle stirring at a potential of - (minus) 1.0 V on the working electrode. Samples were taken from the cell at 1 hour, 3 hours and 4 hours as well as at the end of the procedure. During the sampling of the DNA solution from the cell the potentiostat was switched to a dummy cell represented by a resistor in order to avoid current surges.
- the voltage at the working electrode was reversed to +(plus)l V and treatment of the DNA solution in the electrochemical cell proceeded for a further 25 hours. After this second time period 100 ⁇ l of the DNA solution was removed from the cell and stored on ice. Each of the 4 100 ⁇ l samples was mixed with 20 ⁇ l of gel loading buffer described above and stored on ice until required for electrophoresis.
- Figure 4 is an agarose gel run exactly as described above showing the four DNA samples; A is the starting intact calf thymus material, B is the electrically denatured material, C is the electrically denatured and subsequently electrically renatured material, D is the electrically denatured material which was subsequently thermally renatured. It can be seen from the gel that both the electrically denatured thermally renatured and electrically denatured electrically renatured DNA returns to the original mobility of the double stranded starting material.
- EXAMPLE 7 This example illustrates that a bacteriophage genome can be electrically denatured to a single stranded form in a manner analogous to the thermal method.
- M13 Bacteriophage M13 (M13mpl8RFl Double stranded form supplied by CP Laboratories, PO Box 22, Bishop's Stortford, Herts, UK) was employed. M13 is in circular form which can adopt a number of different coiled and supercoiled configurations. This leads to a complex set of bands on the agarose electrophoresis gel. Therefore the gel pattern was simplified to a single band by subjecting M13 to a restriction digest with the enzyme BqL I, which has only one restriction site on the Ml3 genome.
- the pellet was washed with 0.15 ml of 70% (v/v) ethanol and collected again by centrifugation. Finally the pellet was dried under vacuum for 15 minutes and resuspended in 100 ⁇ l of distilled water.
- the linearised M13 DNA was then subjected to both thermal and electrical denaturation.
- a series of tubes was set up. The series of 6 tubes contained 1 ⁇ l M13 DNA with 4 ⁇ l of distilled water. One tube was placed on ice, and the other tubes were heated for 2,4,6,8,10 minutes in a boiling water bath. After a brief period of centrifugation the tubes were placed on ice (to prevent renaturation of the thermally denatured DNA) . To each tube 1 ⁇ l of gel loading buffer was added. Before being loaded and subsequently run on a 1% agarose gel at 100 mA for 1 hour each tube was briefly vortexed.
- Figure 5 shows the results from this thermal denaturation.
- Track A is the starting material (0 minutes at 100°C)
- Track B is 2 minutes at 100°C
- Track C is 6 minutes at 100°C.
- frc:_ the gel as it denatures to single stranded form which does not bind ethidium bromide stain with high efficiency.
- a faint smear remains on the gel with a higher mobility than native double stranded DNA and this may be the very faintly stained single stranded material.
- 920 ⁇ l of distilled water was added to an electrochemical cell as illustrated in Figure 1.
- 30 ⁇ l of a 100 mg/ml solution of methyl viologen in distilled water was added along with 50 ⁇ l of linearised M13 to the electrochemical cell. The solution was then mixed gently using the stirring bar.
- Figure 6 shows the time course of the electrical denaturation of M13. Track A is the starting material, Track B is after 5 minutes, Track C is after 15 minutes. The gel shows the loss of the double stranded DNA structure which has disappeared by 15 minutes and the appearance of the faintly stained single stranded smear.
- Figure 7 shows the results from an electrochemical cell polymerase chain reaction (PCR) carried out in the presence of the promoter methyl viologen.
- Reagents were then adde to the cell, with the stirrer bar still stirring, namely b ⁇ l of primer (M13 Sequencing primer (-47)24 mer 5 ' ( CGCCAGGGTTTTCCCAGTCACGAC)3 ' supplied by ALTA Biosciences, University of Birmingham, UK as a 5 ⁇ g lyophilised powder) at a final concentration of 78 pmol, 6 ⁇ l of reverse primer M13 Reverse Sequencing primer (-24)16mer 5 'd(AACAGTCATGACCATTG)3 ' supplied as a 5 ⁇ g lyophilised powder) at a final concentration of 78 pmol, 13 ⁇ l of dec *cynucleotide triphosphate mix (each dNTP present at a final concentration of 26 ⁇ m, supplied by Pharmacia Ltd., Midsummer Boulevard, Milton Keynes, UK), 4 ⁇ l, buffer mix (at final concentration of 6.6 mM Tris HCl pH8, 1 mM MgCl 2
- the working/counter electrode was replaced and the second cycle of the polymerase chain reaction started by -(minus) 1 V being applied for 5 minutes and it was observed that the reduced form of the promoter methyl viologen was produced and accumulated such that all the liquid became blue. Then the potentiostat was switched to dummy. The working/counter electrode was removed from the cell and the solution left stirring for 3 minutes and it was observed that the blue colour rapidly disappeared during this period.
- Reagents were then added to the cell, with A stirrer bar still stirring, i.e. 13 ⁇ l of deoxynucleotide triphosphate mix (details as above) and then 2.5 ⁇ l of Klenow DNA polymerase (details as above). There was then a 7 minute incubation, with gentle stirring for the first 1 minute and no stirring for the next 6 minutes.
- the second cycle was repeated as third to tenth cycles, omitting the adding of reagents at the end of the tenth cycle.
- a sample was taken from the working compartment of the cell (750 ⁇ l) and it was split into sub-samples for ease of processing (3 x 250 ⁇ l), then to each tube was added 50 ⁇ l 1 M Magnesium Chloride, 98 ⁇ l 3 M Sodium Acetate and 500 ⁇ l 100% Ethanol.
- the samples were frozen on dry ice for 20 minutes and then after thawing centrifuged for 15 minutes to obtain a pellet. The pellet was washed with 250 ⁇ l of 70% ethanol and centrifuged as described before.
- the pellet was dried under vacuum for 15 minutes and then the pellet in each tube was resuspended in 7 ⁇ l distilled water (pH not adjusted) and after extensive vortexing and leaving on ice, the contents of the 3 tubes pooled before running on a gel.
- lane A contains primers, these run faster on the gel than the thermally amplified 119 base pair fragment in lane B.
- Lanes C and D contain 5 ⁇ l and 15 ⁇ l, respectively, of electrically amplified product.
- high molecular weight M13 DNA is contained in the well, there is some smearing of DNA in the upper part of the gel, this is more pronounced in lane D.
- primers can be seen at the same mobility as in lane A, however in lane D extensive "flaring" of the primers is observed.
- the amplified product can be seen in both lanes C and D at the same mobility as the thermally amplified sample in lane B.
- FIG. 8 shows the results from an electrochemical cell polymerase chain reaction (PCR) experiment carried out in the absence of promoter.
- the method used was essentially the same as for Example 8 with promoter described above except that no promoter is added to the cell and all additions of primer and reverse primer were of 3 ⁇ l each (not 6 ⁇ l as described above) and the experiment ran for 15 cycles.
- lane A contains a thermally amplified 119bp product, lane B primers, and lane E stock M13 that is confined to the well due to its high molecular weight.
- Lanes C and D contain the product of electrical amplification.
- the 119 base pair amplified region is clearly visible at the same mobility on the gel as the thermally amplified product.
- the primers in lanes C and D run at the same mobility as lane B. The reduction of the amount of primers added in this experiment in comparison to the experiment illustrated in Figure 7 reduces the flaring effect in the gel.
- EXAMPLE 10 EXAMPLE 10
- SK 'Blue script' (Stratagene) is a circular 2,964 base pair vector. It contains a polylinker region which contains the M13 primer binding sites between which the target region of DNA amplified in Examples 8 and 9 is located.
- the denaturing, lag phase and reagent addition, annealing and extending step were repeated for 10 cycles, but in cycles 2-10 the denaturation step was for 5 minutes.
- Example 10 The procedure of Example 10 was repeated except that further restriction digests were performed to produce 20 ⁇ g of linear 3000 base pair bluescript DNA using Xmn 1, and 15 ⁇ g of 450 base pair blue script DNA using Pvu 2 (Stratagene). The electrical PCR amplification process was performed in the absence of methyl viologen. A lag phase was not necessary and was omitted.
- the polyacrylamide gel is shown in Figure 10.
- Lane A contains a 'ladder marker', a set of known DNA sizes, which is used to gauge the molecular weight of experimental samples.
- the tempia . ⁇ 450 base pa:_ ⁇ band can be clearly seen, as can an amplified band of 200 ⁇ _.ase pairs.
- Lane C contains the 3000 base pair linear electrically amplified 'blue script' DNA.
- the template DNA is confined to the well (as might be expected due to its 3000 base pair size) and an amplified band of 200 base pairs can clearly be seen.
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/617,675 US5824477A (en) | 1990-09-12 | 1996-04-01 | Electrochemical denaturation of double-stranded nucleic acid |
US09/568,622 US6395489B1 (en) | 1990-09-12 | 2000-05-10 | Electrochemical denaturation of double-stranded nucleic acid |
US10/122,139 US6613527B1 (en) | 1990-09-12 | 2002-04-15 | Electrochemical denaturation of double-stranded nucleic acid |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB9019946.4 | 1990-09-12 | ||
GB9019946A GB2247889A (en) | 1990-09-12 | 1990-09-12 | DNA denaturation by an electric potential |
GB9112911.4 | 1991-06-14 | ||
GB919112911A GB9112911D0 (en) | 1990-09-12 | 1991-06-14 | Treatment of nucleic acid material |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US3013893A Continuation | 1990-09-12 | 1993-03-12 | |
US08/288,231 Continuation US5527670A (en) | 1990-09-12 | 1994-08-09 | Electrochemical denaturation of double-stranded nucleic acid |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1992004470A1 true WO1992004470A1 (en) | 1992-03-19 |
Family
ID=26297644
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB1991/001563 WO1992004470A1 (en) | 1990-09-12 | 1991-09-12 | Electrochemical denaturation of double-stranded nucleic acid |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU8517391A (en) |
WO (1) | WO1992004470A1 (en) |
Cited By (41)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993015224A1 (en) * | 1992-01-23 | 1993-08-05 | Scientific Generics Limited | Electrochemical treatment of nucleic acid containing solutions |
WO1994029484A1 (en) * | 1993-06-09 | 1994-12-22 | Gamera Bioscience Corporation | Magnetic cycle reaction |
WO1995025177A1 (en) * | 1994-03-15 | 1995-09-21 | Scientific Generics Limited | Electrochemical denaturation of double-stranded nucleic acid |
US5605662A (en) * | 1993-11-01 | 1997-02-25 | Nanogen, Inc. | Active programmable electronic devices for molecular biological analysis and diagnostics |
US5653939A (en) * | 1991-11-19 | 1997-08-05 | Massachusetts Institute Of Technology | Optical and electrical methods and apparatus for molecule detection |
WO1997041219A1 (en) * | 1996-04-26 | 1997-11-06 | Scientific Generics Limited | Electrode capture of nucleic acid |
FR2749393A1 (en) * | 1996-05-31 | 1997-12-05 | Motorola Inc | ELECTRODE CONFIGURATION FOR MATRIX ADDRESSING OF A MOLECULAR DETECTION DEVICE |
WO1998000562A1 (en) * | 1996-07-02 | 1998-01-08 | Scientific Generics Limited | Denaturation of double-stranded nucleic acid |
WO1998002573A1 (en) * | 1996-07-11 | 1998-01-22 | Scientific Generics Limited | Denaturation of double-stranded nucleic acid |
WO1998044100A1 (en) * | 1997-04-02 | 1998-10-08 | Scientific Generics Limited | Disassociation of interacting molecules |
US5849486A (en) * | 1993-11-01 | 1998-12-15 | Nanogen, Inc. | Methods for hybridization analysis utilizing electrically controlled hybridization |
US5993611A (en) * | 1997-09-24 | 1999-11-30 | Sarnoff Corporation | Capacitive denaturation of nucleic acid |
US6017696A (en) * | 1993-11-01 | 2000-01-25 | Nanogen, Inc. | Methods for electronic stringency control for molecular biological analysis and diagnostics |
US6048690A (en) * | 1991-11-07 | 2000-04-11 | Nanogen, Inc. | Methods for electronic fluorescent perturbation for analysis and electronic perturbation catalysis for synthesis |
US6051380A (en) * | 1993-11-01 | 2000-04-18 | Nanogen, Inc. | Methods and procedures for molecular biological analysis and diagnostics |
US6068818A (en) * | 1993-11-01 | 2000-05-30 | Nanogen, Inc. | Multicomponent devices for molecular biological analysis and diagnostics |
US6254827B1 (en) | 1993-11-01 | 2001-07-03 | Nanogen, Inc. | Methods for fabricating multi-component devices for molecular biological analysis and diagnostics |
US6287517B1 (en) | 1993-11-01 | 2001-09-11 | Nanogen, Inc. | Laminated assembly for active bioelectronic devices |
US6300063B1 (en) | 1995-11-29 | 2001-10-09 | Affymetrix, Inc. | Polymorphism detection |
US6309602B1 (en) | 1993-11-01 | 2001-10-30 | Nanogen, Inc. | Stacked, reconfigurable system for electrophoretic transport of charged materials |
US6315953B1 (en) | 1993-11-01 | 2001-11-13 | Nanogen, Inc. | Devices for molecular biological analysis and diagnostics including waveguides |
US6319472B1 (en) | 1993-11-01 | 2001-11-20 | Nanogen, Inc. | System including functionally separated regions in electrophoretic system |
US6331274B1 (en) | 1993-11-01 | 2001-12-18 | Nanogen, Inc. | Advanced active circuits and devices for molecular biological analysis and diagnostics |
US6335161B1 (en) | 1995-08-25 | 2002-01-01 | Scientific Generics Limited | Release of intracellular material and the production therefrom of single stranded nucleic acid |
US6365400B1 (en) | 1990-09-12 | 2002-04-02 | Affymetrix, Inc. | Electrochemical denaturation of double-stranded nucleic acid |
US6375899B1 (en) | 1993-11-01 | 2002-04-23 | Nanogen, Inc. | Electrophoretic buss for transport of charged materials in a multi-chamber system |
US6403367B1 (en) | 1994-07-07 | 2002-06-11 | Nanogen, Inc. | Integrated portable biological detection system |
US6569382B1 (en) | 1991-11-07 | 2003-05-27 | Nanogen, Inc. | Methods apparatus for the electronic, homogeneous assembly and fabrication of devices |
US6582660B1 (en) | 1993-11-01 | 2003-06-24 | Nanogen, Inc. | Control system for active programmable electronic microbiology system |
US6706473B1 (en) | 1996-12-06 | 2004-03-16 | Nanogen, Inc. | Systems and devices for photoelectrophoretic transport and hybridization of oligonucleotides |
US6726880B1 (en) | 1993-11-01 | 2004-04-27 | Nanogen, Inc. | Electronic device for performing active biological operations and method of using same |
US6953663B1 (en) | 1995-11-29 | 2005-10-11 | Affymetrix, Inc. | Polymorphism detection |
US6969589B2 (en) | 2001-03-30 | 2005-11-29 | Perlegen Sciences, Inc. | Methods for genomic analysis |
US7101661B1 (en) | 1993-11-01 | 2006-09-05 | Nanogen, Inc. | Apparatus for active programmable matrix devices |
US7153955B2 (en) | 1997-09-22 | 2006-12-26 | Nanogen Recognomics Gmbh | Pentopyranosyl nucleic acid arrays, and uses thereof |
US7172864B1 (en) | 1993-11-01 | 2007-02-06 | Nanogen | Methods for electronically-controlled enzymatic reactions |
US7314708B1 (en) | 1998-08-04 | 2008-01-01 | Nanogen, Inc. | Method and apparatus for electronic synthesis of molecular structures |
WO2014072748A1 (en) * | 2012-11-12 | 2014-05-15 | The University Court Of The University Of Edinburgh | Electrochemical method for denaturing or hybridising nucleic acid molecules |
US9862984B2 (en) | 2006-04-21 | 2018-01-09 | Nanobiosym, Inc. | Single-molecule platform for drug discovery: methods and apparatuses for drug discovery, including discovery of anticancer and antiviral agents |
US10280392B2 (en) | 2013-03-14 | 2019-05-07 | The Regents Of The University Of California | Methods and devices for non-thermal polymerase chain reaction |
US10933417B2 (en) | 2013-03-15 | 2021-03-02 | Nanobiosym, Inc. | Systems and methods for mobile device analysis of nucleic acids and proteins |
-
1991
- 1991-09-12 WO PCT/GB1991/001563 patent/WO1992004470A1/en active Application Filing
- 1991-09-12 AU AU85173/91A patent/AU8517391A/en not_active Abandoned
Non-Patent Citations (5)
Title |
---|
BIOELECTROCHEMISTRY AND BIOENERGETICS vol. 156, no. 2-3, November 1983, LAUSANNE pages 245 - 255; V. BRABEC: 'Conformational changes in DNA induced by its adsorbtion at negativelly charged surfaces. The effect of base composition in DNA and the chemical nature of the adsorbent' see the whole document, esp. abstract and conclusions * |
BIOPHYSICAL CHEMISTRY vol. 4, no. 1, January 1976, AMSTERDAM pages 79 - 92; V. BRABEC ET AL.: 'Interaction of nucleic acids with electrically charged surfaces II. Conformational changes in double- helical polynucleotides' * |
BIOPHYSICS OF STRUCTURE AND MECHANISM vol. 1, no. 1, 1974, BERLIN pages 17 - 26; P. VALENTA ET AL.: 'The electrochemical behaviour of DNA at electrically charged interfaces' see page 23, line 26 - page 24, line 2 * |
JOURNAL OF ELECTROANALYTICAL CHEMISTRY AND INTERFACIAL ELECTROCHEMISTRY vol. 88, no. 3, 25 April 1978, LAUSANNE pages 373 - 385; V. BRABEC ET AL.: 'Interactions of nucleic acids with electrically charged surfaces. Part IV. Local changes in the structure of DNA adsorbed on mercury electrode in the vicinity of zero charge' SA 51317 030cited in the application see the whole document esp. abstract, page 383, line 30-page 385, line 15 * |
see abstract see page 80, left column, line 4 - line 13 see page 88, right column, line 4 - page 91, left column, line 14 * |
Cited By (67)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6395489B1 (en) | 1990-09-12 | 2002-05-28 | Affymetrix, Inc. | Electrochemical denaturation of double-stranded nucleic acid |
US6365400B1 (en) | 1990-09-12 | 2002-04-02 | Affymetrix, Inc. | Electrochemical denaturation of double-stranded nucleic acid |
US6613527B1 (en) | 1990-09-12 | 2003-09-02 | Affymetrix, Inc. | Electrochemical denaturation of double-stranded nucleic acid |
US6569382B1 (en) | 1991-11-07 | 2003-05-27 | Nanogen, Inc. | Methods apparatus for the electronic, homogeneous assembly and fabrication of devices |
US6048690A (en) * | 1991-11-07 | 2000-04-11 | Nanogen, Inc. | Methods for electronic fluorescent perturbation for analysis and electronic perturbation catalysis for synthesis |
US5846708A (en) * | 1991-11-19 | 1998-12-08 | Massachusetts Institiute Of Technology | Optical and electrical methods and apparatus for molecule detection |
US5653939A (en) * | 1991-11-19 | 1997-08-05 | Massachusetts Institute Of Technology | Optical and electrical methods and apparatus for molecule detection |
US5607832A (en) * | 1992-01-23 | 1997-03-04 | Scientific Generics Limited | Use of multivalent inorganic cations in the electrochemical treatment of nucletic acid containing solutions |
WO1993015224A1 (en) * | 1992-01-23 | 1993-08-05 | Scientific Generics Limited | Electrochemical treatment of nucleic acid containing solutions |
US5814450A (en) * | 1992-01-23 | 1998-09-29 | Scientific Generics Ltd. | Use of multivalent inorganic cations in the electrochemical treatment of nucleic acid |
WO1994029484A1 (en) * | 1993-06-09 | 1994-12-22 | Gamera Bioscience Corporation | Magnetic cycle reaction |
US6068818A (en) * | 1993-11-01 | 2000-05-30 | Nanogen, Inc. | Multicomponent devices for molecular biological analysis and diagnostics |
US8389212B1 (en) | 1993-11-01 | 2013-03-05 | Gamida For Life, B.V. | Method for the electronic analysis of a sample oligonucleotide sequence |
US5849486A (en) * | 1993-11-01 | 1998-12-15 | Nanogen, Inc. | Methods for hybridization analysis utilizing electrically controlled hybridization |
US5929208A (en) * | 1993-11-01 | 1999-07-27 | Nanogen, Inc. | Methods for electronic synthesis of polymers |
US6726880B1 (en) | 1993-11-01 | 2004-04-27 | Nanogen, Inc. | Electronic device for performing active biological operations and method of using same |
US6017696A (en) * | 1993-11-01 | 2000-01-25 | Nanogen, Inc. | Methods for electronic stringency control for molecular biological analysis and diagnostics |
US6540961B1 (en) | 1993-11-01 | 2003-04-01 | Nanogen, Inc. | Multicomponent devices for molecular biological analysis and diagnostics |
US7101661B1 (en) | 1993-11-01 | 2006-09-05 | Nanogen, Inc. | Apparatus for active programmable matrix devices |
US6051380A (en) * | 1993-11-01 | 2000-04-18 | Nanogen, Inc. | Methods and procedures for molecular biological analysis and diagnostics |
US7172864B1 (en) | 1993-11-01 | 2007-02-06 | Nanogen | Methods for electronically-controlled enzymatic reactions |
US6518022B1 (en) | 1993-11-01 | 2003-02-11 | Nanogen, Inc. | Method for enhancing the hybridization efficiency of target nucleic acids using a self-addressable, self-assembling microelectronic device |
US6238624B1 (en) | 1993-11-01 | 2001-05-29 | Nanogen, Inc. | Methods for transport in molecular biological analysis and diagnostics |
US6245508B1 (en) | 1993-11-01 | 2001-06-12 | Nanogen, Inc. | Method for fingerprinting utilizing an electronically addressable array |
US6254827B1 (en) | 1993-11-01 | 2001-07-03 | Nanogen, Inc. | Methods for fabricating multi-component devices for molecular biological analysis and diagnostics |
US6287517B1 (en) | 1993-11-01 | 2001-09-11 | Nanogen, Inc. | Laminated assembly for active bioelectronic devices |
US6423271B1 (en) | 1993-11-01 | 2002-07-23 | Nanogen, Inc. | Laminated assembly for active bioelectronic devices |
US7425308B2 (en) | 1993-11-01 | 2008-09-16 | Nanogen, Inc. | Systems for the active electronic control of biological reactions |
US6309602B1 (en) | 1993-11-01 | 2001-10-30 | Nanogen, Inc. | Stacked, reconfigurable system for electrophoretic transport of charged materials |
US6315953B1 (en) | 1993-11-01 | 2001-11-13 | Nanogen, Inc. | Devices for molecular biological analysis and diagnostics including waveguides |
US6319472B1 (en) | 1993-11-01 | 2001-11-20 | Nanogen, Inc. | System including functionally separated regions in electrophoretic system |
US6331274B1 (en) | 1993-11-01 | 2001-12-18 | Nanogen, Inc. | Advanced active circuits and devices for molecular biological analysis and diagnostics |
US6582660B1 (en) | 1993-11-01 | 2003-06-24 | Nanogen, Inc. | Control system for active programmable electronic microbiology system |
US6821729B2 (en) | 1993-11-01 | 2004-11-23 | Nanogen, Inc. | Devices for molecular biological analysis and diagnostics including waveguides |
US5605662A (en) * | 1993-11-01 | 1997-02-25 | Nanogen, Inc. | Active programmable electronic devices for molecular biological analysis and diagnostics |
US6375899B1 (en) | 1993-11-01 | 2002-04-23 | Nanogen, Inc. | Electrophoretic buss for transport of charged materials in a multi-chamber system |
WO1995025177A1 (en) * | 1994-03-15 | 1995-09-21 | Scientific Generics Limited | Electrochemical denaturation of double-stranded nucleic acid |
US6291185B1 (en) | 1994-03-15 | 2001-09-18 | Affymetrix, Inc. | Electrochemical denaturation of double-stranded nucleic acid |
CN1059238C (en) * | 1994-03-15 | 2000-12-06 | 科学通用有限公司 | Electrochemical denaturation of double-stranded nucleic acid |
US6033850A (en) * | 1994-03-15 | 2000-03-07 | Affymetrix, Inc. | Electrochemical denaturation of double-stranded nucleic acid |
US6403367B1 (en) | 1994-07-07 | 2002-06-11 | Nanogen, Inc. | Integrated portable biological detection system |
US6335161B1 (en) | 1995-08-25 | 2002-01-01 | Scientific Generics Limited | Release of intracellular material and the production therefrom of single stranded nucleic acid |
US6811981B2 (en) | 1995-08-25 | 2004-11-02 | Affymetrix, Inc. | Release of intracellular material |
US6586186B2 (en) | 1995-11-29 | 2003-07-01 | Affymetrix, Inc. | Polymorphism detection |
US6300063B1 (en) | 1995-11-29 | 2001-10-09 | Affymetrix, Inc. | Polymorphism detection |
US8095323B2 (en) | 1995-11-29 | 2012-01-10 | Affymetrix, Inc. | Polymorphism detection |
US7674587B2 (en) | 1995-11-29 | 2010-03-09 | Affymetrix, Inc. | Polymorphism detection |
US6953663B1 (en) | 1995-11-29 | 2005-10-11 | Affymetrix, Inc. | Polymorphism detection |
WO1997041219A1 (en) * | 1996-04-26 | 1997-11-06 | Scientific Generics Limited | Electrode capture of nucleic acid |
US6794130B2 (en) | 1996-04-26 | 2004-09-21 | Affymetrix, Inc. | Electrode capture of nucleic acid |
FR2749393A1 (en) * | 1996-05-31 | 1997-12-05 | Motorola Inc | ELECTRODE CONFIGURATION FOR MATRIX ADDRESSING OF A MOLECULAR DETECTION DEVICE |
WO1998000562A1 (en) * | 1996-07-02 | 1998-01-08 | Scientific Generics Limited | Denaturation of double-stranded nucleic acid |
WO1998002573A1 (en) * | 1996-07-11 | 1998-01-22 | Scientific Generics Limited | Denaturation of double-stranded nucleic acid |
US6706473B1 (en) | 1996-12-06 | 2004-03-16 | Nanogen, Inc. | Systems and devices for photoelectrophoretic transport and hybridization of oligonucleotides |
US6333157B1 (en) * | 1997-04-02 | 2001-12-25 | Affymetrix, Inc. | Disassociation of interacting molecules |
WO1998044100A1 (en) * | 1997-04-02 | 1998-10-08 | Scientific Generics Limited | Disassociation of interacting molecules |
US7153955B2 (en) | 1997-09-22 | 2006-12-26 | Nanogen Recognomics Gmbh | Pentopyranosyl nucleic acid arrays, and uses thereof |
US5993611A (en) * | 1997-09-24 | 1999-11-30 | Sarnoff Corporation | Capacitive denaturation of nucleic acid |
US7314708B1 (en) | 1998-08-04 | 2008-01-01 | Nanogen, Inc. | Method and apparatus for electronic synthesis of molecular structures |
US7060224B2 (en) | 1999-11-08 | 2006-06-13 | Nanogen, Inc. | Methods for the electronic, homogeneous assembly and fabrication of devices |
US6969589B2 (en) | 2001-03-30 | 2005-11-29 | Perlegen Sciences, Inc. | Methods for genomic analysis |
US11031098B2 (en) | 2001-03-30 | 2021-06-08 | Genetic Technologies Limited | Computer systems and methods for genomic analysis |
US9862984B2 (en) | 2006-04-21 | 2018-01-09 | Nanobiosym, Inc. | Single-molecule platform for drug discovery: methods and apparatuses for drug discovery, including discovery of anticancer and antiviral agents |
US11807892B2 (en) | 2006-04-21 | 2023-11-07 | Nanobiosym, Inc. | Single-molecule platform for drug discovery: methods and apparatuses for drug discovery, including discovery of anticancer and antiviral agents |
WO2014072748A1 (en) * | 2012-11-12 | 2014-05-15 | The University Court Of The University Of Edinburgh | Electrochemical method for denaturing or hybridising nucleic acid molecules |
US10280392B2 (en) | 2013-03-14 | 2019-05-07 | The Regents Of The University Of California | Methods and devices for non-thermal polymerase chain reaction |
US10933417B2 (en) | 2013-03-15 | 2021-03-02 | Nanobiosym, Inc. | Systems and methods for mobile device analysis of nucleic acids and proteins |
Also Published As
Publication number | Publication date |
---|---|
AU8517391A (en) | 1992-03-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5527670A (en) | Electrochemical denaturation of double-stranded nucleic acid | |
US5824477A (en) | Electrochemical denaturation of double-stranded nucleic acid | |
US6395489B1 (en) | Electrochemical denaturation of double-stranded nucleic acid | |
WO1992004470A1 (en) | Electrochemical denaturation of double-stranded nucleic acid | |
US5607832A (en) | Use of multivalent inorganic cations in the electrochemical treatment of nucletic acid containing solutions | |
EP0702728B1 (en) | Magnetic cycle reaction | |
EP0973885B1 (en) | Disassociation of interacting molecules | |
Tosar et al. | Electrochemical DNA hybridization sensors applied to real and complex biological samples | |
JP3021036B2 (en) | Detection of nucleic acid sequences or changes therein | |
EP2118310B1 (en) | Systems and methods for detecting nucleic acids | |
EP0455517A1 (en) | Restriction amplification assay | |
GB2247889A (en) | DNA denaturation by an electric potential | |
IL95537A (en) | Process for the multiplication of nucleic acids using at least two adaptors | |
EP2740804A1 (en) | Nucleic acid analysis method | |
JP2000342281A (en) | Amplification and detection of organism producing shiga- like toxin i | |
KR100482718B1 (en) | Nucleic Acid Probe-Immobilized Substrate and Method of Detecting the Presence of Target Nucleic Acid by Using the Same | |
WALLACE et al. | Meta-PCR: a novel method for creating chimeric DNA molecules and increasing the productivity of mutation scanning techniques | |
JP2722752B2 (en) | DNA detection method | |
WO1998002573A1 (en) | Denaturation of double-stranded nucleic acid | |
EP0421469B1 (en) | Method for separating a target oligonucleotide | |
JP4580104B2 (en) | A method for in vitro detection of a target substance in a specimen, comprising labeling of the target substance with a reporter gene and a sequence necessary for its expression in vitro | |
US20160230137A1 (en) | Methods and Devices for Non-Thermal Polymerase Chain Reaction | |
JP3847745B2 (en) | Electrochemical detection of nucleic acid hybridization | |
RU114320U1 (en) | DEVICE FOR DIRECT ELECTROCHEMICAL REGISTRATION OF UNPRIMITED SYNTHESIS OF DNA MOLECULES BASED ON PH-SENSITIVE SENSOR | |
Takenaka | Genosensors Based on Metal Complexes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AT AU BB BG BR CA CH CS DE DK ES FI GB HU JP KP KR LK LU MC MG MN MW NL NO PL RO SD SE SU US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE BF BJ CF CG CH CI CM DE DK ES FR GA GB GN GR IT LU ML MR NL SE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: CA |
|
ENP | Entry into the national phase |
Ref country code: US Ref document number: 1998 127115 Date of ref document: 19980731 Kind code of ref document: A Format of ref document f/p: F |