WO1991005064A1 - A sensitive method for measurement of chimeric transcripts of dna containing translocations - Google Patents

A sensitive method for measurement of chimeric transcripts of dna containing translocations Download PDF

Info

Publication number
WO1991005064A1
WO1991005064A1 PCT/US1990/005427 US9005427W WO9105064A1 WO 1991005064 A1 WO1991005064 A1 WO 1991005064A1 US 9005427 W US9005427 W US 9005427W WO 9105064 A1 WO9105064 A1 WO 9105064A1
Authority
WO
WIPO (PCT)
Prior art keywords
mrna
measuring
level
translocation
bcl
Prior art date
Application number
PCT/US1990/005427
Other languages
French (fr)
Inventor
Maryalice Stetler-Stevenson
Original Assignee
The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce filed Critical The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce
Publication of WO1991005064A1 publication Critical patent/WO1991005064A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification

Definitions

  • the present invention is related generally to the measurement of mRNA present in a biological sample. More particularly, the present invention is related to a sensitive and efficient method of measuring chimeric mRNA resulting from a chromosomal translocation, especially from biopsy specimens or the like, by a novel technique combining reverse transcription and polymerase chain reaction (PCR) .
  • PCR polymerase chain reaction
  • Follicular lymphoma is a common B-cell neoplasm which has remained largely an incurable disease. Approximately 95% of follicular lymphomas carry the t(14;18) (q32;q21) chromosomal translocation which results in joining of the putative oncogene bcl-2 on chromosome 18 to the immunoglobulin heavy chain joining region gene, JH, on chromosome 14 (Tsujimoto et al, 1984, Science 226:1097; Tsujimoto et al, 1985, Science 228:1440). This creates a unique segment of DNA composed of a joined bcl-2/JH sequence.
  • an object of the present invention to provide a sensitive, reliable and efficient method for detecting micro quantities of mRNA found in biological samples, such as biopsy specimens. It is a further object of the present invention to provide a diagnostic test for detecting and predicting the course of conditions resulting from t(14;18) translocation, such as follicular lymphoma, Hodgkins disease and the like. Other obj cts and advantages will become evident from the following detailed description of the invention.
  • Figure 1 shows different levels of expression of bcl-2.
  • RNA extracted from tumor cells (lanes 1, 2, 3, 4) and from the cell line SUDHL-6 (lanes 5 and 6) was reverse transcribed and specifically amplified using the polymerase chain reaction technique. The amplified segments are subjected to electrophoresis and Southern blotting. Southern blots were then probed with a 32-P- labeled internal oligo.
  • RNA extraction Two methods of RNA extraction are used, a microprocedure and a standard method.
  • the microprocedure involves pelleting of an aliquot of 100,00 cells in sterile Eppendorf tubes, addition of about 11 ⁇ g of yeast RNA and suspension of cells and RNA in 100 ⁇ l of quanidine isothiocyanate buffer. This is layered over 100 ⁇ l of 5.7 M CsCl and centrifuged at 75,000 rpm for two hours in the Beckman TL-100. The resulting pellet is precipitated with ammonium acetate and ethanol and resuspended in 10 ⁇ l of sterile Tris EDTA buffer.
  • the standard method uses the Fast Tract mRNA Isolation Kit (Invitrogen) and provides polyA selected mRNA.
  • the extracted RNA is reverse transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (BRL) and one of two types of primers, " oligo dT12-18 and a mixture of a specific immunoglobulin heavy chain u constant region primer Cmu(GAGGGGGAAAAGGGTTGGGGCGGAT) and a specific immunoglobulin heavy chain gamma constant region primer C gamma (CAACTGTCTTGTCCACCTTGGTGTT) .
  • the reverse transcription reaction is terminated after production of the first strand by addition of Na-EDTA, phenol chloroform extraction and ethanol precipitation.
  • the cDNA is resuspended in 10-15 ⁇ l of tris EDTA buffer and 5 ⁇ l are amplified using the polymerase chain reaction technique (PCR) with Taq polymerase (Cetus) .
  • PCR polymerase chain reaction technique
  • the primers for PCR are the mu constant region and gamma constant region primers described above and the bcl-2 primer adjacent to the major breakpoint region (TTAGAGAGTTGCTTTACGTGGCCTG) reportedby Stetler-Stevenson et al (1988, Blood 72:1822) as well as 5' and 3' primers for a standard housekeeping gene such as beta actin.
  • PCR is performed in the Thermocycler (Perkin Elmer Cetus) using a 100 mM Tris HC1 buffer, pH8.3, containing 500 mM KC1, 15 mM MgCl, 0.1% gelatin, 2.5 units of Taq polymerase, 200 ⁇ M each of dATP, dTTP, dCTP, and dGTP as well as 1 ⁇ g of each primer.
  • the reaction mixture is heated to 91"C for 5 minutes, cooled to 55 ⁇ C for 5 minutes and brought to 74 ⁇ C for 5 minutes. Following this first round, samples are heated at 94 ⁇ C, 55°C, and 74°C for 1.5, 1.5, and 2 minutes, respectively, for a total of forty cycles.
  • PCR sample Fifty percent of the PCR sample (25 ⁇ l) is resolved by electrophoresis (100V, 4-6 hr) in either 1.5% agarose (BRL) or 3% NuSieve (FMC) and 1% SeaKemp (FMC) agarose with 0.5 ⁇ g ethidium bromide/ml in Tris-Borate buffer. Alkaline Southern transfers are performed overnight using Genescreen Plus nylon filters (DuPont) and 0.4 N NaOH as a transfer buffer.
  • BBL 1.5% agarose
  • FMC NuSieve
  • FMC SeaKemp
  • Blots are then probed with a 32P-labeled 2.8 kb EcorRI/Hindlll fragment of the bcl-2 major breakpoint region, a 32P- labeled genomic JH SauIIIA fragment, and a 32P-labeled oligo with a sequence complimentary to a region immediately 3 » to the bcl-2 primer (CAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGC) . Amplified segments ranging between 125 and 300 base pairs are detected by autoradiography.
  • PCR amplification of contaminating genomic DNA produces a product several kilobases in length due to the nontranscribed region (intron) between JH and C mu or C gamma that is present in the rearranged gene, but not in the mRNA transcript.
  • the technique of the present invention allows easy discrimination between PCR amplified products from the mRNA and genomic levels.
  • the blots are also probed for the housekeeping gene amplified segment, such as beta actin. Comparison of the chimeric bcl-2/JH amplified segment intensity to the intensity of the beta actin amplified segment allows relative quantitation of the expression of bcl-2.
  • RNA is extracted from tissue or mononuclear cells isolated from blood and subjected to the procedures described herein above. Presence of the translocation is indicative of tumor involvement in the setting of follicular lymphoma.
  • This technique can be used to determine the level of bcl-2 expression and this may be utilized in deterr atioh of prognosis and thus in selection of proper treatment modalities.
  • This technique can be used to measure the expression of any known oncogene in tumor tissue and thus be utilized as a prognostic indicator and for selection of appropriate therapy.
  • This technique can be used to determine the presence of leukemic cells containing a translocation and thus allow early detection of relapse following therapy.
  • This technique can be used to determine the level of expression of proteolytic enzymes involved in tumor invasion and metastasis and thus provide an indicator of metastatic potential in tumors.
  • This technique is also useful in staging of Hodgkins disease in cases with known t(l4;18) translocation.
  • mRNA is isolated, reverse transcribed and the cDNA fragment amplified and quantitated by standard methodologies well known in the art; a difference from the known steady state level of mRNA being indicative of the presence of t(14;18) translocation.
  • the combined reverse transcription polymerase chain reaction is a novel technique for measurement of bcl-2 transcripts requiring only small quantities of RNA that can be easily obtained at the time of biopsy.
  • bcl-2/JH mRNA Low levels (nanogram quantities) of bcl-2/JH mRNA can still be detected because following reverse transcription the specific bcl-2/JH segment is amplified up to a million fold by the polymerase chain reaction technique (Saiki et al, 1988, Sci. 239:487). Furthermore, amplified segments are run in agarose gels without formaldehyde thus removing a significant health hazard to laboratory personnel. Detection of a segment of genomic DNA or of RNA containing the t(14;18) translocation is diagnostic for tissue or peripheral blood involvement with follicular lymphoma in patients with this primary diagnosis and in addition, determination of levels of expression allows prediction of clinical cause.
  • a diagnostic test for predicting the clinical course of a malignancy where aggressive behavior by malignant cells is associated with deregulation of an oncogene, lower expression of an antioncogene, or excessive production of proteolytic enzymes associated with metastasis comprises the step of measuring the level of target gene (oncogene, antioncogene or enzyme and the like) mRNA in tumor specimens by the method of the present invention and comparing the level of this mRNA with mRNA of normal uninvolved tissue, any statistically significant deviation from the normal levels being indicative of the clinical behavior of the tumor.
  • target gene oncogene, antioncogene or enzyme and the like

Abstract

A novel method for measuring mRNA has been described. The method combines reverse transcriptase and polymerase chain reaction to achieve efficient and sensitive measurement.

Description

A SENSITIVE METHOD FOR MEASUREMENT OF CHIMERIC TRANSCRIPTS OF DNA CONTAINING TRANSLOCATIONS
The present invention is related generally to the measurement of mRNA present in a biological sample. More particularly, the present invention is related to a sensitive and efficient method of measuring chimeric mRNA resulting from a chromosomal translocation, especially from biopsy specimens or the like, by a novel technique combining reverse transcription and polymerase chain reaction (PCR) .
BACKGROUND OF THE INVENTION Follicular lymphoma is a common B-cell neoplasm which has remained largely an incurable disease. Approximately 95% of follicular lymphomas carry the t(14;18) (q32;q21) chromosomal translocation which results in joining of the putative oncogene bcl-2 on chromosome 18 to the immunoglobulin heavy chain joining region gene, JH, on chromosome 14 (Tsujimoto et al, 1984, Science 226:1097; Tsujimoto et al, 1985, Science 228:1440). This creates a unique segment of DNA composed of a joined bcl-2/JH sequence. Studies with cell lines have indicated that this translocation results in deregulation of bcl-2 expression, perhaps due to the effect of the IgH enhancer, leading to inappropriately high levels of the bcl-2 fusion transcript (Seto et al, 1988, E bo.J. 7:123; Hua, 1988, Oncoαene Res. 2:263). The high level expression of this chimeric transcript in follicular lymphoma has been proposed as a factor involved in the pathogenesis of follicular lymphoma (Tushjimoto, Y., 1989, Proc. Natl. Acad. Sci 86:1958) and the level of expression may be correlated with clinical course. However, the levels of the bcl-2-Ig fusion transcript in follicular lymphoma. tissue has not been studied and correlated to clinical prognosis due to the relatively low levels of expression compared with other gene products and inherent difficulties in isolation of RNA containing sufficient quantities of the chimeric mRNA from biopsy specimens. Conventional methods involve preparation of large quantities of RNA, denaturation of RNA, electrophoresis in agarose formaldehyde gels and transfer to a nitrocellulose paper followed by hybridization with a specific probe and comparison to a product of known level of expression (Graninger et al, 1987, J. Clin. Invest. 80:1512). A reliable method for detecting micro quantities of mRNA found in biopsy samples is still needed. SUMMARY OF THE INVENTION
It is, therefore, an object of the present invention to provide a sensitive, reliable and efficient method for detecting micro quantities of mRNA found in biological samples, such as biopsy specimens. It is a further object of the present invention to provide a diagnostic test for detecting and predicting the course of conditions resulting from t(14;18) translocation, such as follicular lymphoma, Hodgkins disease and the like. Other obj cts and advantages will become evident from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accompanying drawings wherein: Figure 1 shows different levels of expression of bcl-2. RNA extracted from tumor cells (lanes 1, 2, 3, 4) and from the cell line SUDHL-6 (lanes 5 and 6) was reverse transcribed and specifically amplified using the polymerase chain reaction technique. The amplified segments are subjected to electrophoresis and Southern blotting. Southern blots were then probed with a 32-P- labeled internal oligo.
DETAILED DESCRIPTION OF THE INVENTION The above and various other objects and advantages of the invention are achieved by a method for detecting the presence of mRNA in a biological sample which comprises:
(a) extracting mRNA from a biological sample by any suitable procedure;
(b) then reverse transcribing the extracted mRNA using for example, moloney murine leukemia virus reverse transcriptase to obtain cDNA; and (c) then amplifying by PCR a diagnostic fragment of the cDNA and quantitating the product thus obtained by any suitable means known to one of ordinary skill in the art, such as radiometric, fluorometric, colorometric, densitometrie, photometric measurements and the like. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred "methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.
MATERIALS AND METHODS Materials. The following is a list of materials >.and their sources.
Guanidine isothiocyanate - Sigma; Cesium chloride - Bethesda Research Lab (BRL) ; Moloney urine leukemia virus reverse transcriptase - BRL; Fast tract mRNA isolation kit-Invitrogen; Tris and agarose - BRL; EDTA - Fisher; Taq polymerase - Cetus; dATP, dTTp, dCTP, dGTP - Pharmacia; Nusieve and Sea kemp agarose - FMC; Genescreen - DuPont; 32-P-gamma ATP - ICN. Methods
Two methods of RNA extraction are used, a microprocedure and a standard method. The microprocedure involves pelleting of an aliquot of 100,00 cells in sterile Eppendorf tubes, addition of about 11 μg of yeast RNA and suspension of cells and RNA in 100 μl of quanidine isothiocyanate buffer. This is layered over 100 μl of 5.7 M CsCl and centrifuged at 75,000 rpm for two hours in the Beckman TL-100. The resulting pellet is precipitated with ammonium acetate and ethanol and resuspended in 10 μl of sterile Tris EDTA buffer.
The standard method uses the Fast Tract mRNA Isolation Kit (Invitrogen) and provides polyA selected mRNA. The extracted RNA is reverse transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (BRL) and one of two types of primers," oligo dT12-18 and a mixture of a specific immunoglobulin heavy chain u constant region primer Cmu(GAGGGGGAAAAGGGTTGGGGCGGAT) and a specific immunoglobulin heavy chain gamma constant region primer C gamma (CAACTGTCTTGTCCACCTTGGTGTT) . The reverse transcription reaction is terminated after production of the first strand by addition of Na-EDTA, phenol chloroform extraction and ethanol precipitation. The cDNA is resuspended in 10-15 μl of tris EDTA buffer and 5 μl are amplified using the polymerase chain reaction technique (PCR) with Taq polymerase (Cetus) . The primers for PCR are the mu constant region and gamma constant region primers described above and the bcl-2 primer adjacent to the major breakpoint region (TTAGAGAGTTGCTTTACGTGGCCTG) reportedby Stetler-Stevenson et al (1988, Blood 72:1822) as well as 5' and 3' primers for a standard housekeeping gene such as beta actin.
PCR is performed in the Thermocycler (Perkin Elmer Cetus) using a 100 mM Tris HC1 buffer, pH8.3, containing 500 mM KC1, 15 mM MgCl, 0.1% gelatin, 2.5 units of Taq polymerase, 200 μM each of dATP, dTTP, dCTP, and dGTP as well as 1 μg of each primer. The reaction mixture is heated to 91"C for 5 minutes, cooled to 55βC for 5 minutes and brought to 74βC for 5 minutes. Following this first round, samples are heated at 94βC, 55°C, and 74°C for 1.5, 1.5, and 2 minutes, respectively, for a total of forty cycles. Fifty percent of the PCR sample (25μl) is resolved by electrophoresis (100V, 4-6 hr) in either 1.5% agarose (BRL) or 3% NuSieve (FMC) and 1% SeaKemp (FMC) agarose with 0.5 μg ethidium bromide/ml in Tris-Borate buffer. Alkaline Southern transfers are performed overnight using Genescreen Plus nylon filters (DuPont) and 0.4 N NaOH as a transfer buffer. Blots are then probed with a 32P-labeled 2.8 kb EcorRI/Hindlll fragment of the bcl-2 major breakpoint region, a 32P- labeled genomic JH SauIIIA fragment, and a 32P-labeled oligo with a sequence complimentary to a region immediately 3 » to the bcl-2 primer (CAACACAGACCCACCCAGAGCCCTCCTGCCCTCCTTCCGCGGGGGC) . Amplified segments ranging between 125 and 300 base pairs are detected by autoradiography. PCR amplification of contaminating genomic DNA produces a product several kilobases in length due to the nontranscribed region (intron) between JH and C mu or C gamma that is present in the rearranged gene, but not in the mRNA transcript. Thus, the technique of the present invention allows easy discrimination between PCR amplified products from the mRNA and genomic levels. The blots are also probed for the housekeeping gene amplified segment, such as beta actin. Comparison of the chimeric bcl-2/JH amplified segment intensity to the intensity of the beta actin amplified segment allows relative quantitation of the expression of bcl-2. Utilities:
1. This technique can be used to diagnose tissue or peripheral blood involvement with lymphoma. RNA is extracted from tissue or mononuclear cells isolated from blood and subjected to the procedures described herein above. Presence of the translocation is indicative of tumor involvement in the setting of follicular lymphoma.
2. This technique can be used to determine the level of bcl-2 expression and this may be utilized in deterr atioh of prognosis and thus in selection of proper treatment modalities.
3. This technique can be used to measure the expression of any known oncogene in tumor tissue and thus be utilized as a prognostic indicator and for selection of appropriate therapy.
4. This technique can be used to determine the presence of leukemic cells containing a translocation and thus allow early detection of relapse following therapy.
5. This technique can be used to determine the level of expression of proteolytic enzymes involved in tumor invasion and metastasis and thus provide an indicator of metastatic potential in tumors.
6. This technique is also useful in staging of Hodgkins disease in cases with known t(l4;18) translocation. As mentioned herein before, mRNA is isolated, reverse transcribed and the cDNA fragment amplified and quantitated by standard methodologies well known in the art; a difference from the known steady state level of mRNA being indicative of the presence of t(14;18) translocation. In summary, the combined reverse transcription polymerase chain reaction is a novel technique for measurement of bcl-2 transcripts requiring only small quantities of RNA that can be easily obtained at the time of biopsy. Low levels (nanogram quantities) of bcl-2/JH mRNA can still be detected because following reverse transcription the specific bcl-2/JH segment is amplified up to a million fold by the polymerase chain reaction technique (Saiki et al, 1988, Sci. 239:487). Furthermore, amplified segments are run in agarose gels without formaldehyde thus removing a significant health hazard to laboratory personnel. Detection of a segment of genomic DNA or of RNA containing the t(14;18) translocation is diagnostic for tissue or peripheral blood involvement with follicular lymphoma in patients with this primary diagnosis and in addition, determination of levels of expression allows prediction of clinical cause. Therapy modified according to the prognosis indicated by this determination may achieve better patient survival. The t(14;18) translocation has recently been found in Hodgkins disease and, therefore, the combined reverse transcription polymerase chain reaction measurement of bcl-2/JH transcripts can be applied to this disease as well.
The method could also be applied to measure the expression of oncogenes and enzyme markers involved in tumor invasion and metastasis in other neoplasms. Furthermore, this diagnostic test allows a more accurate assessment of the aggressiveness of individual tumors and appropriate adjustment of therapy. A diagnostic test for predicting the clinical course of a malignancy where aggressive behavior by malignant cells is associated with deregulation of an oncogene, lower expression of an antioncogene, or excessive production of proteolytic enzymes associated with metastasis, comprises the step of measuring the level of target gene (oncogene, antioncogene or enzyme and the like) mRNA in tumor specimens by the method of the present invention and comparing the level of this mRNA with mRNA of normal uninvolved tissue, any statistically significant deviation from the normal levels being indicative of the clinical behavior of the tumor.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of t is application and scope of the appended claims.

Claims

WHAT IS CLAIMED IS:
1. A method for measuring mRNA in a biological sample, comprising the steps of:
(a) isolating mRNA from a biological sample; (b) reverse transcribing the isolated mRNA from step (a) to obtain cDNA; (c) amplifying the cDNA obtained from step (b) by polymerase chain reaction and measuring the product thus obtained by any suitable quantitating means.
2. A diagnostic test for predicting the clinical course of a malignancy where aggressive behavior by malignant cells is associated with deregulation of an oncogene, lower expression of an antioncogene, or excessive production of proteolytic enzymes associated with metastasis, comprising the steps of measuring the level of target gene mRNA in tumor specimen by the method of claim 1 and comparing the level of said mRNA with mRNA of normal uninvolved tissue, a deviation from the normal level being indicative of the clinical behavior of the tumor.
3. A diagnostic test for determining the presence of a disease caused by translocation, comprising the step of measuring the chimeric mRNA produced by the DNA segment containing the translocation, by the method of claim 1.
PCT/US1990/005427 1989-10-02 1990-09-27 A sensitive method for measurement of chimeric transcripts of dna containing translocations WO1991005064A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US41611789A 1989-10-02 1989-10-02
US416,117 1989-10-02

Publications (1)

Publication Number Publication Date
WO1991005064A1 true WO1991005064A1 (en) 1991-04-18

Family

ID=23648611

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/005427 WO1991005064A1 (en) 1989-10-02 1990-09-27 A sensitive method for measurement of chimeric transcripts of dna containing translocations

Country Status (4)

Country Link
EP (1) EP0494968A4 (en)
AU (1) AU630001B2 (en)
CA (1) CA2067114A1 (en)
WO (1) WO1991005064A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993006248A1 (en) * 1991-09-16 1993-04-01 The United States Of America Represented By The Secretary, Department Of Health & Human Services Detection method for c-raf-1 genes
GB2260811A (en) * 1991-10-23 1993-04-28 Yorkshire Cancer Research Camp Diagnosis of malignant tumours by mRNA detection
WO1993024655A1 (en) * 1992-05-27 1993-12-09 Amersham International Plc Rna analysis
EP0597699A2 (en) * 1992-11-10 1994-05-18 Tosoh Corporation Protein secreted by cancer cells
DE4431174A1 (en) * 1994-09-01 1996-03-07 Deutsches Krebsforsch Detecting tumour specific mRNA by conversion to cDNA and amplification
EP0731806A1 (en) * 1993-12-03 1996-09-18 St. Jude Children's Research Hospital SPECIFIC FUSION NUCLEIC ACIDS AND PROTEINS PRESENT IN HUMAN t(2;5) LYMPHOMA, METHODS OF DETECTION AND USES THEREOF
US5643730A (en) * 1991-09-23 1997-07-01 Pfizer Inc. Process for detecting specific mRNA and DNA in cells
US5869308A (en) * 1988-08-26 1999-02-09 The United States Of America As Represented By The Department Of The Health And Human Services Detection method for C-RAF-1 genes
US6696548B2 (en) 1993-12-03 2004-02-24 St. Jude Children's Research Hospital Antibodies for recognition of alk protein tyrosine/kinase receptor

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358586A (en) * 1980-12-23 1982-11-09 Harvey Rubin Detection and isolation of endorphin mRNA using a synthetic oligodeoxynucleotide
US4483920A (en) * 1982-05-17 1984-11-20 Hahnemann University Immobilization of message RNA directly from cells onto filter material
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990009456A1 (en) * 1989-02-16 1990-08-23 Viktor Balazs Malignancy test (cancer test) using the polymerase chain reaction

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358586A (en) * 1980-12-23 1982-11-09 Harvey Rubin Detection and isolation of endorphin mRNA using a synthetic oligodeoxynucleotide
US4483920A (en) * 1982-05-17 1984-11-20 Hahnemann University Immobilization of message RNA directly from cells onto filter material
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP0494968A4 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5869308A (en) * 1988-08-26 1999-02-09 The United States Of America As Represented By The Department Of The Health And Human Services Detection method for C-RAF-1 genes
WO1993006248A1 (en) * 1991-09-16 1993-04-01 The United States Of America Represented By The Secretary, Department Of Health & Human Services Detection method for c-raf-1 genes
US5643730A (en) * 1991-09-23 1997-07-01 Pfizer Inc. Process for detecting specific mRNA and DNA in cells
GB2260811A (en) * 1991-10-23 1993-04-28 Yorkshire Cancer Research Camp Diagnosis of malignant tumours by mRNA detection
GB2260811B (en) * 1991-10-23 1995-07-05 Yorkshire Cancer Research Camp Detection of malignant tumours
WO1993024655A1 (en) * 1992-05-27 1993-12-09 Amersham International Plc Rna analysis
US5665544A (en) * 1992-05-27 1997-09-09 Amersham International Plc RNA fingerprinting to determine RNA population differences
EP0597699A2 (en) * 1992-11-10 1994-05-18 Tosoh Corporation Protein secreted by cancer cells
EP0597699A3 (en) * 1992-11-10 1994-09-28 Tosoh Corp Protein secreted by cancer cells.
EP0731806A1 (en) * 1993-12-03 1996-09-18 St. Jude Children's Research Hospital SPECIFIC FUSION NUCLEIC ACIDS AND PROTEINS PRESENT IN HUMAN t(2;5) LYMPHOMA, METHODS OF DETECTION AND USES THEREOF
EP0731806A4 (en) * 1993-12-03 1998-12-16 St Jude Childrens Res Hospital SPECIFIC FUSION NUCLEIC ACIDS AND PROTEINS PRESENT IN HUMAN t(2;5) LYMPHOMA, METHODS OF DETECTION AND USES THEREOF
US6174674B1 (en) 1993-12-03 2001-01-16 St. Jude Children's Research Hospital Method of detecting a chromosomal rearrangement involving a breakpoint in the ALK or NPM gene
US6451997B1 (en) 1993-12-03 2002-09-17 St. Jude Children's Research Hospital Kits for detecting chromosomal rearrangements
US6696548B2 (en) 1993-12-03 2004-02-24 St. Jude Children's Research Hospital Antibodies for recognition of alk protein tyrosine/kinase receptor
DE4431174A1 (en) * 1994-09-01 1996-03-07 Deutsches Krebsforsch Detecting tumour specific mRNA by conversion to cDNA and amplification

Also Published As

Publication number Publication date
CA2067114A1 (en) 1991-04-03
AU630001B2 (en) 1992-10-15
AU6606190A (en) 1991-04-28
EP0494968A1 (en) 1992-07-22
EP0494968A4 (en) 1992-11-25

Similar Documents

Publication Publication Date Title
USRE49542E1 (en) Method for the detection of cancer
US20100279877A1 (en) Method for Detection of Melanoma
US5942390A (en) Method of diagnosing predisposition for ulcerative colitis in Jewish population by detection of interleukin-1 receptor antagonist polymorphism
EP1080227B1 (en) Method of diagnosing, monitoring, and staging colon cancer
EP0760010B1 (en) Methods of screening for crohn's disease using tnf microsatellite alleles
Olsson et al. Real-time t (11; 14) and t (14; 18) PCR assays provide sensitive and quantitative assessments of minimal residual disease (MRD)
AU630001B2 (en) A sensitive method for measurement of chimeric transcripts of dna containing translocations
CA3026809A1 (en) Compositions and methods for diagnosing lung cancers using gene expression profiles
WO1998046798A1 (en) Enhanced reverse transcriptase polymerase chain assay to detect mn in patients with renal cell carcinoma
WO1998046798A9 (en) Enhanced reverse transcriptase polymerase chain assay to detect mn in patients with renal cell carcinoma
WO1999004037A1 (en) Detection of k-ras mutations in cancer
US6153388A (en) Method of determining melanoma micrometastasis using tyrosinase
US5976799A (en) Early detection of ovarian carcinoma using P16 gene products
WO1999060162A1 (en) A novel method of diagnosing, monitoring, and staging prostate cancer
IL131167A (en) Apc mutuation associated with familial colorectal cancer in ashkenazi jews
US20040253622A1 (en) Androgen regulated prostate specific polypeptide-5 (ARP-5)
CN101236193A (en) Gastric carcinoma lymph node transfer detection
WO2001053535A2 (en) Method of detecting neoplastic, hyperplastic, cytologically dysplastic and/or premalignant cellular growth or proliferation
Max et al. Quantitative nested real-time RT-PCR specific for tyrosinase transcripts to quantitate minimal residual disease
KR100868883B1 (en) Detection of Neuroblastoma Cell
US20050069941A1 (en) Novel method of diagnosing, monitoring, and staging colon cancer
US6861215B1 (en) Method of diagnosing, monitoring, and staging prostate cancer
JP4870976B2 (en) Test method for autoimmune disease using whole blood
KR102131519B1 (en) Biomarker for diagnosing of liver cancer metastasis or predicting prognosis of the same and use thereof
Gey et al. Development of a direct in situ RT-PCR method using labeled primers to detect cytokine mRNA inside cells

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 2067114

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1990915643

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1990915643

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990915643

Country of ref document: EP