US5834283A - Acyl coenzyme A:cholesterol acyltransferase (ACAT) - Google Patents

Abstract

This invention pertains to purified, biologically active acyl coenzyme A: cholesterol acyltransferase (ACAT) and to nucleic acid (DNA or RNA) encoding acyl coenzyme A:cholesterol acyltransferase. The nucleic acid, or a fragment thereof, may be ligated with an expression vector and transfected into cells to express acyl coenzyme A:cholesterol acyltransferase activity in intact cells and in cell-free extracts.

Description

GOVERNMENT SUPPORT

The work leading to this invention was supported, in part, by research grants from The United States government.

REFERENCE TO RELATED APPLICATIONS

"This application is a divisional application of Ser. No. 08/121,057 filed on Sep. 10, 1993, now U.S. Pat. No. 5,484,727 which is a continuation-in-part of Ser. No. 07/959,950 filed Oct. 14, 1992, now abandoned. The contents of all of the aforementioned applications hereby incorporated by reference."

BACKGROUND OF THE INVENTION

Acyl coenzyme A:cholesterol acyltransferase (ACAT) is an intracellular enzyme that uses cholesterol and fatty acyl-coenzyme A (CoA) to form cholesterol esters. Accumulation of cholesterol esters as cytoplasmic lipid droplets within cells of human aortic tissue is a characteristic feature of early lesions of atherosclerotic plaque. In intestines of vertebrate animals, the extent of absorption of dietary cholesterol can be shown to be significantly reduced by inhibiting intestinal ACAT activity. In livers of vertebrate animals, formation of lipoproteins require proper supply of cholesterol esters produced through the ACAT catalyzed reaction.

ACAT is a membrane-bound enzyme located in the endoplasmic reticulum of various tissues of animal and human cells. The enzyme has been localized to the rough endoplasmic reticulum in rat liver. It is highly regulated in many cell types and tissues, and it is believed to play an important role in cholesterol metabolism in various cells and tissues such as the small intestinal mucosa, hepatocytes, macrophages, and the steroid hormone-producing tissues (O'Brien, P. M. and Sliskovic, D. R. (1992) in Current Opinion in Therapeutic Patents; Cadigan, K. M., et al. (1988) J. Biol. Chem. 263:274-282; Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210).

Although ACAT has been studied intensively, much remains to be learned about its molecular structure. The active site of the enzyme has been localized to the cytoplasmic surface of the microsomal vesicles in the rat liver, using a combination of detergent and protease treatments, but whether the enzyme spans the entire membrane has not yet been determined. Lichtenstein, A. H. and Brecher, P. (1980) J. Biol. Chem. 255:9098-9104. Recent chemical modification studies indicate that essential histidyl and sulfhydryl residues may reside at or near the active site of the enzyme. Studies of ACAT activities of rabbit tissues suggest the existence of different ACAT subtypes since various tissues have differing sensitivities to histidyl-modifying reagents. Kinnunen, P. M. et al. (1988) Biochemistry 27:7344-7350.

ACAT activity has been studied from ACAT solubilized and reconstituted from various cultured cells, including rat and pig liver cells. Although these procedures have allowed enzyme activity to be measured in a defined lipid environment, little progress has been made as yet in purifying the solubilized preparations. To date, no laboratory had succeeded in purifying ACAT to homogeneity with retention of biological activity.

SUMMARY OF THE INVENTION

This invention pertains to purified, biologically active acyl coenzyme A:cholesterol acyltransferase (ACAT) and to nucleic acid (DNA or RNA) encoding acyl coenzyme A:cholesterol acyltransferase. The nucleic acid, or a fragment thereof, may be ligated with an expression vector and transfected into cells to express acyl coenzyme A:cholesterol acyltransferase activity in intact cells and in cell-free extracts. The nucleic acid, or fragments thereof, are useful as probes, as primers for polymerase chain reactions, or as antisense constructs.

Cells containing the nucleic acid, or active fragment thereof, as well as various cell-free systems are useful for screening and testing chemical agents serving as specific ACAT inhibitors. Such ACAT inhibitors are desirable in the development of drugs serving as specific ACAT inhibitors for prevention and/or treatment of various cholesterol-related disorders.

In addition, the nucleotide sequence of the gene encoding ACAT enables the screening of human populations for abnormal human ACAT activities for disease diagnosis. This invention provides a basis for creating various transgenic animals including mice and rabbits that permanently express the human ACAT gene. Such animals can be used to screen and test various agents that inhibit human ACAT activity in a tissue specific or non-tissue-specific manner in intact animals. In addition, this invention provides a basis for creating transgenic animals including chickens, cows and pigs with permanently reduced ACAT activity. Animals with lower ACAT activity have much less body cholesterol ester content, and thus would offer the same nutritional value but with less dietary cholesterol intake to consumers.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Southern analysis of enzyme restricted genomic DNAs probed with ³² P-gDNA G. Genomic DNAs were from 25-RA (lane 1), AC29 (lane 2), 29T2-8 Amph ^R 4,6,8,10,11,12,16 (lanes 3-9), 29T1 (lane 10), 29T2-4 (lane 11), 29T2-8 (lane 12), 29T2-10 (lane 13), human fibroblast (lane 15). Genomic DNAs were digested with EcoRI and Hind III, run on a 0.8% agarose gel, transferred to a nylon filter and probed with radiolabeled gDNA G. Fifteen μg of genomic DNA was used for each sample except for human fibroblasts (5 mg). Lane 14 contains 10 μg of λDNA (Hind III cut) as a size marker.

FIG. 2. Northern analysis of polyA⁺ mRNAs probed with ³² P-gDNA G₂. PolyA⁺ mRNAs were prepared using FAST-TRACK (Invitrogen, Inc.) from confluent monolayer cells grown in media with 10% fetal calf serum of AC29 (lane 1), 25-RA (lane 2), T2-8 Amph^R 4 (lane 3), T2-8 Amph^R 10 (lane 4), T2-4, 8, 10 (lanes 5-7), and human A431 cells (lane 8). RNAs were run on a denaturing gel and blotted onto a nylon filter, cross-linked with UV light. Approx. 15 μg of RNA was used per lane. A control experiment showed that the same blot probed with ³² P-actin cDNA provided a strong and sharp signal at the 1.9 kb region with approximately equal intensity for all 8 lanes.

FIG. 3. Nucleotide sequence of cDNA C₁, as determined by double stranded DNA sequencing (SEQ ID NO:1).

FIG. 4. Southern analysis of enzyme restricted genomic DNAs probed with ³² P-cDNA C₁. Genomic DNAs were from 25-RA (lane 2), AC29 (lane 3), T2-8 Amph ^R 4, 6, 8, 10, 11, 12, 16, 17, 18 (lanes 4-8, 10-13), 29T1 (lane 9), 29T2-4, 8, 10 (lanes 14, 15, 16), human fibroblast (lane 17). Lane 1 contains 10 μg of gDNA (Hind III cut) as a size marker. Genomic DNAs were digested and analyzed in the same manner as described in FIG. 2, except the ³² P-probe was cDNA C₁.

FIG. 5. Northern analysis of polyA+mRNAs probed with ³² P-cDNA C₁. A duplicate blot prepared in an identical manner as described in FIG. 2 was probed with either ³² P-cDNA C₁ (A), or ³² P-actin cDNA (B).

FIG. 6. The nucleotide sequence of cDNA K₁ (SEQ ID NO:2(SEQID NO: 2). The region which overlaps with that of cDNA C₁ is underlined.

FIG. 7. 25-RA cells (A), AC29 cells (C) the stable transfectant cells 29 K₁ -14e treated with (D) or without (B) ACAT inhibitor 58-035 viewed with differential-interference contrast microscopy. Cells were plated and processed for differential-interference contrast microscopic viewing by the same procedure as described in Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210. In (D), cells were treated with 58-035 at 400 ng/ml for 36 h.

FIG. 8. Heat inactivation of reconstituted ACAT activity from 25-RA (symbol=open square), 29 T2-8 (symbol=closed diamond), 29 K₁ -4b (symbol=closed square), and 29 K₁ -14e (symbol=partially open diamond). Cells were grown in 162 cm² flasks in medium A to confluence. They were harvested, and the cell extracts were reconstituted according to the procedure of Cadigan and Chang (1988) J. Lipid Res. 29:1683-1692. The reconstituted samples were incubated at 45° C. at indicated times, then placed on ice prior to assay for enzyme activity. The control activities for 25-RA, 29 T2-8, 29 K₁ -4b, and 29 K_1- 14e were 228, 73, 43, and 109 pmoles/min per mg respectively.

FIG. 9. The nucleotide and predicted amino acid sequences of cDNA K₁ (SEQ ID NOs: 3 and 4; SEQ ID NO: 3 is an alternative embodiment of the sequence in FIG. 6). Nucleotide residues are numbered on the right; amino acid residues are numbered on the left with residue 1 being the putative initiator methionine. The 5 stretches SEQ OD NOs:5-9) of sequences sharing significant homology with firefly luciferase "signature sequences" regions 1, 2 or 3 (Babbitt et al., (1992) Biochemistry 31:5594-5604) are underlined in the protein coding region. Leucines involved in the potential leucine heptad motif are identified by asterisks. The potential N-linked glycosylation site is indicated by a double asterisk (amino acid residue 409). The two AATAAA sites are underlined in the 3'-untranslated region.

DETAILED DESCRIPTION

The enzyme acyl coenzyme A:cholesterol acyltransferase (ACAT) is an intracellular enzyme which previously had not been purified to homogeneity with retention of biological activity. This invention pertains to isolated, biologically active acyl coenzyme A:cholesterol transferase, or a biologically active portion thereof. As used herein, biological activity includes catalytic activity. ACAT has been shown to have amino acid sequences TNLIEKSASLDNGGCALTT, GRLVLEFSLLSYAF, GFGPTY, GYVAMKFAQVFGCF, and ARVLVLCUFNSILPGVL, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9 and their functional equivalents, which are believed to be involved in catalytic activity. The enzyme, or active portion, is preferably human in origin.

The invention also pertains to the nucleic acid (DNA or RNA) encoding acyl coenzyme A:cholesterol acyltransferase and to the use of the nucleic acid to produce, by recombinant techniques, acyl coenzyme A:cholesterol acyltransferase.

One embodiment of the invention is the cDNA for human ACAT contained the clone K₁, or any derivative of this cDNA. This nucleotide sequence is shown in SEQ ID NO: 2. Variants of this ACAT nucleotide sequence are also within the scope of this invention. These include sequences substantially homologous to the sequence of SEG ID NO: 2. This includes sequences, such as those derived by mutagenesis, which have nucleotide insertions, deletions, substitutions, or other modifications, but which encode a catalytically active ACAT. The variants include fragments of the ACAT nucleotide sequence. As used herein, a fragment of the nucleotide sequence encoding human acyl coenzyme A:cholesterol acyltransferase refers to a nucleotide sequence having fewer nucleotides than the nucleotide sequence of the entire enzyme. Nucleic acid sequences used in any embodiment of this invention can be cDNA as described herein, or alternatively, can be any oligonucleotide sequence having all or a portion of a sequence represented herein, or their functional equivalents. Such oligonucleotide sequences can be produced chemically or mechanically using known techniques. A functional equivalent of an oligonucleotide sequence is one which is capable of hybridizing to a complementary oligonucleotide to which the sequences shown in the Sequence Listing, or fragment thereof, hybridizes, or a sequence complementary to either of the sequences shown in the Sequence Listing.

ACAT, or a portion of ACAT, can be produced by standard recombinant techniques using the nucleotide sequences of this invention. The nucleotide sequence encoding ACAT is inserted into an expression vector. A suitable host cell, such as a mammalian cell, is transformed with the vector, and the cell is cultured under conditions conducive to the production of the enzyme by the cell. ACAT, or a portion of ACAT, can be produced in other organisms, including bacteria, yeast, and insect cells, as well as various cell-free systems. A portion of ACAT expressed in these systems may express partial ACAT function, such as the ability to bind, inter alia, cholesterol, fatty acids, and coenzyme A, thus creating unique tools and assays for testing and screening for inhibitors which block these partial ACAT functions. these inhibitors would be genuine ACAT inhibitors.

The nucleotide sequence information contained in the cDNA encoding ACAT also provides crucial information concerning the catalytic mechanism of ACAT and provides investigators with a means for rational design of drugs serving as specific ACAT inhibitors. Such ACAT inhibitors are desirable for prevention and/or treatment of human hypercholesterolemia and human atherosclerosis. The nucleotide sequence information contained in the nucleic acid encoding ACAT enables design of various specific oligonucleotides as specific anti-sense DNAs or anti-sense RNAs, to inhibit human ACAT messenger RNAs, thereby to inhibit ACAT protein production, as described in more detail below.

The nucleic acid molecules of this invention can be used to produce primers for polymerase-mediated replication of nucleotide sequences encoding ACAT. Typically, the primer is a single stranded oligonucleotide substantially complementary to a portion of the ACAT sequence to be replicated. The primer will have a length sufficient to prime polymerase activity, generally a minimum of five to seven nucleotides, and typically from 16 to 30 nucleotides. Primers can be used in polymerase chain reaction (PCR) to amplify ACAT nucleotide sequences.

The nucleic acid molecules of this invention, and fragments thereof, are also useful as hybridization probes for library screenings to isolate and identify partial and/or full length cDNA or gDNA clones encoding ACAT genes from various animal species. Probes are generally labeled single stranded oligonucleotides substantially complementary to at least a portion of the ACAT nucleotide sequence. Hybridization reactions can be performed by standard techniques. Such probes can be used to identify different forms of human ACAT or ACAT from different animal species.

The probes and primers described above are useful as diagnostic tools to identify persons who have certain diseases, either acquired or genetically inherited, related to an abnormality in the ACAT gene or gene expression.

Nucleic acid molecules can be used to produce antisense constructs for inhibition of ACAT activity. In one embodiment, the oligonucleotide is an antisense oligonucleotide. The antisense oligonucleotide can be a normal oligonucleotide for an analogue of an oligonucleotide (e.g., phosphorothioate oligonucleotides, in which one of the phosphate oxygens is replaced by a sulfur atom) sufficiently stable to reach the target in effective concentrations. Antisense oligodeoxynucleotides can be prepared by standard synthetic procedures.

In another embodiment, the antisense construct is oligoribonucleotide. The antisense construct is produced by introducing the gene encoding the construct into a cell. For example, an ACAT nucleotide sequence can be placed in an expression vector in reverse orientation to generate an antisense transcript.

The antisense oligonucleotides can be designed to operate by different mechanisms of gene inhibition. Generally, these mechanisms involve the hybridization of the oligonucleotide to a specific RNA sequence, typically a messenger RNA. The targeted sequence can be located in the coding region of the RNA or it can be a signal sequence required for processing or translation of the RNA. Alternatively, the oligonucleotide may form a triple helix DNA structure, inhibiting transcription of the mRNA sequence.

The nucleic acid sequence of this invention can be used to produce transgenic animals either carrying human ACAT or having reduced levels of ACAT activity. Transgenic mammals, such as mice, expressing full or partial human ACAT activity can be easily created by methods well-documented in the art, for example those described in Leder et al., U.S. Pat. No. 4,736,866. One of ordinary skill in the art can prepare transgenic mammals by injecting the ACAT gene, or a portion thereof, into the germline of the mammal. Alternatively, the gene or gene fragment can be injected into the male pronucleus of the fertilized egg when the egg is at the single cell stage, prior to implanting the egg in the host female. Moreover, using similar methods, a transgenic animal, such as a chicken, cow, or pig, can be produced by, for example, transfecting germ cells with a nucleic acid sequence encoding an antisense construct which blocks ACAT expression. Transgenic mammals carrying those constructs would have decreased ACAT activity, and, as a result, lower body cholesterol levels. Such transgenic animals would offer the same nutritional values while decreasing consumers'dietary cholesterol intake.

The invention further comprises a stable mutant cell which lacks endogenous ACAT activity, and is transformed with a nucleic acid encoding human ACAT, such that the cell expresses activity of human ACAT, preferably at high levels, in intact cells and in cell-free extracts. The cell produces an excess of cholesterol ester, causing the cell to form detectable (e.g. visibly) cytoplasmic lipid droplets. These droplets disappear with inhibition of ACAT. This mutant cell containing the human ACAT gene can be used in an assay for agents, including antisense DNA and/or RNA, that inhibit human ACAT activity. The cell is exposed to the agent under conditions which allow the agent to be taken up into the cell, and the cell is examined for substantial disappearance of the lipid droplets. Substantial disappearance indicates inhibition of human acyl coenzyme A:cholesterol transferase. This invention also embraces any agents which inhibit ACAT identified by the above-described screening assay, or any other assay using the ACAT nucleic acid sequence, or fragments thereof.

The invention is illustrated further by the following exemplification.

EXEMPLIFICATION Example I.

A. Preparing Human ACAT Genomic DNA Fragments

Chinese hamster ovary (CHO) cells are a fibroblast-like cell line in which cholesterol ester synthesis is highly regulated by exogenous sources of cholesterol, such as low density lipoprotein (LDL), and by endogenous cholesterol synthesis. The inventor and others previously developed an amphotericin B enrichment procedure, and reported the isolation of CHO cell mutants almost entirely lacking ACAT activity. All isolated mutants were found to belong to the same complementation group and possess a defect in the ACAT enzyme itself or in a factor needed for production of the enzyme (Cadigan, K. M., et al. (1988) J. Biol. Chem. 263:274-282).

Cells that regained the ability to synthesize cholesterol esters were isolated from the mutants described above. After populations of ACAT deficient mutant (AC29) were subjected to chemical mutagenesis, or transfected with human fibroblast whole genomic DNA, two revertants and one primary transfectant (T₁) were isolated. Isolation was achieved by virtue of the revertant cells' or transfectant cells' higher fluorescent intensities when stained with Nile Red, a stain specific for neutral lipids, including cholesterol esters.

Both revertants and transfectants regained large amounts of intracellular cholesterol ester and ACAT activity. However, heat inactivation experiments reveal that the enzyme activity of the transfectant cells has heat stability properties identical to those of human fibroblasts, while the ACAT activities of the revertants are similar to that of other Chinese hamster ovary cell lines. This demonstrates that the molecular lesion in the ACAT deficient mutants resides in the structural gene for the enzyme, and indicates that the transfectant cells corrected this lesion by acquiring and stably expressing a human gene encoding the human ACAT polypeptide.

Secondary transfectants (T2-4, T2-8, and T2-10) were isolated by transfection of ACAT deficient mutant cells with primary transfectant genomic DNA. Genomic Southern analysis of the secondary transfectants, using a probe specific for human DNA, revealed several distinct restriction fragments common to all the transfectants. These fragments were hypothesized to comprise part or all of the human ACAT gene (Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210). These human gene fragments were isolated (see Section B below) and were used as the starting material for molecular cloning of the human ACAT cDNA of this invention.

Standard recombinant DNA techniques were employed, according to the methods known in the art and as described in Sambrook, J., et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. The use of λZAP, λDASH, pBluescript for library or recombinant plasmid constructions were following instructions manuals provided by Stratagene, Inc. The use of FAST-TRACK kit for mRNA isolation, of pcDNA₁ and pcDNA_neo for library or recombinant plasmid constructions were following instruction manuals provided by Invitrogen Inc. Other biochemical assays and methods used here were all previously documented in Cadigan, K. M., et al. (1988) J. Biol. Chem. 263:274-282; Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210; Hasan, M. T., et al. (1991) Somatic Cell and Mol. Genetics 17:413-517; Cadigan, K. M. and Chang, T. Y. (1988) J. Lipid Res. 29:1683-1692.

B. Isolating human ACAT cDNA C₁ Clone

A phage lambda (λDASH, from Stratagene, Inc.) library consisting of genomic DNA fragments of transfectant cell T2-8 was prepared and screened using the human-specific Alu-repetitive DNA as the probe prepared according to the method of Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210. An Alu-positive, λ clone (designated as λG) containing an insert was isolated. The insert, designated as gDNA G, was determined to be approximately 14 kb in length. Insert gDNA G was labeled with ³² P and used as the probe in genomic Southern analyses of restriction-digested genomic DNAs of human skin fibroblasts, primary transfectant cell clone T₁, and of secondary transfectant cell clones T2-4, T2-8, and T2-10. Results (FIG. 1) show gDNA G is a specific, common-sized human DNA fragment present in the genomes of all four transfectant clones which exhibit human ACAT activity (Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210). Fragment gDNA G was not found in the genomes of 25-RA cells or AC29 cells, which suggests that gDNA G may be part of the human ACAT genomic DNA.

              TABLE 1                                                     
______________________________________                                    
 .sup.3 H! Oleate Incorporated Into Cholesteryl                           
Oleate in Intact Cells                                                    
Cell Type     (% of 25RA)                                                 
______________________________________                                    
25-RA         100.0*                                                      
29T2-8        94.5                                                        
29T2-8Amph.sup.R 4                                                        
              1.7                                                         
29T2-8Amph.sup.R 6                                                        
              0.5                                                         
29T2-8Amph.sup.R 8                                                        
              1.1                                                         
29T2-8Amph.sup.R 10                                                       
              0.8                                                         
29T2-8Amph.sup.R 11                                                       
              0.6                                                         
29T2-8Amph.sup.R 12                                                       
              0.0                                                         
29T2-8Amph.sup.R 16                                                       
              0.9                                                         
29T2-8Amph.sup.R 17                                                       
              1.1                                                         
29T2-8Amph.sup.R 18                                                       
              1.2                                                         
______________________________________                                    
 *100% = 7529 dpm/min/mg                                                  

To demonstrate the accuracy of this theory, nine individual ACAT deficient cells were isolated using the secondary transfectant cell T2-8 as the parental cell. The T2-8 cell was found to be very sensitive to amphotericin B killing. Using the same procedure as previously described for isolating ACAT deficient mutants from 25-RA cells (Cadigan, K. M., et al. (1988) J. Biol. Chem. 263:274-282), nine independent cell clones (designated as T2-8 ^Ampho R4, T2-8 ^Ampho. R6 ; etc.) were obtained from approximately 10 ×10⁶ T2-8 cells. These clones are found to be devoid of ACAT activity when analyzed by ³ H-oleate pulse in intact cells, as shown in Table 1.

Southern analyses (FIG. 1, lanes 3-9) using gDNA G as the probe showed that, in contrast to the parental T2-8 cells, none of these independent cell clones contains DNA fragment G as part of their genomes. This demonstrates 100% concordance between the presence/absence of DNA fragment G in the cell genome and the presence/absence of human ACAT activity in various CHO cells, and strongly supports the proposition that gDNA G is part of the human ACAT genomic DNA.

gDNA fragment G was digested with HinfI. The resulting 1.2 kb fragment designated as gDNA G₂, which was found to be devoid of Alu-repetitive DNA, was isolated and cloned into the phagemid vector pBluescript (Stratagene). Fragment gDNA G₂ was found to contain at least one exonic element, since it strongly hybridized (particularly at the 3.8 kb and 3.0 kb regions) with polyA⁺ mRNAs of discrete sizes prepared from all of the human ACAT positive transfectant cells, and from human epidermal carcinoma A431 cells. The results of the Northern analysis of those polyA⁺ mRNAs is shown in FIG. 2.

A cDNA library was prepared using polyA⁺ mRNAs of T2-8 cells using pcDNA₁ (from Invitrogen, Inc.) as the vector. This library was screened with ³² P gDNA G₂. A single cDNA clone (size=1006 bps) was identified, designated as cDNA C₁, and sequenced. As shown in FIG. 3 and the Sequence Listing, the nucleotide sequence contains a single, uninterrupted open-reading frame for a predicted polypeptide of 335 amino acids. Extensive search for nucleotide sequence homology between C₁ DNA and other DNAs of known sequences in several DNA sequence data banks reveals that the C₁ sequence has never been reported in the art. Genomic Southern analyses, FIG. 4, show that ³² P-C₁ DNA strongly hybridizes with the same 14-kb genomic DNA fragment recognized by gDNA G in all the transfectant cell DNAs, and in human fibroblast DNAs. Northern analyses, shown in FIG. 5, demonstrate that ³² P-C₁ DNA strongly hybridizes with the same polyA⁺ mRNA species as recognized by the gDNA G₂ fragment in transfectant cell RNAs. These hybridization signals were absent in CHO cells devoid of human ACAT activity (FIG. 4, lanes 2-8 and 10-13; FIG. 5, lanes 1-4), consistent with the interpretation that C₁ DNA is part of the human ACAT cDNA. Clone C₁ DNA was ligated in two opposite orientations with the mammalian expression vector pcDNA_neo (from Invitrogen), and then transfected into AC29 cells. These experiments repeatedly failed to produce functional complementation of ACAT deficiency in AC29 cells, thus indicating that C₁ DNA does not contain sufficient coding sequences to express human ACAT activity in CHO cells.

Example II. Isolating Human ACAT cDNA K₁ Clone

A phage lambda library (in λZAP; Stratagene) containing cDNAs of human macrophage cell line THP-1 cells was obtained from Dr. T. Kodama of Tokyo University in Japan as a generous gift. (Preparation and use of this particular library is described in Matsumoto, et al. (1990) Proc. Natl. Acad. Sci. 87:9133-9137). This library was screened using both gDNA G₂ and cDNA C₁ as the probe. A single clone was identified which strongly hybridizes with both G₂ and C ₁ probes. This clone, designated as cDNA K₁, is approximately 4.1 kb in length.

The entire K₁ nucleotide sequence has been completed, with 98% to 99% certainty, and is shown in FIG. 6 and in the Sequence Listing. Uncertain nucleotides are represented by the letter N. The K₁ nucleotide comprises a 1006-bp nucleotide sequence (underlined) which shares 100% homology with that of the DNA C₁ sequence shown in FIG. 3. K₁ cDNA can be stably propagated as an insert in the phagemid pBluescript.

To demonstrate that K₁ DNA complements ACAT deficiency in AC29 cells, the pBluescript plasmid containing K₁ DNA as the insert (designated as pK₁) was digested with enzymes NotI and EcoRV, to release the intact K₁ DNA insert free of NotI and EcoRV sites from the vector. The DNA mixture was ligated with a NotI-EcoRV linearized pcDNA₁ vector for the purpose of ligating K₁ DNA with the CMV promoter in proper orientation. The ligated DNA mixture was directly transfected into AC29 cells. Appropriate control transfections, using various DNA mixtures without K₁ DNA or without pcDNA₁ were performed in parallel. The result (Table 2) indicates that DNA K₁ is necessary to provide large increases in rate of cholesteryl ester synthesis in AC29 cells, in both transient and stable transfection experiments.

              TABLE 2                                                     
______________________________________                                    
Transfection of Various DNA Mixtures Into ACAT                            
Deficient Mutant (Clone AC29)                                             
            Relative Rate of                                              
                           Relative                                       
            Cholesterol Ester                                             
                           Rate                                           
            Synthesis In   of Phospho-                                    
            Intact Cells   lipid Syn-                                     
              A. Transient                                                
                        B. Stable  thesis In                              
DNA Mixture   Transfection                                                
                        Transfection                                      
                                   Intact Cells                           
______________________________________                                    
None           1.0*      1.0**       1.0***                               
pSV2 neo      1.0       1.5        1.2                                    
pSV2 neo + pBluescript                                                    
              0.9       1.3        1.7                                    
pSV2 neo + pcDNA.sub.1                                                    
              1.1       1.6        0.9                                    
pSV2 neo + pBluescript +                                                  
              1.0       1.0        1.6                                    
pcDNA.sub.1                                                               
pSV2 neo + pBluescript +                                                  
              2.4       8.6        1.4                                    
K.sub.1                                                                   
pSV2 neo + pBluescript +                                                  
              6.0         21.8**** 1.0                                    
pcDNA.sub.1 +                                                             
K.sub.1                                                                   
______________________________________                                    
 *1.0 = 134 dpm/min/mg                                                    
 **1.0 = 80 dpm/min/mg                                                    
 ***1.0 = 23 × 10.sup.2 dpm/min/mg; measured only in stable         
 transfectant cells                                                       
 ****12.4% of value found in 25RA cells                                   

In the experiments reported in Table 2, DNA transfection of AC29 cells was accomplished according to the method of Hasan et al. ((1991) Somatic Cell and Mol. Genetics 17:413-517). AC29 cells plated at 0.3×10⁶ cells/25 cm² flask in medium A were grown for 24 h before transfection. Each transfection was performed in triplicate, and included supercoiled plasmid pSV2_neo (at 0.7 μg/flask) along with indicated DNA mixtures (which totaled 17.5 μg/flask). Each indicated plasmid was sequentially cut with EcoRV and NotI, salt precipitated, and redissolved in sterile water.

For the DNA mixture involving pBluescript +pcDNA₁, or pBluescript +pcDNA₁ +K₁, ligation took place as follows: 50 μg pcDNA₁ was ligated with either 12.5 μg pBluescript, or with 25 μg pK₁ (cut with EcoRV and NotI to release K₁ insert from vector) in 20 μl volume using 3400 units of T4 DNA ligase (New England Biolab) at 16° C. overnight. The ligated DNA mixtures were salt precipitated, redissolved in sterile water and used directly in transfection experiments.

To measure cholesterol ester synthesis in transient transfectant cells, transfected cells were grown in medium A for 2 days, then in medium A +500 μg/ml G418 for one more day, and were subjected to ³ H-oleate pulse assay in duplicate flasks. To measure cholesterol ester synthesis in stable transfectant cells, cells after transfection were grown in medium A for 2 days, then in medium A+500 μg/ml G418 for 14 days. The G418 resistant cells were then placed in medium A in duplicate flasks, and were subjected to ³ H-oleate pulse assay.

In a separate experiment, DNA mixtures of pBluescript+pcDNA_neo, or of pBluescript+pcDNA_{neo+K 1} were treated, ligated, and used for stable transfection in an identical manner to that described in Table 2. Stable transfectant cells (resistant to 500 μg/ml G418 toxicity) were isolated and subjected to ³ H-oleate pulse assay. Results very similar to those shown in Table 2 were obtained: While the transfectant clones resulting from the former DNA mixture only provided basal values, those cells resulting from the latter DNA mixture provided large increase (by approximately 10-fold) in rate of cholesterol ester synthesis as compared to the basal value found in AC29 cells.

In the stable transfectant cell populations containing pcDNA₁ and K₁ DNA, or containing pcDNA_neo and K₁ DNA, a great deal of heterogeneity was observed in cytoplasmic cholesteryl ester contents, present as lipid droplets, in various cell clones. This can be visually detected by examination of cells under phase-contrast microscopy. That this is so appears to be due to variability of expression of the transfected K₁ gene in different clones.

Example III: Stable Transfectant 14e

The stably transfected cells described above were cloned by cloning rings. Eight independently cloned transfectant cells were evaluated for their rates of cholesterol ester synthesis in intact cells and in vitro by reconstituted ACAT assay. The result (shown in Table 3) indicates that one clone, identified as 14e, expresses the highest ACAT activity in intact cells and in vitro. Its ACAT activity is higher than those found in the transfectant clone T2-8 obtained previously through total human genomic DNA transfection experiments. A second stable transfectant clone (4b), obtained using the ligated DNA mixture of pcDNA_neo +pBluescript+K₁, expresses significant ACAT activity, but this activity is less than that measured in the T2-8 cells.

              TABLE 3                                                     
______________________________________                                    
Rates of Cholesterol Ester Synthesis of Individual                        
AC29 Clones Stably Transfected with K1 cDNA                               
                        In Vitro                                          
            In Intact Cells                                               
                        (By Reconstituted                                 
Cell Type   (by Oleate Pulse)                                             
                        ACAT Assay)                                       
______________________________________                                    
AC29        1.0*        1.0**                                             
29K1-10     0.7         1.0                                               
29K1-11     1.1         1.0                                               
29K1-12     0.8         1.1                                               
29K1-6      1.1         1.9                                               
29K1-13     5.4         3.1                                               
29K1-5      0.9         4.3                                               
29K1-4b     42.4        13.6                                              
29K1-14e    82.4        23.3                                              
29T2-8      70.6        16.1                                              
25-RA       84.2        44.4                                              
______________________________________                                    
 *1.0 = 133 dpm/min/mg                                                    
 **1.0 = 4 pmole/min/mg                                                   

In the experiments reported in Table 3, Clones 29K₁ -10, 11, 12, 13, and 14e were isolated from stable transfectant cells described in Table 2 using pSV2 _neo +pBluescript+K₁ as the DNA mixture; clones 29 K_1- 4b, 29 K₁ -5, 29 K₁ -6 were isolated from stable transfectant cells using pBluescript+pcDNA_neo +K₁, performed in a separate experiment in similar manner as described in Table 2; clones 14a, 14d, and 14e were isolated from stable transfectant cells described in Table 2 using pSV2_neo +pBluescript+pcDNA₁ +K₁ as the DNA mixture. The oleate pulse assay and in vitro reconstituted ACAT activity assay were performed in duplicate as described earlier (Cadigan, K. M., et al. (1988) J Biol. Chem. 263:274-282; Cadigan, K. M., et al. (1989) J. Cell Biol. 108:2201-2210).

In 14e cells, numerous cytoplasmic lipid droplets are visible under the microscope (FIG. 7B). When treated with an ACAT inhibitor, specifically 58-035 at 400 ng/ml for 36 h, most of the lipid droplets in 14e cells disappear (FIG. 7D), indicating that these are cholesteryl ester droplets. For comparison purposes, photos of 25-RA cells, which contain ACAT of CHO origin, and AC29 cells, which are deficient in ACAT activity, as viewed under the microscope, are provided in FIG. 7A and 7C. The cloned populations of 14e cells can be continuously grown in culture for at least two months without losing this distinct phenotype.

As was previously reported, the biochemical characteristics of ACAT activities present in the crude extracts of cultured human cells differs from that in CHO cells. Cadigan, K. M. et al. (1989) J. Cell Biol. 108:2201-2210: In reconstituted vesicles of defined lipid composition, the CHO cell ACAT activity exhibits a significantly greater thermolability at 45° C. than that of human cell ACAT activity. Based on this criterion, primary and secondary genomic ACAT transfectant cells (29T1, 29T2-4, 29T2-8, and 29T2-10) were determined to contain ACAT activities of human origin. Further investigation, by heat inactivation of the ACAT activities expressed in stable cDNA K₁ transfectant clones 14e and 4b, and comparison with that expressed in 25-RA cells and in T2-8 cells shows that the ACAT inactivation rates in 14e cells and 4b cells are the same as that of T2-8 cells, which is considerably slower than that found in 25-RA cells. This indicates that the ACAT activities expressed in 14_e cells and 4_b cells are of human origin. This result invalidates the alternative interpretation: that the K₁ cDNA was human cDNA which, upon transfection in AC29 cells, reactivated the CHO ACAT activity. If this were the case, the ACAT activity expressed in cells 14e and 4b would have behaved like that expressed in 25-RA cells, i.e., the CHO ACAT, in the heat inactivation study.

This cell clone can effectively be used as a tool to screen drugs and anitisense constructs serving as human ACAT inhibitors. The numerous cytoplasmic lipid droplets in 14e cells that are visible under the microscope provide an elegant test for evaluating potential ACAT inhibitors. Specifically, when 14e cells are treated with an ACAT inhibitor, the lipid droplets essentially disappear, as illustrated in FIG. 7D. A simple, visual method for testing and screening potential human ACAT inhibitors in cultured cells is thus provided. Those skilled in the art will recognize that this embodiment is not limited to 14e cells, and can be used with any stable transfectant cell line that hyper expresses the ACAT gene, or a fragment thereof, for example, the 29K-4b or 29T₂ cell lines. Those skilled in the art will also recognize that the visual detection of intracellular cholesteryl esters present in 14e cells, or other cell line capable of hyper expressing ACAT, could be achieved by means other than standard microscopy, such as phase-contrast microscopy, fluorescent dye staining followed by fluorescent microscopy, among others. The speed of detection may also be enhanced by coupling a rapid scanning mechanism to the microscopic apparatus.

Example IV. 1.7 kb K₁ cDNA Encoding Human ACAT

A fragment of the 4.0 kb K₁ cDNA was discovered that spans the entire predicted protein coding region of ACAT. It is the 1.7 kb Sal I-Hind III fragment, spanning nucleotide residues 1302-3050 of K₁.

Subcloning the 1.7 kb fragment into the pcDNA1_neo vector, in both directions, produced plasmids designated pcDNA1_neo -K₁.sbsb.1.7kb sense and pcDNA1_neo -K₁.sbsb.1.7kb antisense. To demonstrate ACAT expression, the plasmids, together with pcDNA_neo as a control, were transiently transfected into AC29 cells. As shown in Table 4,transfection of pcDNA1_neo -K₁.sbsb.1.7kb sense dramatically increased the rate of cholesterol ester synthesis in AC29 cells, with values equal to 60% of those found in 25-RA cells. The plasmid minimally increased the rate of phospholipid synthesis. Control plasmids exhibited no similar effects. Plasmid pcDNA1_neo -K₁.sbsb.1.7kb sense also increased the rate of cholesterol ester synthesis in stable transfectant cells, approximately 20% of values found in 25-RA cells, without altering the rates of phospholipid synthesis.

                                  TABLE 4                                 
__________________________________________________________________________
Transient Transfection of Plasmids Containing                             
pcDNA1.sub.neo Vector and K1.sub.1.7kb                                    
cDNA as Insert into ACAT Deficient Mutant (Clone AC29)                    
                         Relative Rate of                                 
         Relative Rate of Cholesterol                                     
                         Phospholipid                                     
         Ester Synthesis In Intact Cells                                  
                         Synthesis In Intact Cells                        
         A. Third day after                                               
                 B. Fifth Day after                                       
                         A. Third day after                               
                                 B. Fifth day after                       
DNA Mixture                                                               
         Transfection                                                     
                 Transfection                                             
                         Transfection                                     
                                 Transfection                             
__________________________________________________________________________
pcDNA1.sub.neo                                                            
          1.0.sup.a                                                       
                 1.0.sup.b                                                
                          1.0.sup.c                                       
                                  1.0.sup.d                               
pcDNA1.sub.neo -K1.sub.1.7kb                                              
         0.9     .07     1.0     1.0                                      
(antisense)                                                               
pcDNA1.sub.neo -K1.sub.1.7kb                                              
         103     91*     1.7     1.4                                      
(sense)                                                                   
__________________________________________________________________________
 .sup.a 1.0 = 29 dpm/min/mg                                               
 .sup.b 1.0 = 45 dmp/min/mg                                               
 .sup.c 1.0 = 1404 dpm/min/mg                                             
 .sup.d 1.0 = 164 dpm/min/mg                                              
 *60.5% of value found in 25RA                                            

The method of Hason et al. ((1991) Somatic Cell and Mol. Genetics 17:413-417) was used to perform transfection. 0.3×10⁶ cells per 25 cm² flask were seeded in medium A for 24 h. 3 ml of fresh medium A with 100 μM Chloroquine was then added for 2 h before the transfection. For each flask, 3 μg of pcDNA1_neo DNA or 5 μg of pcDNA1_neo -K₁.sbsb.1.7kb DNA was used in transfection. Incubation was at 37° C. for 16 h. Transfection cells were grown in medium A +500 μg.ml G418 for 3 or 5 days and were then subjected to ³ H-oleate pulse assay in duplicate flasks. The construction of pcDNA1_neo -K₁.sbsb.1.7kb plasmids was described in Experimental Procedures.

As shown in FIG. 4., the K₁ cDNA contains a single open reading frame (ORF) (residues 1397-3046) 1650 bps in length and a predicted 64,805 dalton protein. This ORF is designated as ACAT K₁ protein. The second and third nucleotides before the putative first ATG codon and the one after it conformed to the Kozak sequences (Kozak, 1984). An in-frame stop codon was found 150 nucleotides upstream from the first ATG codon.

Hydrophobicity analysis of the hypothetical ACAT K₁ protein indicates that it contains at least two potential transmembrane α-helices located at amino acids 132-155 and 460-483 (FIG. 7). This analysis supports the conclusion that ACAT K₁ is an integral membrane protein. The polypeptide regions at amino acids 215-235, 320-340, and 355-380 are also very hydrophobic, yet these regions seem to be rich in β-sheet structure (panel B of FIG. 7), therefore, these regions may not contain transmembrane helices. One potential N-glycosylation site (Gavel and von Heijne, (1990) Protein Engineering 3:433-442) was identified (indicated by the symbol ** in FIG. 4). In contrast, the classic phosphorylation sites recognized by different protein kinases including c-AMP-dependent protein kinase and protein kinase C (reviewed in Kemp and Pearson, (1990) Trends in Biochem. Sci. 15: 342-346), could not be clearly identified. In addition, the proposed motif (Jackson and Peterson, (1990) The EMBO J. 9: 3153-3162) for retention of certain transmembrane proteins in the endoplasmic reticulum as well as the motif (Petrou et al., (1993) Trends in Biochem. Sci. 18:41-42) for the fatty acid binding domain of certain intracellular lipid binding proteins could not be identified.

Tissue Distribution of ACAT K₁ Gene Transcripts

The human tissue distribution of K₁ gene transcripts was examined using ³² P-cDNA C1 as the probe. The results (not shown) indicate that it cross-hybridized with poly(A)⁺ RNAs of various discrete sizes, with strong signals at approx. 3 and 4 kb and with weak signals at approx. 4.7 and 7.4 kb. While the intensities varied, these signals were found in poly (A)⁺ RNAs of virtually all of the tissues reported here.

Example V. Homology With Other Enzymes

Protein homology analysis shows that the entire predicted ACAT K₁ protein sequence shares a 48% homology with human fatty acid ligase (Abe et al., (1992) J. Biochem. 111:123-129). In addition, further analysis shows that the predicted K₁ protein contains five separate stretches of linear sequences (TNLIEKSASLDNGGCALTT, GRLVLEFSLLSYAF, GFGPTY, GYVAMKFAQVFGCF, and ARVLVLCVFNSILPGVL, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9 underlined in the protein coding region of FIG. 9) which share significant homology (42%, 57%, 80%, 57%, and 58% respectively, based on firefly luciferase sequences) with the newly identified "signature sequences" (Babbitt et al., (1992) Biochemistry 31: 5594-5604). These signature sequences include three separate segments of peptides and are present in at least twelve different enzymes including firefly luciferase and fatty acid ligase. These enzymes participate in various metabolic functions, and show one common feature--all are involved in the catalysis of acyl adenylate formation followed by acyl thioester formation and subsequent acyl transfer. This analysis suggests that these enzymes share common catalytic mechanisms, and these "signature sequences" constitute part(s) of the active site(s) of these enzymes. Within the ACAT K₁ protein sequence, two different stretches of peptides share homology with the "signature sequence" region #1 (amino acids 193-212 of luciferase), one stretch of peptides shares homology with signature sequence region #2 (amino acids 338-344 of luciferase), while two other stretches of peptides shared homology with the "signature sequence" region #3 (amino acids 338-401 of luciferase).

This finding is important for at least two reasons. First, it suggests that, in addition to functioning as a fatty acyl coenzyme A:cholesterol acyltransferase, the ACAT enzyme may also possess enzymatic activity mechanistically very similar to that of fatty acid: coenzyme A ligase, as well as those of the other enzymes listed in Table 1 of the Babbitt et al. article, supra. Second, this information provides an important clue for designing specific ACAT inhibitors based on known catalytic mechanisms utilized by these enzymes. For example, it should now be possible to design specific ACAT inhibitors based on structural characteristics of various inhibitors already known to inhibit the active site(s) of any of the enzymes listed in Table 1 of the Babbitt, et al. article, supra.

Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the following claims.

__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 9                                              
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 996 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
GAAACCCTGCAAAGGAGTCCCTAGAGACACCTAGTAATGGTCGAATTGACATAAAACAGT60            
TGATAGCAAAGAAGATAAAGTTGACAGCAGAGGCAGAGGAATTGAAGCCATTTTTTATGA120           
AGGAAGTTGGCAGTCACTTTGATGATTTTGTGACCAATCTCATTGAAAAGTCAGCATCAT180           
TAGATAATGGTGGGTGCGCTCTCACAACCTTTTCTGTTCTTGAAGGAGAGAAAAACAACC240           
ATAGAGCGAAGGATTTGAGAGCACCTCCAGAACAAGGAAAGATTTTTATTGCAAGGCGCT300           
CTCTCTTAGATGAACTGCTTGAAGTGGACCACATCAGAACAATATATCACATGTTTATTG360           
CCCTCCTCATTCTCTTTATCCTCAGCACACTTGTAGTAGATTACATTGATGAAGGAAGGC420           
TGGTGCTTGCAAGTTACGCCTCCTGTCTTATGCATTTTGGCAAATTTCCTACCGTTGTTT480           
GGACCTGGTGGATCATGTTCCTGTCTACATTTTCAGTTCCCTATTTTCTGTTTCAACATT540           
GGCGCACTGGCTATAGCAAGAGTTCTCATCCGCTGATCCGTTCTCTCTTCCATGGCTTTC600           
TTTTCATGATCTTCCAGATTGGAGTTCTAGGTTTTGGACCAACATATGTTGTGTTAGCAT660           
ATCCTGCCACCAGCTTCCCGGTTCATCATTATTCGAGCAGATCGTTTTGTAATGAAGGCC720           
CACTCATTTGTCAGAGAGAACGTGCCTCGGGTACTAATTCAGCTAAGGAGAAATCAAGCA780           
CTGTTCCAATACCTACAGTCAACCAGTATTTGTACTTCTTATTTGCTCCTACCCTTATCT840           
ACCGTGACAGCTATCCCAGGAATCCCACTGTAAGATGGGGTTATGTTGCTATGAAGTTTG900           
CACAGGTCTTTGGTTGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCCT960           
TGTTTCGGAATATCAAACAGGAGCCCTTCAGCGCTC996                                   
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4079 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
GGGTAGAGACGGGGTTTCACCGTGTTAGCCAGGATGGTCTGGATCTCCTGACCTCGTGAT60            
CCACCCACCTCGGCCTCCTAAAGTGCTGGGATTACAGACATGAGCCACCGCGCCCAGCCC120           
TATTCATCCCTTTTCAAAAGTCAGACCCTAGGAAGCTGGAGGGAGGTGGGGCATGGTTTT180           
ACAGTGAATTTCTGATTTCACTCAGGGTGATAAATCAGACTCTTGGGGAAGCGGGTGGTG240           
GCTCTGGACAGCAGCAGGAATGGGGATCCAGTTAGCAACAAATCCATGGACCTATGACAG300           
GCTGAAAGCCACCCCTTCTCCATCTTTGGGAGGTTGCCAATGTCTGATTTAACACTATCC360           
AATGAATGATCATTGAAAGTAAAAAATAACTATCAACTAGCAGAAAATATAAATGGTAAG420           
CATTAGCACATATTTCACATGTTTATATTTGGCTCTCAGATTGACCTATAAAACAAAGTC480           
TGGGAAATTCTATATGATCCTGAAAAAATGATACGCTGGTCTGGATGGTAGAATAAGTTG540           
GAGAAATGTTTAAGCCAAAATGCAGTCTTACCAATGACTTTTTATTTTATTTTATTAATT600           
TTCAGGATTTTTGGTATACAGGTGGTTTTTGGTTACATGGAAAAGTTCTTTACTGGTGAT660           
TTCTGAGATTTTAGTTCACCCCTTATCCTGAGCAGTGTACACTGTTCCCAATATGTAGCC720           
TTTTATCCCTCACCCCCTCTAAGTTCAAGAAGACTATGGTCCTGCAGAAAGCTTTATATG780           
TAATTAACATATCTTTATCTTTATCTTTATAGGCAGTAGACTCATCTTTTGAAACAGATT840           
CCATTAAGAGTGAATGTGTACCCTCCCTCTAGCCTTTATTATTACTGTTTTTGCTATTAC900           
ATGTGTTAGTGTATGTGAATTTAATGCTTAAAAATGTATCCCATTGGCTACTATGGCAAA960           
AGGTTGACTCATAAGAGTTTAGCACGGGTTAAGATCTGAAAGTTTTCTNNCCCAGCCTCT1020          
TATCACTGGCNAGACTTCACAATTCATGGAAGCCACCAGTGAGATGACATTAGCACGGGT1080          
AGTCGATTTGCAGCCTCTTATCACTGNNNNAGACTTCACAATTCATGGAACAGGAATGAC1140          
ATTTCGCTCAGGCAGTTACTGTTTTTATATTCTATAACTCGAGGAGCTCAGGGCTTTCGG1200          
AAATCATTAAACTTTCCTTGTCCTTTTAAAGTTGGAGCCAGCAATTGTAGACAGCCTTCC1260          
AGTGGGTTATCTTTTTGTGTCTCCTTACCTGTGGAGAAGCCTATTAGCTGGATATATTAT1320          
TAAATAGCTATATTTATATATATCCAGGGCACCCGAATTCGGGAGAGCTTCCCGGAGTCG1380          
ACCTTCCTGCTGGCTGCTCTGTGACGCTTCCCGCTCTGCCCTCTTGGCCGAAGTCGCGCT1440          
GCCGGGCGCGGGCCTCAGACAATACAATGGTGGGTGAAGAGAAGATGTCTCTAAGAAACC1500          
GGCTGTCAAAGTCCAGGGAAAATCCTGAGGAAGATGAAGACCAGGAGAAACCCTGCAAAG1560          
GAGTCCCTAGAGACACCTAGTAATGGTCGAATTGACATAAAACAGTTGATAGCAAAGAAG1620          
ATAAAGTTGACAGCAGAGGCAGAGGAATTGAAGCCATTTTTTATGAAGGAAGTTGGCAGT1680          
CACTTTGATGATTTTGTGACCAATCTCATTGAAAAGTCAGCATCATTAGATAATGGTGGG1740          
TGCGCTCTCACAACCTTTTCTGTTCTTGAAGGAGAGAAAAACAACCATAGAGCGAAGGAT1800          
TTGAGAGCACCTCCAGAACAAGGAAAGATTTTTATTGCAAGGCGCTCTCTCTTAGATGAA1860          
CTGCTTGAAGTGGACCACATCAGAACAATATATCACATGTTTATTGCCCTCCTCATTCTC1920          
TTTATCCTCAGCACACTTGTAGTAGATTACATTGATGAAGGAAGGCTGGTGCTTGCAAGT1980          
TACGCCTCCTGTCTTATGCATTTTGGCAAATTTCCTACCGTTGTTTGGACCTGGTGGATC2040          
ATGTTCCTGTCTACATTTTCAGTTCCCTATTTTCTGTTTCAACATTGGCGCACTGGCTAT2100          
AGCAAGAGTTCTCATCCGCTGATCCGTTCTCTCTTCCATGGCTTTCTTTTCATGATCTTC2160          
CAGATTGGAGTTCTAGGTTTTGGACCAACATATGTTGTGTTAGCATATCCTGCCACCAGC2220          
TTCCCGGTTCATCATTATTCGAGCAGATCGTTTTGTAATGAAGGCCCACTCATTTGTCAG2280          
AGAGAACGTGCCTCGGGTACTAATTCAGCTAAGGAGAAATCAAGCACTGTTCCAATACCT2340          
ACAGTCAACCAGTATTTGTACTTCTTATTTGCTCCTACCCTTATCTACCGTGACAGCTAT2400          
CCCAGGAATCCCACTGTAAGATGGGGTTATGTTGCTATGAAGTTTGCACAGGTCTTTGGT2460          
TGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCCTTGTTTCGGAATATC2520          
AAACAGGAGCCCTTCAGCGCTCGTGTTCTGGTCCTATGTGTATTTAACTCCATCTTGCCA2580          
GGTGTGCTGATTCTCTTCCTTACTTTTTTTGCCTTTTTGCACTGCTGGCTCAATGCCTTT2640          
GCTGAGATGTTACGCTTTGGTGACAGGATGTTCTATAAGGATTGGTGGAACTCCACGTCA2700          
TACTCCAACTATTATAGAACCTGGAATGTGGTGGTCCATGACTGGCTATATTACTATGCT2760          
TACAAGGACTTTCTCTGGTTTTTCTCCAAGAGATTCAAATCTGCTGCCATGTTAGCTGTC2820          
TTTGCTGTATCTGCTGTAGTACACGAATATGCCTTGGCTGTTTGCTTGAGCTTTTTCTAT2880          
CCCGTGCTGTTCGTGCTCTTCATGTTCTTTGGAATGGCTTTCAACTTCATTGTCAATGAT2940          
AGTCGGAAAAAGCCGATTTGGAATGTTCTGATGTGGACTTCTCTTTTCTTGGGCAATGGA3000          
GTCTTACTCTGCTTTTATTCTCAAGAATGGTATGCACGTCGGCACTGTACCTCTGAAAAA3060          
TCCCACATTTTTGGATTATGTCCTGTCACGTTCCTGGACTTGTCGTTACGTGTTTTAGAA3120          
GCTTGGACTTTGTTTCCTCCTTGTCACTGAAGATTGGGTAGCTCCCTGATTTGGAGCCAG3180          
CTGTTTCCAGTTGTTACTGAAGTTATCTGTGTTATTTGGACCACTCCAGGCTTTACAGAT3240          
GACTCACTCCATTCCTAGGTCACTTGAAGCCAAACTGTTGGAAGTTCACTGGAGTCTTGT3300          
ACACTTAAGCAGAGGAGAACTTTTTTTGTGGGGCTGGGTGGGGGGAGAAGACCGACTAAC3360          
AGCTGAAGTAATGACAGATTGTTGCTGGGTCATATCAGCTTTATCCCTTGGTAATTATAT3420          
CTGTTTTGTTTCTTGACTCTGTCCAATCAGAGAATAAACATCATAGTTTCTTGGCCACTG3480          
AATTAGCCAAAACACTTAGGAAGAAATCACTTAAATACCTCTGGCTTAGAAATTTTTTCA3540          
TGCACACTGTTGGAATGTATGCTAATTGAACATGCAATTGGGGAAGAAAAAATTAGAATG3600          
ATTTTTGCTATTTCTAGTAGAAAGAAAATGTCTGTTTTCCAAAGATAATGTTATACATCC3660          
TATTTTGTAATTTTTTTGAAAAAAGTTCAATGTTCAGTTTTCCTTAGTTTTTACCTTGTT3720          
TTCTCTATAGGTCAGTATTTCTGTGAAGCAAAAAGATGCCTTTTACCATGAATTCTTGAG3780          
TTTACATCAATAATATTGTATATTAAGGGGATCAGAAGTAGGAAGGAAAAAATAAGAGAT3840          
AGCAGAGGAAAAAGAAAAACATTTCCTCTTATAACTTCTGAAGTAATTTGTAAAAAAGAT3900          
TTGTAGAGTCAATCATGTGTTTAAATTATTTTATCACAAACTTAACATGGAAGATATTCC3960          
TTTTTAACTTTGTGGTAACTTCTTTGAAGTTATTTAGAAATATCCTTTGGAACAATTATT4020          
TTATTGTCTAATAAATATTGACTTCTCTTGAATTATTTTGCAGACTAGTGAGTCTGTAC4079           
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 4011 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 1397..3046                                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
GGGTAGAGACGGGGTTTCACCGTGTTAGCCAGGATGGTCTGGATCTCCTGACCTCGTGAT60            
CCACCCACCTCGGCCTCCTAAAGTGCTGGGATTACAGACATGAGCCACCGCGCCCAGCCC120           
TATTCATCCCTTTTCAAAAGTCAGACCCTAGGAAGCTGGAGGGAGGTGGGGCATGGTTTT180           
ACAGTGAATTTCTGATTTCACTCAGGGTGATAAATCAGACTCTTGGGGAAGCGGGTGGTG240           
GCTCTGGACAGCAGCAGGAATGGGGATCCAGTTAGCAACAAATCCATGGACCTATGACAG300           
GCTGAAAGCCACCCCTTCTCCATCTTTGGGAGGTTGCCAATGTCTGATTTAACACTATCC360           
AATGAATGATCATTGAAAGTAAAAAATAACTATCAACTAGCAGAAAATATAAATGGTAAG420           
CATTAGCACATATTTCACATGTTTATATTTGGCTCTCAGATTGACCTATAAAACAAAGTC480           
TGGGAAATTCTATATGATCCTGAAAAAATGATACGCTGGTCTGGATGGTAGAATAAGTTG540           
GAGAAATGTTTAAGCCAAAATGCAGTCTTACCAATGACTTTTTATTTTATTTTATTAATT600           
TTCAGGATTTTTGGTATACAGGTGGTTTTTGGTTACATGGAAAAGTTCTTTACTGGTGAT660           
TTCTGAGATTTTAGTTCACCCCTTATCCTGAGCAGTGTACACTGTTCCCAATATGTAGCC720           
TTTTATCCCTCACCCCCTCTAAGTTCAAGAAGACTATGGTCCTGCAGAAAGCTTTATATG780           
TAATTAACATATCTTTATCTTTATCTTTATAGGCAGTAGACTCATCTTTTGAAACAGATT840           
CCATTAAGAGTGAATGTGTACCCTCCCTCTAGCCTTTATTATTACTGTTTTTGCTATTAC900           
ATGTGTTAGTGTATGTGAATTTAATGCTTAAAAATGTATCCCATTGGCTACTATGGCAAA960           
AGGTTGACTCATAAGAGTTTAGCACGGGTTAAGATCTGAAAGTTTTCTCCCAGCCTCTTA1020          
TCACTGGCGCAGACTTCACAATTCATGGAAGCCACCAGTGAGATGACATTGCCTCAGGCA1080          
GTTACTATTTTTATATTCTATAACTCGAGGAGCTCAGGGTTTCGGAAATCATTAAACTTT1140          
TTTTGTCCTTTTAAAGTTGGAGACAGCAATTGTAGACAGCCTTCCAGTGGGTTATCTTTT1200          
TGTGTCTCCTTACCTGTGGAGAAGCCTATTAGCTGGGATATGTAGTTAAATAGCTATATT1260          
TATATATATCCAGGGCACCCCGAATTCGGGAGAGCTTCCCGGAGTCGACCTTCCTGCTGG1320          
CTGCTCTGTGACCGCTTCCCGGCTCTGCCCTCTTGGCCGAAGTGCCCGCTGCCGGGCGCG1380          
GGCCTCAGACAATACAATGGTGGGTGAAGAGAAGATGTCTCTAAGAAAC1429                     
MetValGlyGluGluLysMetSerLeuArgAsn                                         
1510                                                                      
CGGCTGTCAAAGTCCAGGGAAAATCCTGAGGAAGATGAAGACCAGAGA1477                      
ArgLeuSerLysSerArgGluAsnProGluGluAspGluAspGlnArg                          
152025                                                                    
AACCCTGCAAAGGAGTCCCTAGAGACACCTAGTAATGGTCGAATTGAC1525                      
AsnProAlaLysGluSerLeuGluThrProSerAsnGlyArgIleAsp                          
303540                                                                    
ATAAAACAGTTGATAGCAAAGAAGATAAAGTTGACAGCAGAGGCAGAG1573                      
IleLysGlnLeuIleAlaLysLysIleLysLeuThrAlaGluAlaGlu                          
455055                                                                    
GAATTGAAGCCATTTTTTATGAAGGAAGTTGGCAGTCACTTTGATGAT1621                      
GluLeuLysProPhePheMetLysGluValGlySerHisPheAspAsp                          
60657075                                                                  
TTTGTGACCAATCTCATTGAAAAGTCAGCATCATTAGATAATGGTGGG1669                      
PheValThrAsnLeuIleGluLysSerAlaSerLeuAspAsnGlyGly                          
808590                                                                    
TGCGCTCTCACAACCTTTTCTGTTCTTGAAGGAGAGAAAAACAACCAT1717                      
CysAlaLeuThrThrPheSerValLeuGluGlyGluLysAsnAsnHis                          
95100105                                                                  
AGAGCGAAGGATTTGAGAGCACCTCCAGAACAAGGAAAGATTTTTATT1765                      
ArgAlaLysAspLeuArgAlaProProGluGlnGlyLysIlePheIle                          
110115120                                                                 
GCAAGGCGCTCTCTCTTAGATGAACTGCTTGAAGTGGACCACATCAGA1813                      
AlaArgArgSerLeuLeuAspGluLeuLeuGluValAspHisIleArg                          
125130135                                                                 
ACAATATATCACATGTTTATTGCCCTCCTCATTCTCTTTATCCTCAGC1861                      
ThrIleTyrHisMetPheIleAlaLeuLeuIleLeuPheIleLeuSer                          
140145150155                                                              
ACACTTGTAGTAGATTACATTGATGAAGGAAGGCTGGTGCTTGAGTTC1909                      
ThrLeuValValAspTyrIleAspGluGlyArgLeuValLeuGluPhe                          
160165170                                                                 
AGCCTCCTGTCTTATGCTTTTGGCAAATTTCCTACCGTTGTTTGGACC1957                      
SerLeuLeuSerTyrAlaPheGlyLysPheProThrValValTrpThr                          
175180185                                                                 
TGGTGGATCATGTTCCTGTCTACATTTTCAGTTCCCTATTTTCTGTTT2005                      
TrpTrpIleMetPheLeuSerThrPheSerValProTyrPheLeuPhe                          
190195200                                                                 
CAACATTGGCGCACTGGCTATAGCAAGAGTTCTCATCCGCTGATCCGT2053                      
GlnHisTrpArgThrGlyTyrSerLysSerSerHisProLeuIleArg                          
205210215                                                                 
TCTCTCTTCCATGGCTTTCTTTTCATGATCTTCCAGATTGGAGTTCTA2101                      
SerLeuPheHisGlyPheLeuPheMetIlePheGlnIleGlyValLeu                          
220225230235                                                              
GGTTTTGGACCAACATATGTTGTGTTAGCATATACACTGCCACCAGCT2149                      
GlyPheGlyProThrTyrValValLeuAlaTyrThrLeuProProAla                          
240245250                                                                 
TCCCGGTTCATCATTATATTCGAGCAGATTCGTTTTGTAATGAAGGCC2197                      
SerArgPheIleIleIlePheGluGlnIleArgPheValMetLysAla                          
255260265                                                                 
CACTCATTTGTCAGAGAGAACGTGCCTCGGGTACTAAATTCAGCTAAG2245                      
HisSerPheValArgGluAsnValProArgValLeuAsnSerAlaLys                          
270275280                                                                 
GAGAAATCAAGCACTGTTCCAATACCTACAGTCAACCAGTATTTGTAC2293                      
GluLysSerSerThrValProIleProThrValAsnGlnTyrLeuTyr                          
285290295                                                                 
TTCTTATTTGCTCCTACCCTTATCTACCGTGACAGCTATCCCAGGAAT2341                      
PheLeuPheAlaProThrLeuIleTyrArgAspSerTyrProArgAsn                          
300305310315                                                              
CCCACTGTAAGATGGGGTTATGTCGCTATGAAGTTTGCACAGGTCTTT2389                      
ProThrValArgTrpGlyTyrValAlaMetLysPheAlaGlnValPhe                          
320325330                                                                 
GGTTGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCC2437                      
GlyCysPhePheTyrValTyrTyrIlePheGluArgLeuCysAlaPro                          
335340345                                                                 
TTGTTTCGGAATATCAAACAGGAGCCCTTCAGCGCTCGTGTTCTGGTC2485                      
LeuPheArgAsnIleLysGlnGluProPheSerAlaArgValLeuVal                          
350355360                                                                 
CTATGTGTATTTAACTCCATCTTGCCAGGTGTGCTGATTCTCTTCCTT2533                      
LeuCysValPheAsnSerIleLeuProGlyValLeuIleLeuPheLeu                          
365370375                                                                 
ACTTTTTTTGCCTTTTTGCACTGCTGGCTCAATGCCTTTGCTGAGATG2581                      
ThrPhePheAlaPheLeuHisCysTrpLeuAsnAlaPheAlaGluMet                          
380385390395                                                              
TTACGCTTTGGTGACAGGATGTTCTATAAGGATTGGTGGAACTCCACG2629                      
LeuArgPheGlyAspArgMetPheTyrLysAspTrpTrpAsnSerThr                          
400405410                                                                 
TCATACTCCAACTATTATAGAACCTGGAATGTGGTGGTCCATGACTGG2677                      
SerTyrSerAsnTyrTyrArgThrTrpAsnValValValHisAspTrp                          
415420425                                                                 
CTATATTACTATGCTTACAAGGACTTTCTCTGGTTTTTCTCCAAGAGA2725                      
LeuTyrTyrTyrAlaTyrLysAspPheLeuTrpPhePheSerLysArg                          
430435440                                                                 
TTCAAATCTGCTGCCATGTTAGCTGTCTTTGCTGTATCTGCTGTAGTA2773                      
PheLysSerAlaAlaMetLeuAlaValPheAlaValSerAlaValVal                          
445450455                                                                 
CACGAATATGCCTTGGCTGTTTGCTTGAGCTTTTTCTATCCCGTGCTG2821                      
HisGluTyrAlaLeuAlaValCysLeuSerPhePheTyrProValLeu                          
460465470475                                                              
TTCGTGCTCTTCATGTTCTTTGGAATGGCTTTCAACTTCATTGTCAAT2869                      
PheValLeuPheMetPhePheGlyMetAlaPheAsnPheIleValAsn                          
480485490                                                                 
GATAGTCGGAAAAAGCCGATTTGGAATGTTCTGATGTGGACTTCTCTT2917                      
AspSerArgLysLysProIleTrpAsnValLeuMetTrpThrSerLeu                          
495500505                                                                 
TTCTTGGGCAATGGAGTCTTACTCTGCTTTTATTCTCAAGAATGGTAT2965                      
PheLeuGlyAsnGlyValLeuLeuCysPheTyrSerGlnGluTrpTyr                          
510515520                                                                 
GCACGTCGGCACTGTCCTCTGAAAAATCCCACATTTTTGGATTATGTC3013                      
AlaArgArgHisCysProLeuLysAsnProThrPheLeuAspTyrVal                          
525530535                                                                 
CGGCCACGTTCCTGGACTTGTCGTTACGTGTTTTAGAAGCTTGGACTTTGTTT3066                 
ArgProArgSerTrpThrCysArgTyrValPhe                                         
540545550                                                                 
CCTCCTTGTCACTGAAGATTGGGTAGCTCCCTGATTTGGAGCCAGCTGTTTCCAGTTGTT3126          
ACTGAAGTTATCTGTGTTATTTGGACCACTCCAGGCTTTACAGATGACTCACTCCATTCC3186          
TAGGTCACTTGAAGCCAAACTGTTGGAAGTTCACTGGAGTCTTGTACACTTAAGCAGAGC3246          
AGAACTTTTTTTGTGGGGCTGGGTGGGGGGAGAAGACCGACTAACAGCTGAAGTAATGAC3306          
AGATTGTTGCTGGGTCATATCAGCTTTATCCCTTGGTAATTATATCTGTTTTGTTTCTTG3366          
ACTCTGTCCAATCAGAGAATAAACATCATAGTTTCTTGGCCACTGAATTAGCCAAAACAC3426          
TTAGGAAGAAATCACTTAAATACCTCTGGCTTAGAAATTTTTTCATGCACACTGTTGGAA3486          
TGTATGCTAATTGAACATGCAATTGGGGAAGAAAAAATGTAGAATGATTTTTGCTATTTC3546          
TAGTAGAAAGAAAATGTCTGTTTTCCAAAGATAATGTTATACATCCTATTTTGTAATTTT3606          
TTTGAAAAAAGTTCAATGTTCAGTTTTCCTTAGTTTTTACCTTGTTTTCTCTATAGGTCA3666          
TGATTTCTGTGAAGCAAAAAGATGCCTTTTACCATGAATTCTTGAGTTTACATCAATAAT3726          
ATTGTATATTAAGGGGATCAGAAGTAGGAAGGAAAAAATAAGAGATAGCAGAGGAAAAAG3786          
AAAAACATTTCCTCTTATAACTTCTGAAGTAATTTGTAAAAAAGATTTGTAGAGTCAATC3846          
ATGTGTTTAAATTATTTTATCACAAACTTAACATGGAAGATATTCCTTTTTAACTTTGTG3906          
GTAACTTCTTTGAAGTTATTTAGAAATATCCTTTGGAACAATTATTTTATTGTCTAATAA3966          
ATATTGACTTCTCTTGAATTATTTTGCAGACTAGTGAGTCTGTAC4011                         
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 550 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
MetValGlyGluGluLysMetSerLeuArgAsnArgLeuSerLysSer                          
151015                                                                    
ArgGluAsnProGluGluAspGluAspGlnArgAsnProAlaLysGlu                          
202530                                                                    
SerLeuGluThrProSerAsnGlyArgIleAspIleLysGlnLeuIle                          
354045                                                                    
AlaLysLysIleLysLeuThrAlaGluAlaGluGluLeuLysProPhe                          
505560                                                                    
PheMetLysGluValGlySerHisPheAspAspPheValThrAsnLeu                          
65707580                                                                  
IleGluLysSerAlaSerLeuAspAsnGlyGlyCysAlaLeuThrThr                          
859095                                                                    
PheSerValLeuGluGlyGluLysAsnAsnHisArgAlaLysAspLeu                          
100105110                                                                 
ArgAlaProProGluGlnGlyLysIlePheIleAlaArgArgSerLeu                          
115120125                                                                 
LeuAspGluLeuLeuGluValAspHisIleArgThrIleTyrHisMet                          
130135140                                                                 
PheIleAlaLeuLeuIleLeuPheIleLeuSerThrLeuValValAsp                          
145150155160                                                              
TyrIleAspGluGlyArgLeuValLeuGluPheSerLeuLeuSerTyr                          
165170175                                                                 
AlaPheGlyLysPheProThrValValTrpThrTrpTrpIleMetPhe                          
180185190                                                                 
LeuSerThrPheSerValProTyrPheLeuPheGlnHisTrpArgThr                          
195200205                                                                 
GlyTyrSerLysSerSerHisProLeuIleArgSerLeuPheHisGly                          
210215220                                                                 
PheLeuPheMetIlePheGlnIleGlyValLeuGlyPheGlyProThr                          
225230235240                                                              
TyrValValLeuAlaTyrThrLeuProProAlaSerArgPheIleIle                          
245250255                                                                 
IlePheGluGlnIleArgPheValMetLysAlaHisSerPheValArg                          
260265270                                                                 
GluAsnValProArgValLeuAsnSerAlaLysGluLysSerSerThr                          
275280285                                                                 
ValProIleProThrValAsnGlnTyrLeuTyrPheLeuPheAlaPro                          
290295300                                                                 
ThrLeuIleTyrArgAspSerTyrProArgAsnProThrValArgTrp                          
305310315320                                                              
GlyTyrValAlaMetLysPheAlaGlnValPheGlyCysPhePheTyr                          
325330335                                                                 
ValTyrTyrIlePheGluArgLeuCysAlaProLeuPheArgAsnIle                          
340345350                                                                 
LysGlnGluProPheSerAlaArgValLeuValLeuCysValPheAsn                          
355360365                                                                 
SerIleLeuProGlyValLeuIleLeuPheLeuThrPhePheAlaPhe                          
370375380                                                                 
LeuHisCysTrpLeuAsnAlaPheAlaGluMetLeuArgPheGlyAsp                          
385390395400                                                              
ArgMetPheTyrLysAspTrpTrpAsnSerThrSerTyrSerAsnTyr                          
405410415                                                                 
TyrArgThrTrpAsnValValValHisAspTrpLeuTyrTyrTyrAla                          
420425430                                                                 
TyrLysAspPheLeuTrpPhePheSerLysArgPheLysSerAlaAla                          
435440445                                                                 
MetLeuAlaValPheAlaValSerAlaValValHisGluTyrAlaLeu                          
450455460                                                                 
AlaValCysLeuSerPhePheTyrProValLeuPheValLeuPheMet                          
465470475480                                                              
PhePheGlyMetAlaPheAsnPheIleValAsnAspSerArgLysLys                          
485490495                                                                 
ProIleTrpAsnValLeuMetTrpThrSerLeuPheLeuGlyAsnGly                          
500505510                                                                 
ValLeuLeuCysPheTyrSerGlnGluTrpTyrAlaArgArgHisCys                          
515520525                                                                 
ProLeuLysAsnProThrPheLeuAspTyrValArgProArgSerTrp                          
530535540                                                                 
ThrCysArgTyrValPhe                                                        
545550                                                                    
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(v) FRAGMENT TYPE: internal                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
ThrAsnLeuIleGluLysSerAlaSerLeuAspAsnGlyGlyCysAla                          
151015                                                                    
LeuThrThr                                                                 
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 14 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(v) FRAGMENT TYPE: internal                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
GlyArgLeuValLeuGluPheSerLeuLeuSerTyrAlaPhe                                
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 6 amino acids                                                 
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(v) FRAGMENT TYPE: internal                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
GlyPheGlyProThrTyr                                                        
15                                                                        
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 14 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(v) FRAGMENT TYPE: internal                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
GlyTyrValAlaMetLysPheAlaGlnValPheGlyCysPhe                                
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(v) FRAGMENT TYPE: internal                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
AlaArgValLeuValLeuCysValPheAsnSerIleLeuProGlyVal                          
151015                                                                    
Leu                                                                       
__________________________________________________________________________

Claims (5)

What is claimed is:

1. Isolated and purified human acyl coenzyme A:cholesterol acyltransferase (ACAT), or a fragment thereof, retaining enzymatic ACAT activity.

2. The isolated and purified human acyl coenzyme A:cholesterol acyltransferase of claim 1 produced by recombinant DNA techniques from the nucleic acid sequence selected from the group consisting of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, and fragments thereof, retaining enzymatic activity.

3. The isolated and purified enzymatically active acyl coenzyme A:cholesterol acyltransferase of claim 1 having an amino acid sequence containing a linear sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and a fragment of said ACAT retaining enzymatic activity.

4. The isolated biologically active acyl coenzyme A:cholesterol acyltransferase of claim 1 produced by recombinant DNA techniques from the nucleic acid sequence shown in SEQ ID NO:3 and a fragment thereof retaining enzymatic activity.

5. Purified enzymatically active acyl coenzyme A:cholesterol acyltransferase having the amino acid sequence shown in SEQ ID NO: 4, and fragments thereof retaining enzymatic activity.

Images