Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS5683657 A
Publication typeGrant
Application numberUS 08/464,081
Publication date4 Nov 1997
Filing date5 Jun 1995
Priority date24 Mar 1994
Fee statusLapsed
Also published asCA2186340A1, EP0752009A1, WO1995025815A1
Publication number08464081, 464081, US 5683657 A, US 5683657A, US-A-5683657, US5683657 A, US5683657A
InventorsAlec Mian
Original AssigneeGamera Bioscience, Corp.
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
DNA meltometer
US 5683657 A
The invention provides an apparatus, termed a DNA meltometer, for the efficient, accurate, and reliable automated performance of DNA sizing, quantitating, probing and sequencing techniques, and methods for using the apparatus in clinical and diagnostic applications for the rapid diagnosis of pathological and disease states.
Previous page
Next page
We claim:
1. An nucleic acid analysis apparatus comprising, in combination,
a thermomodulating chamber, wherein a temperature is defined, and wherein the thermomodulating chamber comprises a first opening and a second opening, wherein each of the openings is connected with a pumping means for passing a buffer solution through the thermomodulating chamber;
heating and cooling means that are in thermal contact with the thermomodulating chamber, for controlling the temperature of the thermomodulating chamber further comprising a nucleic acid retaining means; and
a detecting means for detecting thermally-denatured double-stranded DNA at a temperature that is about the Tm of each nucleic acid to be analyzed, wherein the detecting means is connected to one of the openings in the thermomodulating chamber to allow the buffer solution to flow from the thermomodulating chamber and past the detecting means, and thereby sizing, quantitating, probing or sequencing the nucleic acid.
2. The apparatus of claim 1 wherein the detecting means is a fluorescence detector.
3. The apparatus of claim 1 wherein the detecting means is an ultraviolet spectrophotometer.
4. The apparatus of claim 1 wherein the nucleic acid retaining means comprises means for retaining DNA fragments labeled with a tethering molecule.
5. The apparatus of claim 4 wherein the double-stranded DNA retaining means is a Teflon® filter.
6. The apparatus of claim 4 wherein the double-stranded DNA retaining means is an externally-applied magnetic field.

This is a divisional of application Ser. No. 08/218,030, filed Mar. 24, 1994.


1. Field of the Invention

The invention relates to the fields of medical diagnostics and medical genetics, particularly with respect to molecular biological methods relevant to those fields. In particular, the invention provides methods and an apparatus for sizing, quantitating, probing and sequencing DNA fragments relevant to disease-related genetic polymorphisms and pathological organisms, cells and tissues. Specifically, the invention provides an apparatus, termed a DNA meltometer, for efficient, accurate, and reliable automated performance of DNA sizing, quantitating, probing and sequencing, and methods for using the apparatus in clinical and diagnostic applications for the rapid diagnosis of pathological and disease states.

2. Summary of the Related Art

In the fields of medical genetics and diagnostics, a variety of disease states are characterized by the presence of specific nucleic acids. In inherited diseases, for example, certain specific mutant genes are present in the genomic DNA of an individual. The reduced or absence of expression of the gene product of such specific mutant genes, or the expression of a mutant, non-functional gene product, or a gene product with altered or impaired function, causes or contributes to oven pathology or disease in the individual (see Striver et al., 1989, The Metabolic Basis of Inherited Disease, McGraw-Hill, N.Y.). In infectious diseases, the presence of nucleic acid from the disease-causing organism is indicative of the presence of a disease or the imminent or eventual occurrence of the disease even in the absence of immediate symptoms. One important example is infection with human immunodeficiency virus, which infection frequently antedates the appearance of the symptoms of acquired immunodeficiency syndrome by many years (see Fauci, 1988, Science 239: 617-622). A second category of diseases that are not genetic in origin are the so-called environmentally-induced dims. Such diseases are caused by toxic, antigenic or nutritional effects of environmental toxins and other insults on cells and tissues. The resulting molecular pathologies may be identified through the detection of alterations in patterns of gene expression in affected cells and tissues. Thus, specific detection of such indicative nucleic acids has potential as an important diagnostic tool for the clinician.

Over the last decade, research in human genetics has undergone enormous advances, and in over one hundred human diseases a genetic lesion has been identified associated with the disease (Antonarakis, 1989, N. Engl. J. Med. 320: 153-163). The techniques used in the discovery and characterization of these disease-associated DNA polymorphisms include: (1) in vitro amplification of specific nucleic acid sequences, particularly using the polymerase chain reaction; (2) separation and sizing of nucleic acid fragments using gel electrophoresis; (3) detection of particular nucleic acid fragments amongst a multiplicity of such fragments by specific hybridization of nucleic acid bound to various membranes (so-called "Southern" and "Northern" hybridizations); and (4) determination of nucleotide sequences by degradative or, more frequently, synthetic sequencing methods (see Sambrook et al., 1990, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. for a detailed description of these techniques).

As robust as these techniques have been in the research laboratory, transfer of these technologies to the clinical lab has proven to be difficult. In particular, automation and standardization of these techniques to routine clinical and diagnostic applications has been slow. This is due in pan to the fact that all of these techniques typically have involved agarose or polyacrylamide gel electrophoresis as a final characterization step. Gel electrophoresis, while effective in the research setting, is cumbersome, difficult to automate and requires skilled laboratory personnel to perform. In addition, gel electrophoresis techniques typically involve the use of hazardous chemicals, such as ethidium bromide (which is mutagenic) and acrylamide (a neurotoxin), radioactivity, and/or hazardous conditions, such as high voltages (up to 4000V) or the use of ultraviolet transilluminators. In addition, visualization of specific DNA fragments separated in gels usually requires photographic equipment, a darkroom, and X-ray film developing equipment, all of which makes these techniques less economical to use and increases the level of skill required to reliably perform these analyses.

There is thus a need in the clinical diagnostic arts for a simple, robust and easily-automated alternative to gel electrophoresis which could be used by technicians having considerably less skill in the molecular biological arts than is required to perform the currently available gel electrophoretic methods. Even within the molecular biological arts, certain areas of ongoing, important research, including the Human Genome Project (see Olson et al., 1989, Science 245: 1434-1435) are limited in the rate at which advances can be achieved by the amount of time consumed using currently-available, electrophoresis-based nucleic acid size separating methods. Advantageous features of an alternative to these methods include rapid "run" times, ease of use, high throughput, and automated operation by conventionally-trained clinical laboratory technical personnel.


The present invention provides a "gel-free" nucleic acid detection and characterization system, comprising an apparatus and methods for using the apparatus to size, quantitate, probe and sequence nucleic acid without the use of gel electrophoresis. The invention provides nucleic acid detection in a single, easy-to-use, automatable instrument, termed a DNA meltometer. The meltometer is comprised of the following components, in operative combination: a thermomodulating chamber in which the temperature can be accurately, reliably and rapidly adjusted to any temperature between about 15° C. and 95°-100° C.; temperature controllers including heating elements and cooling or refrigeration units in thermal contact with the thermomodulating chamber for adjusting the temperature in the thermomodulating chamber; and a detector for detecting thermal denaturation of double-stranded DNA or RNA:DNA hybrids, i.e., for detecting single-stranded DNA or RNA produced as the result of thermal denaturation of double-stranded DNA or RNA:DNA hybrids. Optionally and advantageously, the meltometer is also comprised of a data-processing device and an interface whereby the data-processor controls the operation of the other components of the apparatus and collects, records and stores data produced by operation of the apparatus. Also optionally included in the components of the meltometer is a pump for moving a liquid buffer solution through the thermomodulating chamber, preferably arranged to cause a flow of buffer through the thermomodulating chamber and past the detector; in such embodiments of the apparatus of the invention, the thermomodulating chamber advantageously has a first opening and a second opening, whereby buffer flows into the chamber through the first opening and out from the chamber through the second opening, which second opening is connected with or attached to the detector.

The apparatus and methods provided by the invention are useful for: (a) sizing nucleic acids ranging in length from about 50 to about 500 basepairs (bps) in length; (b) quantitating an amount of a specific DNA fragment, either alone or in a mixture of heterologous DNA fragments; (c) detecting a specific nucleotide sequence of a nucleic acid among a plurality of non-specific nucleotide sequences by hybridization to a sequence-specific nucleic acid probe; and (d) detecting a nested set of extended nucleic acid sequencing oligonucleotides ranging in length from about 20 to about 100 nucleotides, each extended oligonucleotide having at its 3' extent a polymerase chain-terminating compound, thereby providing for gel-free nucleotide sequencing of nucleic acids.

The present invention is based on the following technical considerations. Nuclei acids have conventionally been characterized by gel electrophoresis on the basis of their physical size, the most important parameter of which is length. Apart from physical size, another property characteristic of any double-stranded nucleic acid is the temperature at which the two complimentary strands dissociate from one another. This property, termed the melting temperature, Tm, is defined as the temperature at which 50% of the nucleic acid molecules have dissociated into their component single strands. The Tm of a given small (less than approximately 600 basepairs) nucleic acid is known to depend on two factors: the size (i.e., length) of the fragment, and the sequence and base composition of the fragment. Size contributes to Tm because the longer a nucleic acid is, the more hydrogen-bonded basepairs it contains, which thereby require more thermal energy to be broken apart. Base composition effects are due to the fact that G.tbd.C basepairs are more stable than A.tbd.T basepairs because they share more inter-strand hydrogen bonds between the basepairs. Base sequence effects are due to the fact that the bases interact with one another within each strand in a manner that stabilizes the double-stranded conformation.

The use of various formulae to predict the Tm of a DNA duplex of known length and base composition is well known in the art. The instant invention for the first time provides an apparatus and methods for using the Tm of a DNA fragment to identify its length and (in some embodiments of the methods of the invention) its base composition.

The effects of base composition and sequence on Tm can be removed by the use of isostabilizing compounds. These compounds bind specifically to GC or AT basepairs, and act to destabilize or stabilize, respectively, the hydrogen bonding between the basepairs. In the presence of isostabilizers, the Tm of some nucleic acid fragments becomes a function solely of its length. In addition, isostabilizers sharpen the melting transition, thereby increasing the resolution of detection of different nucleic acid fragments which differ in length, for example, by even a single nucleotide.

Specific preferred embodiments of the present invention will become evident from the following more detailed description of certain preferred embodiments and the claims.


FIG. 1 illustrates the structure and operation of the thermomodulating chamber of the DNA meltometer, wherein 1 represents the direction of flow of temperature-controlled buffer, 2 represents tethered DNA, consisting of 3 an immobilized strand and 4 a detectably-labeled thermally-denatured, detectably-labeled, single-stranded DNA or RNA molecule and 8 represents a tethered DNA retainer.

FIG. 2 illustrates an automated embodiment of the DNA meltometer, wherein 5 represents the thermomodulating chamber, 6 represents the detector, 9 represents a pump for moving buffer through the thermomodulating chamber 5, 10 represents a buffer reservoir, 11 represents a data-processor for controlling operation of the apparatus and 12 represents an interface enabling the computer to control operation of the apparatus and to collect and store data produced by the apparatus.


The present invention provides an apparatus, termed a DNA meltometer, for gel-free sizing, quantitating, probing and sequencing nucleic acid fragments, preferably double-stranded DNA fragments. The DNA meltometer is based on the principle that the Tm of a DNA fragment under the appropriate conditions is essentially a function of the length of the DNA fragment. Methods for sizing, quantitating, probing and sequencing DNA fragments, in the absence or in the presence of isostabilizing compounds, are also provided by the invention.

The apparatus is comprised of an thermomodulating chamber (5 in FIG. 1) for containing a buffer solution of a double-stranded nucleic acid such as DNA wherein the DNA is thermally denatured therein. Exemplary embodiments of such an thermomodulating chamber include a thin-walled polypropylene tube contained within a heating block comprised of a heat-conducting material, which embodiment advantageously is limited to a single use to avoid the possibility of cross-contamination of samples. Another embodiment of the thermomodulating chamber component of the meltometer is a cell or chamber comprised of heat-conducting material and defining a cavity having at least one opening for inserting a sample and flushing such a sample after each sample determination. Advantageously, the thermomodulating chamber of the meltometer has a first and second opening, allowing the flow of a liquid buffer solution, a liquid sample-containing solution or any other liquid solution through the chamber. In such embodiments of the meltometer are included a pump (9 in FIG. 2) for moving buffer from a buffer reservoir (10 in FIG. 2) through the thermomodulating chamber and past a detector (6 in FIGS. 1 & 2). An example of a pump useful in this embodiment of the DNA meltometer is a high pressure liquid chromatography pump (available from Beckman Scientific Instruments, Fullerton, Calif.). In additional embodiments, the thermomodulating chamber is defined by a number of sample wells allowing multiple determinations to be made sequentially or contemporaneously.

In certain embodiments, the thermomodulating chamber is also comprised of a double-stranded nucleic acid retainer (8 in FIG. 1). Exemplary retainers include but are not limited to Teflon® filters for retaining nucleic acid fragments that have been tethered to latex beads. Another example of an advantageously-used retainer is an external magnetic field generator for retaining nucleic acid fragments that have been tethered to ferrous metal-binding agents, such as transferrin or paramagnetic beads (available from Dynal, Oslo, Norway).

The thermomodulating chamber of the meltometer is in thermal contact with temperature controlling devices such as heating elements and/or cooling or refrigerating units for regulating the temperature within the chamber. A variety of such temperature regulating units are known to those with skill in this art, including but not limited to metallic heating strips, cooling fans, refrigeration units, and the like. In particular, temperature regulators are known which are capable of regulating temperature to within ±1° C., more preferably ±0.1° C., and most preferably +0.01° C. (an example of which is a temperature controller available from Eppendorf, Hamburg, Germany).

Thermal-denaturation of nucleic acid, comprising the dissociation of a double-stranded nucleic acid into single-stranded DNA or RNA, is detected using a detector (6 in FIGS. 1 & 2) that detects a physical property unique to the single-stranded conformer of a DNA fragment. Such properties may be detected by essentially three categories of detectors: direct detectors, semi-direct detectors and indirect detectors. Direct detection of thermal denaturation can be achieved, for example, using a calorimeter to detect the heat of dissociation released when a double-stranded nucleic acid denatures into its component single strands. Another example of direct detection is spectrophotometric detection. In this detection method, what is detected is the increase in absorbance of ultraviolet light at a wavelength of 260 mm that is associated with thermal denaturation (the so-called denaturation hyperchromicity effect). Such direct methods will be understood by those with skill in the art to be limited by the requirement of nanomoles (˜1014 molecules) of target nucleic acid.

Semi-direct methods of thermal denaturation detection include detection of the binding or dissociation of single- or double-strand conformation specific dyes and intercalating compounds. Thus, for example, thermal denaturation may be detected by the increase in the effective concentration of a spectrophotometrically-detectable double-strand specific dye, binding moiety or intercalating compound. Typically, these types of dyes absorb or emit light at a certain wavelength in a way that depends on whether or not the dye is bound to, associated with or intercalated into a double-stranded DNA molecule. Using these types of dyes, the amount of the dye that is bound to, associated with or intercalated into a double-stranded DNA molecule can be detected by the increase (or decrease) in absorbance or emission of light at the appropriate wavelength as the DNA molecule is thermally denatured. Alternatively, thermal denaturation may be detected by the decrease in the effective concentration of a spectrophotometrically-detectable single-strand specific dye, binding moiety or intercalating compound. These dyes are similar to double-strand specific dyes in that the amount of light absorbed or emitted at a particular and characteristic wavelength depends on whether or not the dye is bound to, associated with or intercalated into a single-stranded DNA molecule. Thus, using these types of dyes, the amount of the dye that is bound to, associated with or intercalated into a single-stranded DNA molecule can be detected by the increase (or decrease) in absorbance or emission of light at the appropriate wavelength as the amount of single-stranded DNA increases with thermal denaturation of the double-stranded DNA. More complex "sandwich"-type systems are known, wherein additional specific binding components are involved in intermediate steps between thermal denaturation and the increase or decrease in the effective concentration of a detectable dye, binding moiety or intercalator. In such systems, the binding or release of either a dye or an intermediate specific binding moiety is detected spectrophotometrically by the increase or decrease in the effective concentration of the detectable dye. A variety of useful nucleic acid-specific dye compounds are known, including, for example, ethidium bromide, or preferably, DAPI, Hoechst 33258, and, most preferably, TOTO/YOYO (Molecular Probes, Eugene, Oreg.). The use of this latter dye enables detection of as little as femtomoles (˜109 molecules) of target nucleic acid (see Glazer & Hays, 1992, Nature 359: 8591.

Indirect detection methods include, but are not limited to, fluorescence or infrared spectrophotometry of fluorescently- or infrared-tagged single-stranded DNA or RNA. Fluorescence detection is preferably used in embodiments of the meltometer comprising flow of a liquid buffer solution through the thermomodulating chamber and past the detector, under conditions and using an thermomodulating chamber wherein undenatured nucleic acid is retained within the thermomodulating chamber. An example of such an arrangement is shown in FIG. 1. In this example of indirect detection using the apparatus of the invention, a liquid buffer solution, preferably an aqueous buffer solution such as standard citrate saline (SSC; see Sambrook et al., 1990, ibid.) is made to flow (wherein 1 represents the direction of flow of temperature-controlled buffer) through the thermomodulating chamber 5 at a temperature that is initially below the Tm of the particular DNA fragment of interest. In the chamber is a sample of tethered DNA 2 retained therein by a retainer 8. The tethered double-stranded DNA consists of an immobilized strand 3 and a detectably-labeled, preferably a fluorescently- or infrared-labeled strand 4. As the temperature in the thermomodulating chamber is increased, the DNA denatures at a characteristic temperature (the Tm) and the detectably-labeled strand is moved by the flow of buffer from the thermomodulating chamber 5 past a detector 6, where it is detected as a thermally-denatured, fluorescently- or infrared-labeled, single-stranded DNA or RNA molecule 7. The use of fluorescence-based or infrared-based indirect detection methods can enable detection of 1000-2000 molecules in solution (Middendoff et al., 1992, Electrophoresis 13: 487), or even of a single molecule (Davis et al., 1991, GATA 8: 1), theoretically.

In the use of the meltometer provided by the invention, nucleic acid to be sized, quantitated, probed or sequenced is advantageously modified to comprise a tethering molecule on one strand. Incorporation of such a tethering molecule provides a way to retain the double-stranded nucleic acid in the thermomodulating chamber and to prevent detection of undenatured DNA by the detector. This is accomplished by tethering, anchoring or immobilizing the double-stranded nucleic acid inside the thermomodulating chamber. The undenatured DNA may be anchored, tethered or immobilized to the thermomodulating chamber itself, or more preferably to a retainer (8 in FIG. 1) within the thermomodulating chamber. Advantageous combinations of tethering molecules and retainers include but are not limited to biotinylated nucleic acids linked to streptavidin-coated latex or glass beads, and retained within the thermomodulating chamber by a Teflon® membrane. Also included in such advantageous embodiments of the invention are nucleic acids linked to a magnetic metal, with or without the use of a chelating moiety such as porphyrin or ferritin, and retained within the thermomodulating chamber by the application of an external magnetic field. Tethering molecules can be added to the double stranded nucleic acid by replacement synthesis, hybridization, chemical modification or during in vitro chemical synthesis or in vitro amplification.

In the use of the meltometer provided by the invention, nucleic acid to be sized, quantitated, probed or sequenced is advantageously modified to comprise a detectable label on the one strand. Incorporation of such a detectable label provides a way to detect denaturation of the double-stranded nucleic acid. One non-limiting example of a preferred detectable label is a fluorescent label such as fluorescein or rhodamine, or an infrared label such as a polymethine dye. Detectable label molecules can be added to the double stranded nucleic acid by replacement synthesis, hybridization, chemical modification or during in vitro chemical synthesis or in vitro amplification. Also included in this aspect of the invention is the non-covalent incorporation of a detectable label into the double-stranded nucleic acid, for example, intercalation of single-strand or double-strand conformation-specific detectable dyes. Examples of such nucleic acid conformation-specific dye molecules include but are not limited to ethidium bromide, or preferably, DAPI, Hoechst 33258, and, most preferably, TOTO/YOYO.

In addition and advantageously, the solution within the buffer chamber is comprised of a isostabilizing compound. Exemplary isostabilizing compounds include betaine, sarcosine, taurine, glycerol, TMAO, TMACl, TEACl, among others, the isostabilizing properties of which are disclosed in accompanying Table I.

              TABLE I______________________________________                        fold   change in Tm                        sharpening                               of calf               effective                        of melting                               thymus DNAisostabilizers   compound type               molarity transition                               (°C.)______________________________________saltsTMACl1   alkylammonium               3        5      +23TEACl1,2   alkylammonium               2.4      5      -10osmolytesbetaine3,4   zwitterion  5.2      4      -15sarcosine4   zwitterion  NA       --     --taurine4   zwitterion  NA       --     --TMAO4   methylamine NA       --     --glycerol4   polyhydric  NA       --     --   alcohol______________________________________ Data Sources: 1 Wood et al (1985) Proc. Natl. Acad. Sci. USA 82: 1585-1588 2 Melchior, WB and von Hippi PH (1973) Proc. Natl. Acad. Sci. USA 70 298-302 3 Rees, et al (1993) Biochemistry 32: 137-144 4 Yancey et al (1982) Science 217: 1214-1222

Use of such isostabilizing compounds is advantageous because these compounds increase the degree to which the Tm of a nucleic acid is proportional to its length (see Wood et al., 1985, Proc. Natl. Acad. Sci USA 82: 1585-1588). In addition, isostabilizing compounds of the invention act to sharpen the melting transition, i.e. they act to decrease the range of temperature over which a double-stranded nucleic acid changes from being essentially completely double stranded to being essentially completely single stranded (see Rees et al., 1992, Biochemistry 32: 137). This feature is advantageous because it results in increased resolution of different nucleic acids that differ by, at the limit, a single basepair, such as the nested set of extended oligonucleotides which represent the products of a DNA replacement-synthesis sequencing reaction.

The DNA meltometer is provided in a preferred embodiment as an automated apparatus. A schematic diagram of this embodiment of the meltometer is shown in FIG. 2. In this embodiment, the operational steps are controlled by an interface unit (12 in FIG. 2), preferably an I/O interface such as, for example, an Omega OM-900 unit, controlled by a dam-processor (11 in FIG. 2), such as a computer. Operational steps include control of the temperature regulating units, control of the flow rate of buffer through the thermomodulating chamber, and control of the detection of thermal denaturation by the detector. Also a feature of this preferred embodiment of the meltometer is the use of the computer to acquire, record and store data generated by operation of the apparatus.

The DNA meltometer provided by the invention is useful to enable gel-free sizing, quantitating, probing and sequencing of nucleic acids. The method of sizing a nucleic acid fragment, for example, a DNA fragment, provided by the invention comprises the steps of placing a solution comprising the DNA fragment in the thermomodulating chamber of the meltometer at a temperature less than the thermal-denaturation temperature of the DNA fragment. The temperature of the thermomodulating chamber is then incrementally raised linearly and stringently (±0.01° to 1° C.) at a rate sufficient to detect and resolve denaturation of the DNA fragment. Thermal denaturation of the DNA fragment is thereby detected. In preferred embodiments, one strand of the DNA fragment is linked to a tethering molecule and retained in the thermomodulating chamber via a retainer. The other strand of the fragment is linked to a detectable label that is, for example, a fluorescent label or an infrared label. The thermomodulating chamber is advantageously arranged to have a first and second opening whereby buffer flows through the thermomodulating chamber during the course of thermal denaturation. The thermally-denatured single-stranded, fluorescently- or infrared-labeled DNA molecules flow past the detector as the result of buffer flow from through the thermomodulating chamber, and are thereby detected. In an advantageous modification of this method, a set of DNA size marker fragments are added to the thermomodulating chamber. Such marker fragments are preferably differentially labeled such that the detector can discriminate between each of the marker fragments and the sample DNA fragment. The size of the DNA sample fragment is then determined by comparison with a standard curve prepared using the thermal denaturation temperatures detected for each of the DNA marker fragments.

The method of quantitating a DNA fragment comprises the additional step of calculating the amount of the DNA fragment detected by the detector. In one embodiment, the amount of the fragment detected is quantitated from the total intensity of the detected labeled DNA, using algorithms well-known in the art such as Beers' law to relate the absorbance at a particular wavelength to the amount of the absorbing substance.

The method of probing a nucleic acid fragment, for example, a DNA fragment, to specifically detect a particular DNA fragment from among a multiplicity of DNA fragments provided by the invention comprises the following steps. One strand of each of the multiplicity of double-stranded DNA fragments is linked to a tethering molecule. A solution of a multiplicity of tethered double-stranded DNA fragments is then placed in the thermomodulating chamber of the meltometer in the presence of a retainer, so that the multiplicity of double-stranded DNA fragments are retained in the thermomodulating chamber. The temperature of the thermomodulating chamber is then raised to a temperature sufficient to thermally denature the multiplicity of DNA fragments. Alternatively, thermal denaturation can be accomplished prior to addition of the DNA sample to the thermomodulating chamber. This thermal denaturation results in there being a multiplicity of single-stranded DNA fragments present in the thermomodulating chamber that are targets for later hybridization with a sequence-specific probe. A detectably-labeled nucleic acid probe is then hybridized to the multiplicity of DNA fragments in a hybridization solution, said probe being preferably an oligonucleotide that specifically hybridizes to the particular DNA fragment of interest among the multiplicity of DNA fragments, at a temperature sufficient to allow said hybridization to occur. Excess probe is then removed from the thermomodulating chamber and the temperature in the thermomodulating chamber then incrementally raised linearly and stringently (±0.01° to 1° C.) at a rate sufficient to detect and resolve denaturation of the hybridized oligonucleotide probe from the particular DNA fragment of interest. The thermally-denatured oligonucleotide probe is then detected by the detector. In preferred embodiments, one strand of the multiplicity of DNA fragments is linked to a tethering molecule and retained in the thermomodulating chamber via a retainer. The oligonucleotide is linked to a detectable label that is a fluorescent label or an infrared label. The thermomodulating chamber is arranged to have a first and second opening whereby buffer flows through the thermomodulating chamber during the course of thermal denaturation. The thermally-denatured oligonucleotide, fluorescently- or infrared-labeled probe then flows past the detector as the result of buffer flow through the thermomodulating chamber and is thereby detected.

The method of sequencing a nucleic acid fragment, for example, a DNA fragment, as provided by the invention comprises the following steps. One strand of each of a multiplicity of double-stranded DNA fragments is linked to a tethering molecule and a solution of the multiplicity of tethered double-stranded DNA fragments is placed in the thermomodulating chamber of the meltometer in the presence of a retainer, so that the multiplicity of double-stranded DNA fragments are retained in the thermomodulating chamber. The temperature of the thermomodulating chamber is then raised to a temperature sufficient to thermally denature the multiplicity of DNA fragments. Alternatively, thermal denaturation can be accomplished prior to addition of the DNA sample to the thermomodulating chamber. This thermal denaturation results in there being a multiplicity of single-stranded DNA fragments present in the thermomodulating chamber that are targets for later hybridization with a sequence-specific probe. An oligonucleotide sequencing primer that specifically hybridizes to the DNA fragment at a site in the nucleotide sequence of the DNA fragment adjacent to the site to be sequenced is then annealed to the denatured DNA. This annealing step is performed at a temperature sufficient to allow annealing of the primer to the template DNA to occur. Conventional dideoxynucleotide/replacement synthesis nucleic acid sequencing reactions are then performed to create a nested set of extended oligonucleotides hybridized to the DNA fragment. The temperature in the thermomodulating chamber is then incrementally raised linearly and stringently (±0.01° to 1° C.) at a rate sufficient to detect and resolve denaturation of each of the nested set of extended oligonucleotides hybridized to the DNA fragment of interest. Each species of the nested set of the extended oligonucleotides is then detected by the detector in a temporal sequence that reflects the nucleotide sequence of the DNA fragment. In preferred embodiments, one strand of the multiplicity of DNA fragments, i.e., the strand complimentary to the oligonucleotide primer, is linked to a tethering molecule and retained in the thermomodulating chamber via a retainer. Each of the nested set of extended oligonucleotides is detectably labeled at the 3' terminus by a fluorescently-labeled or an infrared-labeled dideoxy terminator residue. Optionally and advantageously, each of the dideoxynucleotides can be differentially labeled so as to be individually detectable by the detector. The thermomodulating chamber is arranged to have a first and second opening whereby buffer flows through the thermomodulating chamber during the course of thermal denaturation. Each of the thermally-denatured, fluorescently- or infrared-labeled extended oligonucleotides then flows past the detector as the result of buffer flow through the thermomodulating chamber and is thereby detected in a temporal sequence that reflects the nucleotide sequence of the DNA fragment.

The following Examples are intended to further illustrate certain preferred embodiments of the invention and are not limiting in nature.

EXAMPLE 1 Detecting, Sizing and Quantitating a Specific PCR Product using the DNA Meltometer

Polymerase chain reactions are performed using standard techniques. A DNA sample comprising the DNA template to be amplified is mixed at a final concentration of about 104 molecules/reaction in a reaction mixture containing a first oligonucleotide PCR primer of between 15 and 30 nucleotides, that is homologous to a DNA sequence flanking the DNA fragment to be amplified, and that is labeled at the 5' end with a tethering molecule such as biotin. Also in the reaction mixture is a second oligonucleotide PCR primer of between 15 and 30 nucleotides, that is homologous to a DNA sequence flanking the DNA fragment to be amplified, and on the strand opposite to the strand homologous to the first PCR primer, said second PCR primer being labeled at the 5' end with a fluorescent molecule such as rhodamine or fluorescein or an infrared label such as a polymethine dye. Each of the PCR primers is present in the reaction mixture at a final concentration of 1 μM. The reaction mixture also contains: (1) a DNA polymerase such as the thermostable polymerase from T. aquaticus (available from Perkin Elmer-Cetus, Emeryville, Calif.) at a final concentration of 1-5U/reaction; (2) each of 4 deoxynucleotide triphosphates, at a total dNTP concentration of about 200 μM; and (3) a buffer appropriate for the polymerase enzyme used, the buffer typically containing a magnesium ion salt at a concentration of 1-5 mM.

The DNA fragment is amplified following an amplification protocol involving repeated cycles of denaturation of double-stranded DNA, annealing and polymerase-catalyzed extension of the oligonucleotide primers. Amplification is performed for between 10-40 cycles, or until approximately 50-1500 ng (100 picomole) of the DNA fragment have been produced.

The specific DNA fragment is detected using the DNA meltometer as follows. To the PCR reaction comprising the amplified fragment is added a solution containing streptavidin-coated latex beads of a size sufficient to be retained by a Teflon® filter. After binding of the amplified DNA fragments to the latex beads via the biotinylated end of one strand of each fragment, the mixture of latex bead-bound DNA fragments are placed into the thermomodulating chamber of the meltometer, the chamber containing a Teflon® retaining filter. The thermomodulating chamber is equilibrated to a temperature that is less than the thermal denaturation temperature of the DNA fragment before use, and is typically equilibrated to a temperature of 15° C. The pump is used to generate a flow of a buffer solution through the thermomodulating chamber and past a detector, which is calibrated to detect the fluorescently- or infrared-labeled strand of the DNA fragment. Each of the control steps herein described for performance of the DNA fragment detection is preferably performed by a computer in combination with a I/O interface, and the data generated from the detector is also recorded by the computer to form a permanent record of the experiment.

To detect the specific amplified DNA fragment, the temperature of the thermomodulating chamber is incrementally raised linearly and stringently (±0.01° to 1°0 C.) at a rate sufficient to detect and resolve denaturation of the DNA fragment. Optionally, also contained in the thermomodulating chamber is a set of DNA size marker fragments, wherein each fragment is labeled on one strand with biotin and attached thereby to a streptavidin-coated latex bead, and is labeled on the other strand with a fluorescent label or an infrared label. Also optionally contained in the thermomodulating chamber is an amount of an isostabilizing compound. The DNA fragment is detected by the detection of the appropriate signal by the detector. The accuracy of this determination is increased by a comparison of the observed size of the DNA fragment, relative to the DNA size marker fragments, with the expected size of the DNA fragment.

Additionally, the amount of the specific DNA detected can be determined by integration of the total absorbance of labeled DNA fragments detected, using well-known algorithms for such a purpose. The amount of a particular detected fragment will be related to the total absorbance detected at the appropriate wavelength that is specific for that fragment. The use of specific detectable labels is particularly advantageous for this purpose.

EXAMPLE 2 Detecting Specific Hybridization of DNA with an Oligonucleotide Probe using the DNA Meltometer

Hybridization of a genetic polymorphism-specific probe with human genomic DNA is achieved as follows. DNA from an individual diagnosed as a carrier of the sickle cell anemia trait GTG (Glu6)→GAG (Val6) in the human β-globin gene! is digested with a restriction enzyme that does not destroy the polymorphism and that produces a recessed 3' end of each restriction fragment. The DNA is then labeled with ferritin under standard conditions (see Sambrook et al., ibid.), for example, by performing a fill-in reaction of the 3' recessed end using the Klenow fragment of E. coli DNA polymerase I or T4 DMA polymerase and ferritinylated dUTP.

The ferritinylated DNA sample is first denatured and then placed into the thermomodulating chamber of the meltometer, the chamber being supplied with an external magnetic field generator. Said magnetic field is applied throughout the remaining course of the experiment. An oligonucleotide hybridization probe that is homologous to the sickle cell anemia-associated allele of human β-globin and labeled, for example, at the 5' end, with a fluorescent molecule such as rhodamine or fluorescein or an infrared label such as a polymethine dye, is added to the thermomodulating chamber. The temperature of the thermomodulating chamber is then adjusted to a temperature below the thermal denaturation temperature of the oligonucleotide probe with its homologous site in the human genomic DNA of the DMA sample. Hybridization is performed for an appropriate amount of time to allow the maximum amount of specific hybridization to occur, and then excess unhybridized probe is washed from the thermomodulating chamber using a wash solution typically comprised of 0.1-1% sodium dodecyl sulfate (SDS) in 0.1-2× standard saline citrate (SSC), 1× SSC being comprised of 0.15M NaCl and 0.015M sodium titrate, pH 7.0)!. The pump is used to generate a flow of the washing solution through the thermomodulating chamber and past a detector, which is calibrated to detect the labeled probe. Each of the control steps herein described for performance of the DNA fragment detection is preferably performed by a computer in combination with a I/O interface, and the data generated from the detector is also recorded by the computer to form a permanent record of the experiment.

When the detector no longer detects the passage of any excess unhybridized probe, the temperature of the thermomodulating chamber is incrementally raised linearly and stringently (±0.01° to 1° C.) at a rate sufficient to detect and resolve denaturation of the oligonucleotide probe from the genomic DNA and to allow detection of the denatured DNA probe. The oligonucleotide is detected by the detection of the appropriate signal by the detector. If DNA from an individual heterozygous for the sickle cell anemia trait is used, two distinct thermal denaturation events, occurring at 2 different temperatures, are expected to be detected. The first is the denaturation of the probe from the site of the non-sickle cell anemia-associated allele, which denaturation will occur at the lower temperature because of the presence of a mismatch at the site of the mutation between the genomic DNA and the oligonucleotide probe. The second denaturation event detected will be denaturation of the probe from the site of the sickle cell anemia-associated allele, which denaturation will occur at the higher temperature because of the exact match at the site of the mutation between the genomic DNA and the oligonucleotide probe. Optionally, also contained in the thermomodulating chamber is a set of DNA size marker fragments, wherein each fragment is labeled on one strand with ferritin and retained thereby in the thermomodulating chamber by the externally-applied magnetic field, and is labeled on the other strand with a fluorescent or infrared label. Also optional contained in the thermomodulating chamber is an amount of an isostabilizing compound. The accuracy of this determination is increased by a comparison of the observed size of the DNA fragment, relative to the DNA size marker fragments, with the expected size of the DNA fragment.

EXAMPLE 3 DNA Sequencing using the DNA Meltometer

Dideoxynucleotide/replacement synthesis nucleic acid sequencing of a site of a genetic polymorphism is performed, and a nested set of extended oligonucleotides detected using the DNA meltometer as follows. DNA from an individual diagnosed as a carrier of the genetic polymorphism that causes cystic fibrosis (deletion of the three-base codon encoding Phe463 in the cystic fibrosis transmembrane regulator gene) is digested with a restriction enzyme that does not destroy the polymorphism and that produces a recessed 3' end of each restriction fragment. The DNA is then labeled with biotinylated dUTP by fill-in reaction of the 3' recessed end using the Klenow fragment of E. coli DNA polymerase I or T4 DNA polymerase, under standard conditions (see Sambrook et al., ibid. for details of this protocol). Alternatively, a DNA fragment encompassing the site of the genetic polymorphism is produced by in vitro amplification, for example, as described in Example 1.

The biotinylated DNA sample is then denatured and mixed with streptavidin-coated latex beads and then placed into the thermomodulating chamber of the meltometer, the chamber containing a Teflon® retaining filter. A DNA sequencing oligonucleotide primer that hybridizes to a site flanking the polymorphism in the cystic fibrosis-associated DNA fragment is then added to the thermomodulating chamber. A mixture of a DNA polymerase, the appropriate buffers and unlabeled dNTPs, and each of four differentially fluorescently- or infrared-labeled dideoxynucleotide triphosphates is then added to the thermomodulating chamber, at a temperature that allows the sequencing primer to anneal and the polymerase to incorporate dNTPs and ddNTPs into a set of extended oligonucleotides encompassing the cystic fibrosis polymorphic site. After an appropriate amount of time to allow the maximum amount of oligonucleotide extension to occur, the excess sequencing reaction mixture is flushed from the thermomodulating chamber using the pump to generate a flow of washing solution as in Example 2 above through the thermomodulating chamber and past a detector, which is calibrated to detect each of the labeled ddNTPs. Each of the control steps herein described for performance of the DNA fragment detection is preferably performed by a computer in combination with a I/O interface, and the data generated from the detector is also recorded by the computer to form a permanent record of the experiment.

When the detector no longer detects the passage of any excess free ddNTPs, the temperature of the thermomodulating chamber is incrementally raised linearly and stringently (±0.01° to 1° C.) at a rate sufficient to detect and resolve denaturation of each of the nested set of extended oligonucleotides hybridized to the DNA fragment of interest and to allow detection of the differentially-labeled extended oligonucleotide primers. The extended oligonucleotides are detected by the detection of the appropriate signal by the detector. The DNA sequence is determined by the temporal sequence of the detected signal past the detector. Optionally contained in the thermomodulating chamber is an amount of an isostabilizing compound.

A theoretical thermal denaturation profile for sequencing of the sequence CAGTCCGTAACATCTAGCCGAGGAAGACTCTGCCATGCCAAGGAGC (SEQ ID No.: 1) using the oligonucleotide primer GATCTAGCTATTAG (SEQ ID No. :2) is shown in Table II. The data in this Table were derived as follows. By analyzing nearest-neighbor thermodynamic parameters (see Breslauer et al., 1986, Proc. Natl. Acad. Sci. USA 83: 3746), the increase in Tm (in °C.) of the sequence was determined as single nucleotides were added to the oligonucleotide primer. As can be seen in the Table, in theory about 60 basepairs of DNA sequence can be read using the DNA meltometer over a thermal denaturation profile of 22.5° C. →82.6° C., particularly in view of the fact that temperature regulators are commercially available having a precision of ±0.01° C.

              TABLE II______________________________________Tm °C.      22.5   27.0 29.9 32.2 35.1 40.2______________________________________sequence→   gatctagctattag              c      a    g    t    c    c______________________________________fragment           15                         20size45.8 47.1   47.5   49.2  50.2 52.7 53.2 54.7 56.9 57.9______________________________________g    t      a      a     c    a    t    c    t    a______________________________________                    25                       3058.7 61.1   63.3   66.0  67.0 67.4 69.1 70.0 70.4 70.6______________________________________g    c      c      g     a    g    g    a    a    g______________________________________                    35                       4071.4 71.6   71.8   72.5  72.7 73.8 75.1 76.3 77.3 77.4______________________________________a    c      t      c     t    g    c    c    a    t______________________________________                    45                       5077.5 78.5   79.5   80.4  80.5 80.5 81.3 81.7 81.7 82.6______________________________________g    c      c      a     a    g    g    a    g    c______________________________________                    55                       60______________________________________

It should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 46 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:CAGTCCGTAACATCTAGCCGAGGAAGACTCTGCCATGCCAAGGAGC46(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 14 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:GATCTAGCTATTAG14__________________________________________________________________________
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4029595 *17 Sep 197614 Jun 1977Rca CorporationNovel liquid crystal compounds and electro-optic devices incorporating them
US4588797 *5 Nov 198413 May 1986The Standard Oil CompanyComposition comprising amide, lithium halide and organic sulfone
US5453461 *4 Oct 199326 Sep 1995Bayer AktiengesellschaftBiologically active polymers
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6030115 *2 Jun 199829 Feb 2000Tosoh CorporationMethod of measuring melting temperature of nucleic acid
US657518818 Sep 200110 Jun 2003Handylab, Inc.Methods and systems for fluid control in microfluidic devices
US669270014 Feb 200117 Feb 2004Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US685228712 Sep 20018 Feb 2005Handylab, Inc.Microfluidic devices having a reduced number of input and output connections
US719255714 Dec 200120 Mar 2007Handylab, Inc.Methods and systems for releasing intracellular material from cells within microfluidic samples of fluids
US727078614 Dec 200118 Sep 2007Handylab, Inc.Methods and systems for processing microfluidic samples of particle containing fluids
US732314015 Feb 200229 Jan 2008Handylab, Inc.Moving microdroplets in a microfluidic device
US733213017 Feb 200419 Feb 2008Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US767443112 Sep 20029 Mar 2010Handylab, Inc.Microfluidic devices having a reduced number of input and output connections
US77319062 Aug 20048 Jun 2010Handylab, Inc.Processing particle-containing samples
US78290252 Aug 20049 Nov 2010Venture Lending & Leasing Iv, Inc.Systems and methods for thermal actuation of microfluidic devices
US80435813 Mar 201025 Oct 2011Handylab, Inc.Microfluidic devices having a reduced number of input and output connections
US808861614 Nov 20073 Jan 2012Handylab, Inc.Heater unit for microfluidic diagnostic system
US810578326 Sep 200831 Jan 2012Handylab, Inc.Microfluidic cartridge
US811015814 Oct 20107 Feb 2012Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US813367114 Jul 200813 Mar 2012Handylab, Inc.Integrated apparatus for performing nucleic acid extraction and diagnostic testing on multiple biological samples
US818276323 Jul 200822 May 2012Handylab, Inc.Rack for sample tubes and reagent holders
US821653014 Oct 201010 Jul 2012Handylab, Inc.Reagent tube
US827330830 Oct 200725 Sep 2012Handylab, Inc.Moving microdroplets in a microfluidic device
US828782017 Sep 200816 Oct 2012Handylab, Inc.Automated pipetting apparatus having a combined liquid pump and pipette head system
US832358424 Oct 20114 Dec 2012Handylab, Inc.Method of controlling a microfluidic device having a reduced number of input and output connections
US832390025 Feb 20114 Dec 2012Handylab, Inc.Microfluidic system for amplifying and detecting polynucleotides in parallel
US832437211 Jul 20084 Dec 2012Handylab, Inc.Polynucleotide capture materials, and methods of using same
US841510325 Jan 20129 Apr 2013Handylab, Inc.Microfluidic cartridge
US842001530 Oct 200716 Apr 2013Handylab, Inc.Systems and methods for thermal actuation of microfluidic devices
US84401496 Feb 201214 May 2013Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US84705863 May 200525 Jun 2013Handylab, Inc.Processing polynucleotide-containing samples
US847310422 Jul 201125 Jun 2013Handylab, Inc.Methods and systems for control of microfluidic devices
US86179055 Dec 201131 Dec 2013The Regents Of The University Of MichiganThermal microvalves
US86798319 Feb 201025 Mar 2014Handylab, Inc.Processing particle-containing samples
US86853413 Dec 20121 Apr 2014Handylab, Inc.Microfluidic devices having a reduced number of input and output connections
US870306914 Sep 201222 Apr 2014Handylab, Inc.Moving microdroplets in a microfluidic device
US870978714 Nov 200729 Apr 2014Handylab, Inc.Microfluidic cartridge and method of using same
US87102113 Dec 201229 Apr 2014Handylab, Inc.Polynucleotide capture materials, and methods of using same
US873473313 May 201327 May 2014Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US876507614 Nov 20071 Jul 2014Handylab, Inc.Microfluidic valve and method of making same
US876851724 Jun 20131 Jul 2014Handylab, Inc.Methods and systems for control of microfluidic devices
US885286216 Nov 20057 Oct 2014Handylab, Inc.Method for processing polynucleotide-containing samples
US888349014 Nov 200711 Nov 2014Handylab, Inc.Fluorescence detector for microfluidic diagnostic system
US889494719 Mar 201325 Nov 2014Handylab, Inc.Systems and methods for thermal actuation of microfluidic devices
US902877328 Mar 201412 May 2015Handylab, Inc.Microfluidic devices having a reduced number of input and output connections
US904028826 Mar 200726 May 2015Handylab, Inc.Integrated system for processing microfluidic samples, and method of using the same
US905160423 May 20149 Jun 2015Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US90802073 Dec 201214 Jul 2015Handylab, Inc.Microfluidic system for amplifying and detecting polynucleotides in parallel
US918667714 Jul 200817 Nov 2015Handylab, Inc.Integrated apparatus for performing nucleic acid extraction and diagnostic testing on multiple biological samples
US921714325 Apr 201422 Dec 2015Handylab, Inc.Polynucleotide capture materials, and methods of using same
US922295427 Mar 201429 Dec 2015Becton, Dickinson And CompanyUnitized reagent strip
US92382235 Apr 201319 Jan 2016Handylab, Inc.Microfluidic cartridge
US92597349 Mar 201216 Feb 2016Handylab, Inc.Integrated apparatus for performing nucleic acid extraction and diagnostic testing on multiple biological samples
US925973527 Jun 201416 Feb 2016Handylab, Inc.Methods and systems for control of microfluidic devices
US934758615 Oct 201224 May 2016Handylab, Inc.Automated pipetting apparatus having a combined liquid pump and pipette head system
US9393566 *23 Jun 200819 Jul 2016Canon U.S. Life Sciences, Inc.System and method for temperature referencing for melt curve data collection
US948098318 Dec 20151 Nov 2016Becton, Dickinson And CompanyUnitized reagent strip
US949382226 Aug 201015 Nov 2016Koninklijke Philips Electronics N.V.Devices and methods for microarray selection
US95281425 Jun 201527 Dec 2016Handylab, Inc.Heat-reduction methods and systems related to microfluidic devices
US961813923 Jul 200811 Apr 2017Handylab, Inc.Integrated heater and magnetic separator
US967052824 Mar 20146 Jun 2017Handylab, Inc.Processing particle-containing samples
US20030082535 *7 Mar 20011 May 2003James LeushnerMethod, compositions and kit for detection of microorganisms and bi-directional sequencing of nucleic acid polymers
US20030203387 *21 Apr 200330 Oct 2003Olivier PelletierDNA authentication
US20090318306 *23 Jun 200824 Dec 2009Canon U.S. Life Sciences, Inc.System and method for temperature referencing for melt curve data collection
US20100230334 *12 Nov 200916 Sep 2010Samsung Electronics Co., Ltd.Filter unit for separating target material and microfluidic device including the filter unit
USD66509514 Apr 20117 Aug 2012Handylab, Inc.Reagent holder
USD66919128 Jul 201016 Oct 2012Handylab, Inc.Microfluidic cartridge
USD69216230 Sep 201122 Oct 2013Becton, Dickinson And CompanySingle piece reagent holder
USD74202721 Oct 201327 Oct 2015Becton, Dickinson And CompanySingle piece reagent holder
USD7870878 Feb 201616 May 2017Handylab, Inc.Housing
WO1999009217A1 *14 Aug 199825 Feb 1999Hyseq, Inc.Methods and compositions for detection or quantification of nucleic acid species
U.S. Classification422/68.1, 436/94, 422/82.05, 422/203, 422/82.07
International ClassificationC12Q1/68, B01L7/00, G01N33/58, C12M1/00
Cooperative ClassificationC12Q1/6832, B01L7/52, C12Q1/6827, Y10T436/143333
European ClassificationC12Q1/68B8, B01L7/52, C12Q1/68B6
Legal Events
21 Jul 1999ASAssignment
Effective date: 19990528
3 May 2001FPAYFee payment
Year of fee payment: 4
28 Oct 2004ASAssignment
Effective date: 20041028
12 Nov 2004ASAssignment
Effective date: 20041028
5 Apr 2005FPAYFee payment
Year of fee payment: 8
20 Sep 2006ASAssignment
Effective date: 20000720
Effective date: 20001202
15 Jun 2007ASAssignment
Effective date: 20070615
23 Jul 2007ASAssignment
Effective date: 20070615
29 Jan 2008CCCertificate of correction
11 May 2009REMIMaintenance fee reminder mailed
4 Nov 2009LAPSLapse for failure to pay maintenance fees
22 Dec 2009FPExpired due to failure to pay maintenance fee
Effective date: 20091104