US20040033980A1 - Method of down-regulating gene expression - Google Patents

Method of down-regulating gene expression Download PDF

Info

Publication number
US20040033980A1
US20040033980A1 US10/640,898 US64089803A US2004033980A1 US 20040033980 A1 US20040033980 A1 US 20040033980A1 US 64089803 A US64089803 A US 64089803A US 2004033980 A1 US2004033980 A1 US 2004033980A1
Authority
US
United States
Prior art keywords
oligonucleotide
gene
oligonucleotides
complementary
ribonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/640,898
Inventor
Sudhir Agrawal
Robert Diasio
Ruiwen Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aceragen Inc
Original Assignee
Hybridon Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/328,520 external-priority patent/US5591721A/en
Application filed by Hybridon Inc filed Critical Hybridon Inc
Priority to US10/640,898 priority Critical patent/US20040033980A1/en
Publication of US20040033980A1 publication Critical patent/US20040033980A1/en
Assigned to IDERA PHARMACEUTICALS, INC. reassignment IDERA PHARMACEUTICALS, INC. CERTIFICATE OF OWNERSHIP AND MERGER Assignors: HYBRIDON INC.
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • C12N2310/3125Methylphosphonates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/345Spatial arrangement of the modifications having at least two different backbone modifications
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the control of gene expression. More particularly, this invention relates to the use of synthetic, modified oligonucleotides to down-regulate the expression of a gene in an animal.
  • herpes simplex see, e.g., Gao et al. (1990) Antimicrob. Agents Chem. 34:808-812
  • SV40 see, e.g., Birg et al. (1990) ( Nucleic Acids Res. 18:2901-2908)
  • human papilloma virus see, e.g., Storey et al. (1991) ( Nucleic Acids Res. 19:4109-4114).
  • the use of synthetic oligonucleotides and their analogs as antiviral agents has recently been extensively reviewed by Agrawal ( Trends in Biotech . (1992) 10:152-158).
  • synthetic oligonucleotides have been used to inhibit a variety of non-viral pathogens, as well as to selectively inhibit the expression of certain cellular genes.
  • synthetic oligonucleotides as agents to inhibit virus propagation, propagation of non-viral, pathogens and selective expression of cellular genes has been well established.
  • oligonucleotides have more recently been developed that have greater efficacy in inhibiting such viruses, pathogens and selective gene expression. Some of these oligonucleotides having modifications in their internucleotide linkages have been shown to be more effective than their unmodified counterparts. For example, Agrawal et al. ( Proc. Natl. Acad. Sci . ( USA ) (1988) 85:7079-7083) teaches that oligonucleotide phosphorothioates and certain oligonucleotide phosphoramidates are more effective at inhibiting HIV-1 than conventional phosphodiester-linked oligodeoxynucleotides. Agrawal et al. ( Proc. Natl. Acad. Sci . ( USA ) (1989) 86:7790-7794) discloses the advantage of oligonucleotide phosphorothioates in inhibiting HIV-1 in early and chronically infected cells.
  • chimeric oligonucleotides having more than one type of internucleotide linkage within the oligonucleotide have been developed.
  • Pederson et al. U.S. Pat. Nos. 5,149,797 and 5,220,007 discloses chimeric oligonucleotides having an oligonucleotide phosphodiester or oligonucleotide phosphorothioate core sequence flanked by nucleotide methylphosphonates or phosphoramidates.
  • Furdon et al. Nucleic Acids Res .
  • oligonucleotide hybrids containing 2′-O-methyl ribonucleotides at both the 3′- and 5′ ends and deoxyribonucleotide phosphorothioates in the interior portion were absorbed through the gastrointestinal (GI) tract of rats ( Biochem. Pharm. ( 1995) 50:571-576).
  • the present invention provides a method of down-regulating the expression of a gene in an animal which involves the administration of an oligonucleotide complementary to the gene via an oral route, thereby bypassing the complications which may be experienced during intravenous and other modes of in vivo administration.
  • hybrid oligonucleotides with other than phosphodiester bonds and having at least one 2′-substituted ribonucleotide and chimeric oligonucleotides with at least two different types of internucleotide linkages are relatively stable in vivo following oral administration to an animal, and that these molecules are successfully absorbed from the gastrointestinal tract and distributed to various body tissues.
  • This discovery has been exploited to develop the present invention, which is a method of down-regulating the expression of a gene in an animal.
  • This method is also a means of examining the function of various genes in an animal, including those essential to animal development.
  • gene function can only be examined by the arduous task of making a “knock out” animal such as a mouse. This task is difficult, time-consuming and cannot be accomplished for genes essential to animal development since the “knock out” would produce a lethal phenotype.
  • the present invention overcomes the shortcomings of this model.
  • a pharmaceutical formulation containing an oligonucleotide complementary to the targeted gene is orally administered in a pharmaceutically acceptable carrier to the animal harboring the gene.
  • the oligonucleotide inhibits the expression of the gene, thereby down-regulating its expression.
  • the term “animal” is meant to encompass humans as well as other mammals, as well as reptiles amphibians, and insects.
  • oral administration refers to the provision of the formulation via the mouth through ingestion, or via some other part of the gastrointestinal system including the esophagus.
  • oligonucleotide is meant to include polymers of two or more nucleotides or nucleotide analogs connected together via 5′ to 3′ internucleotide linkages which may include any linkages that are known in the antisense art, including non-phosphodiester linkages. Such molecules have a 3′ terminus and a 5′ terminus.
  • non-phosphodiester-linkages refers to a synthetic covalent attachment between the 5′ end of one nucleotide and the 3′ end of another nucleotide in which the 5′ nucleotide phosphate has been replaced with any number of chemical groups.
  • Preferable synthetic linkages include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphoramidites, phosphate esters, carbamates, carbonates, phosphate triesters, acetamidate, and carboxymethyl esters.
  • all of the nucleotides of the oligonucleotide are linked via phosphorothioate and/or phosphorodithioate linkages.
  • the oligonucleotides administered are modified with other than, or in addition to, non-phosphodiester-internucleotide linkages.
  • modified oligonucleotide encompasses oligonucleotides with modified nucleic acid(s), base(s), and/or sugar(s) other than those found in nature.
  • a 3′,5′-substituted oligonucleotide is an oligonucleotide having a sugar which, at both its 3′ and 5′ positions is attached to a chemical group other than a hydroxyl group (at its 3′ position) and other than a phosphate group (at its 5′ position).
  • a modified oligonucleotide may also be one with added substituents such as diamines, cholestryl, or other lipophilic groups, or a capped species.
  • substituents such as diamines, cholestryl, or other lipophilic groups, or a capped species.
  • unoxidized or partially oxidized oligonucleotides having a substitution in one nonbridging oxygen per nucleotide in the molecule are also considered to be modified oligonucleotides.
  • modified oligonucleotides are oligonucleotides having nuclease resistance-conferring bulky substituents at their 3′ and/or 5′ end(s) and/or various other structural modifications not found in vivo without human intervention are also considered herein as modified.
  • the oligonucleotide being administered in the method of the invention has non-phosphodiester internucleotide linkages and includes at least one 2′-substituted ribonucleotide.
  • the term “2′-substituted oligonucleotide” refers to an oligonucleotide having a sugar attached to a chemical group other than a hydroxyl group at its 2′ position.
  • the 2′-OH of the ribose molecule can be substituted with -O-lower alkyl containing 1-6 carbon atoms, aryl or substituted aryl or allyl having 2-6 carbon atoms, e.g., 2′-O-allyl, 2′-O-aryl, 2′-O-alkyl (such as a 2′-O-methyl), 2′-halo, or 2′-amino, but not with 2′-H, wherein allyl, aryl, or alkyl groups may be unsubstituted or substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl or amino groups.
  • the oligonucleotide administered includes at least one 2′-substituted ribonucleotide at its 3′ terminus. In some embodiments, all but four or five nucleotides at its 5′ terminus are 2′-substituted ribonucleotides, and in some embodiments, these four or five unsubstituted 5′ nucleotides are deoxyribonucleotides.
  • the oligonucleotide has at least one 2′-substituted ribonucleotide at both its 3′ and 5′ termini, and in yet other embodiments, the oligonucleotide is composed of 2′-substituted ribonucleotides in all positions with the exception of at least four or five contiguous deoxyribonucleotide nucleotides in any interior position.
  • Another aspect of the invention includes the administration of an oligonucleotide composed of nucleotides that are all 2′-substituted ribonucleotides.
  • Particular embodiments include oligonucleotides having a 2′-O-alkyl-ribonucleotide such as a 2′-O-methyl.
  • Other embodiments include the administration of chimeric oligonucleotides.
  • the chimeric oligonucleotide has at least one alkylphosphonate internucleotide linkage at both its 3′ and 5′ ends and having phosphorothioate internucleotide linkages.
  • the oligonucleotide administered has at least one deoxyribonucleotide, and in a preferred embodiment, the oligonucleotide has at least four or five contiguous deoxyribonucleotides capable of activating RNase H.
  • the oligonucleotide administered is complementary to a gene of a virus, pathogenic organism, or a cellular gene in some embodiments of the invention.
  • the oligonucleotide is complementary to a gene of a virus involved in AIDS, oral or genital herpes, papilloma warts, influenza, foot and mouth disease, yellow fever, chicken pox, shingles, adult T-cell leukemia, Burkitt's lymphoma, nasopharyngeal carcinoma, or hepatitis.
  • the oligonucleotide is complementary to an HIV gene and includes about 15 to 26 nucleotides linked by phosphorothioate internucleotide linkages, at least one of the nucleotides at the 3′ terminus being a 2′-substituted ribonucleotide, and at least four contiguous deoxyribonucleotides.
  • the oligonucleotide is complementary to a gene encoding a protein associated with Alzheimer's disease.
  • the oligonucleotide is complementary to a gene encoding a protein expressed in a parasite that causes a parasitic disease such as amebiasis, Chagas' disease, toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis, trichomoniasis, malaria, ascariasis, filariasis, trichinosis, or schistosomiasis infections.
  • a parasitic disease such as amebiasis, Chagas' disease, toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis, trichomoniasis, malaria, ascariasis, filariasis, trichinosis, or schistosomiasis infections.
  • FIG. 1 is a graphic representation showing the time course of radiolabelled oligonucleotide in liver, kidney and plasma following the oral administration of radiolabelled phosphorothioate (PS) oligonucleotide 11 (SEQ ID NO:10);
  • PS radiolabelled phosphorothioate
  • FIG. 2A is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of rats at different times following oral administration of PS oligonucleotide;
  • FIG. 2B is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of rats at different times following oral administration of hybrid oligonucleotide;
  • FIG. 3A is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of mice at different times following oral administration of hybrid oligonucleotide;
  • FIG. 3B is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of mice at different times following oral administration of chimeric oligonucleotide;
  • FIG. 4A is an HPLC chromatograph of radiolabelled PS oligonucleotide standard
  • FIG. 4B is an HPLC chromatogram of oligonucleotides extracted from plasma samples taken 12 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 5A is an HPLC chromatogram of radiolabelled PS oligonucleotide standard
  • FIG. 5B is an HPLC chromatogram of oligonucleotides extracted from rat liver 6 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 5C is an HPLC chromatogram of oligonucleotides extracted from rat liver 24 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 6 is a graphic representation demonstrating the time course of urinary excretion of radioactivity in rats following the oral administration of radiolabelled PS oligonucleotide
  • FIG. 7A is an HPLC chromatogram of radiolabelled PS oligonucleotide standard
  • FIG. 7B is an HPLC chromatogram of oligonucleotides extracted from rat urine 6 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 7C is an HPLC chromatogram of oligonucleotides extracted from rat urine 12 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 8 is a graphic representation showing the course of radioactivity in the gastrointestinal tract and feces in rats following the oral administration of radiolabelled PS oligonucleotide;
  • FIG. 9 is an HPLC chromatogram of oligonucleotides extracted from rat stomach 1 hour, 3 hours, and 6 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 10 is an HPLC chromatogram of oligonucleotides extracted from rat large intestine 3 hours, 6 hours, and 12 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 11A is a representation of an autoradiogram of radiolabelled oligonucleotide in the plasma, liver, kidney, spleen, heart, and lung of mice 6 hours following oral administration of hybrid oligonucleotide;
  • FIG. 11B is a representation of an autoradiogram of radiolabelled oligonucleotide in the plasma, liver, kidney, spleen, heart, and lung of mice 6 hours following oral administration of chimeric oligonucleotide;
  • FIG. 12 is a graphic representation of the distribution of radioactivity in GI+feces, plasma, tissue, and urine at various times following oral administration of PS oligonucleotide (30 mg/kg rat), hybrid oligonucleotide (10 mg/kg mouse), and chimeric oligonucleotide (10 mg/kg mouse).
  • This invention provides a method of down-regulating the expression of a gene in an animal by the oral administration of an oligonucleotide whose nucleotide sequence is complementary to the targeted gene.
  • an oligonucleotide can bind to a target single-stranded nucleic acid molecule according to the Watson-Crick or the Hoogsteen rule of base pairing, and in doing so, disrupt the function of the target by one of several mechanisms: by preventing the binding of factors required for normal transcription, splicing, or translation; by triggering the enzymatic destruction of mRNA by RNase H if a contiguous region of deoxyribonucleotides exists in the oligonucleotide, and/or by destroying the target via reactive groups attached directly to the antisense oligonucleotide.
  • oligonucleotides are useful therapeutically by their ability to control or down-regulate the expression of a particular gene in an animal, according to the method of the present invention.
  • the oligonucleotides useful in the method of the invention are at least 6 nucleotides in length, but are preferably 6 to 50, more preferably 11 to 35, most preferably 15 to 30, and commonly 15 to 25 nucleotides in length. They are composed of deoxyribonucleotides, ribonucleotides, or a combination of both, with the 5′ end of one nucleotide and the 3′ end of another nucleotide being covalently linked by non-phosphodiester internucleotide linkages.
  • Such linkages include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters.
  • Oligonucleotides with these linkages can be prepared according to known methods such as phosphoramidate or H-phosphonate chemistry which can be carried out manually or by an automated synthesizer as described by Brown ( A Brief History of Oligonucleotide Synthesis. Protocols for Oligonucleotides and Analogs, Methods in Molecular Biology (1994) 20:1-8).
  • the oligonucleotides of the composition may also be modified in a number of ways without compromising their ability to hybridize to the target nucleic acid.
  • modifications include, for example, those which are internal or at the end(s) of the oligonucleotide molecule and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the viral genome.
  • modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3′,5′-substituted oligonucleotide having a sugar which, at both its 3′ and 5′ positions is attached to a chemical group other than a hydroxyl group (at its 3′ position) and other than a phosphate group (at its 5′ position).
  • Other modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3′ and/or 5′ end(s), or have a substitution in one nonbridging oxygen per nucleotide.
  • Such modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule.
  • modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule.
  • Oligonucleotides which are self-stabilized are also considered to be modified oligonucleotides useful in the methods of the invention (Tang et al. (1993) Nucleic Acids Res. 20:2729-2735). These oligonucleotides comprise two regions: a target hybridizing region; and a self-complementary region having an oligonucleotide sequence complementary to a nucleic acid sequence that is within the self-stabilized oligonucleotide.
  • the oligonucleotides administered to the animal may be hybrid oligonucleotides in that they contain both deoxyribonucleotides and at least one 2′ substituted ribonucleotide.
  • the term “2′-substituted” means substitution at the 2′ position of the ribose with, e.g., a -O-lower alkyl containing 1-6 carbon atoms, aryl or substituted aryl or allyl having 2-6 carbon atoms e.g., 2′-O-allyl, 2′-O-aryl, 2′-O-alkyl, 2′-halo, or 2′-amino, but not with 2′-H, wherein allyl, aryl, or alkyl groups may be unsubstituted or substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy,
  • the hybrid DNA/RNA oligonucleotides useful in the method of the invention resist nucleolytic degradation, form stable duplexes with RNA or DNA, and preferably activate RNase H when hybridized with RNA. They may additionally include at least one unsubstituted ribonucleotide.
  • an oligonucleotide useful in the method of the invention may contain all deoxyribonucleotides with the exception of one 2′ substituted ribonucleotide at the 3′ terminus of the oligonucleotide.
  • the oligonucleotide may have at least one substituted ribonucleotide at both its 3′ and 5′ termini.
  • One preferred class of oligonucleotides useful in the method of the invention contains four or more deoxyribonucleotides in a contiguous block, so as to provide an activating segment for RNase H. In certain cases, more than one such activating segment will be present at any location within the oligonucleotide. There may be a majority of deoxyribonucleotides in oligonucleotides according to the invention. In fact, such oligonucleotides may have as many as all but one nucleotide being deoxyribonucleotides.
  • a preferred oligonucleotide having from about 2 to about 50 nucleotides or most preferably from about 12 to about 25 nucleotides, the number of deoxyribonucleotides present ranges from 1 to about 24.
  • Other useful oligonucleotides may consist only of 2′-substituted ribonucleotides.
  • TABLE 1 lists some representative species of oligonucleotides which are useful in the method of the invention. 2′-substituted nucleotides are underscored.
  • CTCTCGCACCCATCTCTCTCCTTCU 1 2.
  • CTCTCGCACCCATCTCTCTCCTUC U 2 3.
  • CTCTCGCACCCATCTCUCU CCUUCU 4 5.
  • CTCTCGCACC CAUCUCUCUCCUUCU 5 6.
  • CTCTC GCACCCAUCUCUCUCUCCUUCU 6 7.
  • CTCT CGCACCCAUCUCUCUCUCCUUCU 7 8.
  • CUCUCGCACCCAUCUCUCUCUCCUUCU 8 9.
  • C TCTCGCACCCATCTCTCTCCTTC U 1 10. CU CTCGCACCCATCTCTCTCCTT CU 9 11. CUCUC GCACCCATCTCTCTC CUUCU 10 12. CUCUCGCACC CATCT CUCUCCUUCU 11 13. CUCUCGC ACCCA UCUCUCCUUCU 12 14. CUCUCGCACCC ATCTCTC UCCUUCU 13 15. C TCTCGCA CCCAUCUCUCCUUCU 5 16. CUCUCGCACCCAU CTCTCT CCUUCU 14 17. CUCUCGC ACCCATCTCTCTC CUUCU 15 18. CUC TCGCACC CAUCUCUCUCCUUCU 16 19. CUC TCGCACCCATCTCTC UCCUUCU 17
  • the oligonucleotides administered to the animal may be chimeric in that they contain more than one type of internucleotide linkage.
  • Such chimeric oligonucleotides are described in U.S. Pat. Nos. 5,149,797 and 5,366,878.
  • chimeric oligonucleotides useful in the method of the invention may include phosphorothioate and alkylphosphonate internucleotide linkages.
  • One preferred alkylphosphonate linkage is a methylphosphonate linkage.
  • Table 2 lists some representative specifics of chimeric oligonucleotides which are useful in the method of the invention.
  • the alkylphosphonate internucleotide linkages are indicated by “:”; the phosphorothioate linkages are indicated by “-”.
  • oligonucleotides according to the invention are effective in inhibiting the expression of various genes in viruses, pathogenic organisms, or in inhibiting the expression of cellular genes.
  • the ability to inhibit such agents is clearly important to the treatment of a variety of disease states.
  • oligonucleotides according to the method of the invention have a nucleotide sequence which is complementary to a nucleic acid sequence that is from a virus, a pathogenic organism or a cellular gene.
  • oligonucleotides are from about 6 to about 50 nucleotides in length.
  • oligonucleotide sequence that is complementary to a nucleic acid sequence is intended to mean an oligonucleotide sequence that binds to the target nucleic acid sequence under physiological conditions, e.g., by Watson-Crick base pairing (interaction between oligonucleotide and single-stranded nucleic acid) or by Hoogsteen base pairing (interaction between oligonucleotide and double-stranded nucleic acid) or by any other means including in the case of a oligonucleotide binding to RNA, pseudoknot formation.
  • Watson-Crick base pairing interaction between oligonucleotide and single-stranded nucleic acid
  • Hoogsteen base pairing interaction between oligonucleotide and double-stranded nucleic acid
  • any other means including in the case of a oligonucleotide binding to RNA, pseudoknot formation.
  • nucleic acid sequence to which an oligonucleotide according to the invention is complementary will vary, depending upon the gene to be down-regulated.
  • the target gene or nucleic acid sequence will be a virus nucleic acid sequence.
  • antisense oligonucleotides to inhibit various viruses is well known (reviewed in Agrawal (1992) Trends in Biotech. 10:152-158).
  • Viral nucleic acid sequences that are complementary to effective antisense oligonucleotides have been described for many viruses, including human immunodeficiency virus type 1 (HIV-1) (U.S. Pat. No. 4,806,463), herpes simplex virus (U.S. Pat. No.
  • oligonucleotides Sequences complementary to any of these nucleic acid sequences can be used for oligonucleotides according to the invention, as can be oligonucleotide sequences complementary to nucleic acid sequences from any other virus. Additional viruses that have known nucleic acid sequences against which antisense oligonucleotides can be prepared include, but are not limited to, foot and mouth disease virus (see, Robertson et al. (1985) J. Virol. 54:651; Harris et al. (1980) Virol.
  • an oligonucleotide has been designed which is complementary to a portion of the HIV-1 gene, and as such, has significant anti-HIV effects (Agrawal (1992) Antisense Res. Development 2:261-266).
  • the target of this oligonucleotide has been found to be conserved among various HIV-1 isolates. It is 56% G+C rich, water soluble, and relatively stable under physiological conditions.
  • This oligonucleotide binds to a complementary RNA target under physiological conditions, with the T of the duplex approximately being 56° C.
  • This oligonucleotide has been tested in several models, including acutely and chronically infected CEM cells, long-term cultures mimicking in vivo conditions, human peripheral blood lymphocytes and macrophages, and isolates from HIV-1 infected patients (Lisziewicz et al. ( Proc. Natl. Acad. Sci . ( USA ) (1992) 89:11209-11213); Lisziewicz et al. ( Proc. Natl. Acad. Sci . ( USA ) (1993) 90:3860-3864); Lisziewicz et al. ( Proc. Natl. Acad. Sci . ( USA ) (1994) 91:7942-7946); Agrawal et al. ( J. Ther. Biotech ) in press).
  • the oligonucleotides according to the invention alternatively can have an oligonucleotide sequence complementary to a nucleic acid sequence of a pathogenic organism.
  • the nucleic acid sequences of many pathogenic organisms have been described, including the malaria organism, Plasmodium falciparum , and many pathogenic bacteria.
  • Oligonucleotide sequences complementary to nucleic acid sequences from any such pathogenic organism can be used in oligonucleotides according to the invention.
  • Nonlimiting examples of pathogenic eucaryotes having known nucleic acid sequences against which antisense oligonucleotides can be prepared include Trypanosom abrucei gambiense and Leishmania (See Campbell et al., Nature 311:350 (1984)), and Fasciola hepatica (See Zurita et al., Proc. Natl. Acad. Sci . ( USA ) 84:2340 (1987).
  • Antifungal oligonucleotides can be prepared using a target hybridizing region having an oligonucleotide sequence that is complementary to a nucleic acid sequence from, e.g., the chitin synthetase gene, and antibacterial oligonucleotides can be prepared using, e.g., the alanine racemase gene.
  • fungal diseases that may be treatable by the method of treatment according to the invention are candidiasis, histoplasmosis, cryptococcocis, blastomycosis, aspergillosis, sporotrichosis, chromomycosis, dermatophytosis, and coccidioidomycosis.
  • the method might also be used to treat rickettsial diseases (e.g., typhus, Rocky Mountain spotted fever), as well as sexually transmitted diseases caused by Chlamydia trachomatis or Lymphogranuloma venereum .
  • rickettsial diseases e.g., typhus, Rocky Mountain spotted fever
  • sexually transmitted diseases caused by Chlamydia trachomatis or Lymphogranuloma venereum .
  • a variety of parasitic diseases may be treated by the method according to the invention, including amebiasis, Chagas' disease, toxoplasmosis, pneumocystosis, giardiasis, cryptosporidiosis, trichomoniasis, and Pneumocystis carini pneumonia; also worm (helminthic) diseases such as ascariasis, filariasis, trichinosis, schistosomiasis and nematode or cestode infections. Malaria may be treated by the method of treatment of the invention regardless of whether it is caused by P. falciparum, P. vivas, P. orale , or P. malariae.
  • infectious diseases identified above may all be treated by the method of treatment according to the invention because the infectious agents for these diseases are known and thus oligonucleotides according to the invention can be prepared, having oligonucleotide sequence that is complementary to a nucleic acid sequence that is an essential nucleic acid sequence for the propagation of the infectious agent, such as an essential gene.
  • disease states or conditions that may be treatable by the method according to the invention are those which result from an abnormal expression or product of a cellular gene. These conditions may be treated by administration of oligonucleotides according to the invention, and have been discussed earlier in this disclosure.
  • oligonucleotides according to the invention can have a nucleotide sequence complementary to a cellular gene or gene transcript, the abnormal expression or product of which results in a disease state.
  • the nucleic acid sequences of several such cellular genes have been described, including prion protein (Stahl et al. (1991) FASEB J. 5:2799-2807), the amyloid-like protein associated with Alzheimer's disease (U.S. Pat. No. 5,015,570), and various well-known oncogenes and proto-oncogenes, such as c-myb, c-myc, c-abl, and n-ras.
  • oligonucleotides that inhibit the synthesis of structural proteins or enzymes involved largely or exclusively in spermatogenesis, sperm motility, the binding of the sperm to the egg or any other step affecting sperm viability may be used as contraceptives.
  • contraceptives for women may be oligonucleotides that inhibit proteins or enzymes involved in ovulation, fertilization, implantation or in the biosynthesis of hormones involved in those processes.
  • Hypertension may be controlled by oligonucleotides that down-regulate the synthesis of angiotensin converting enzyme or related enzymes in the renin/angiotensin system.
  • Platelet aggregation may be controlled by suppression of the synthesis of enzymes necessary for the synthesis of thromboxane A2 for use in myocardial and cerebral circulatory disorders, infarcts, arteriosclerosis, embolism and thrombosis.
  • Deposition of cholesterol in arterial wall may be inhibited by suppression of the synthesis of fatty acid co-enzyme A: cholesterol acyl transferase in arteriosclerosis. Inhibition of the synthesis of cholinephosphotransferase may be useful in hypolipidemia.
  • hybridization arrest may be used to reduce or eliminate adverse effects of the disorder.
  • suppression of the synthesis of monoamine oxidase may be used in Parkinson's disease.
  • Suppression of catechol o-methyl transferase may be used to treat depression; and suppression of indole N-methyl transferase may be used in treating schizophrenia.
  • mdr-1 multidrug resistance
  • mdr-1 multidrug resistance gene
  • Oligonucleotide sequences complementary to nucleic acid sequences from any of these genes can be used for oligonucleotides according to the invention, as can be oligonucleotide sequences complementary to any other cellular gene transcript, the abnormal expression or product of which results in a disease state.
  • the oligonucleotides described herein are administered orally or enterally to the animal subject in the form of therapeutic pharmaceutical formulations that are effective for treating virus infection, infections by pathogenic organisms, or disease resulting from abnormal gene expression or from the expression of an abnormal gene product.
  • the oligonucleotides are administered in conjunction with other therapeutic agents, e.g., AZT in the case of AIDS.
  • the therapeutic pharmaceutical formulation containing the oligonucleotide includes a physiologically acceptable carrier, such as an inert diluent or an assimilable edible carrier with which the peptide is administered.
  • a physiologically acceptable carrier such as an inert diluent or an assimilable edible carrier with which the peptide is administered.
  • suitable formulations that include pharmaceutically acceptable excipients for introducing compounds to the bloodstream by other than injection routes can be found in Remington's Pharmaceutical Sciences (18 th ed .) (Genarro, ed. (1990) Mack Publishing Co., Easton, Pa.).
  • the oligonucleotide and other ingredients may be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet.
  • the oligonucleotide may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • the oligonucleotide When the oligonucleotide is administered orally, it may be mixed with other food forms and pharmaceutically acceptable flavor enhancers.
  • the oligonucleotide When the oligonucleotide is administered enterally, they may be introduced in a solid, semi-solid, suspension, or emulsion form and may be compounded with any number of well-known, pharmaceutically acceptable additives. Sustained release oral delivery systems and/or enteric coatings for orally administered dosage forms are also contemplated such as those described in U.S. Pat. Nos. 4,704,295, 4,556,552, 4,309,404, and 4,309,406.
  • compositions or preparations according to the present invention are prepared so that an oral dosage unit contains between from about 50 micrograms to about 200 mg per kg body weight of the animal, with 10 mg to 100 mg per kg being most preferable.
  • unit content of active ingredient or ingredients contained in an individual dose of each dosage form need not in itself constitute an effective amount since the necessary effective amount can be reached by administration of a plurality of dosage units (such as capsules or tablets or combinations thereof).
  • FIG. 1 illustrates the plasma, liver, and kidney concentration-time course of an oligonucleotide equivalents after oral administration of the radiolabelled oligonucleotide.
  • both unmodified and hybrid oligonucleotides were shown to be stable in the stomach up to 6 hr following oral administration.
  • the unmodified oligonucleotide underwent extensive degradation in small and large intestine, the majority of the radioactivity being associated with the different length of truncated oligonucleotide (FIG. 2A).
  • the hybrid oligonucleotide was more stable compared to the unmodified oligonucleotide, the majority of the radioactivity in small intestine being associated with the intact oligonucleotide (FIG. 2B).
  • Increased degradation of the hybrid oligonucleotide was observed in the large intestine (FIG. 2B).
  • 35 S-labelled modified oligonucleotides were also orally administered to mice at a single dose.
  • hybrid oligonucleotide similar profiles of gel electrophoresis of radioactivity in the gastrointestinal tract were observed with mice compared to rats (FIG. 3A).
  • chimeric oligonucleotide gel electrophoresis of radioactivity in the gastrointestinal tract revealed that this compound was stable in stomach and small intestine, with significant degradation in large intestine (FIG. 3B).
  • FIGS. 4A and 4B The chemical form of radioactivity in rat plasma was further evaluated by HPLC as shown in FIGS. 4A and 4B, demonstrating the presence of both intact PS oligonucleotide (A) as well as metabolites (B) 12 hours after oral administration (see FIG. 4B). Intact oligonucleotide was also detected in rat liver 6 hours (FIG. 5B) and 12 hours (FIG. 5C) after oral administration. Radioactivity in rat brain, thymus, heart, lung, liver, kidney, adrenals, stomach, small intestine, large intestine, skeletal muscle, testes, thyroid, epidermis, whole eye, and bone marrow was detectable 48 hours after oral administration of the radiolabelled oligonucleotide.
  • oligonucleotide For unmodified oligonucleotide, minimal intact form was detectable in rat tissue samples. However, as shown in FIG. 11A for the hybrid oligonucleotide and in FIG. 11B for the chimeric oligonucleotide, intact oligonucleotides were detected in plasma and tissue samples of the liver, kidney, spleen, heart, and lung.
  • FIG. 6 shows the cumulative excretion of the radioactively labelled oligonucleotide into the urine over 48 hr following the administration of radiolabelled phosphorothioate oligonucleotide. That the oligonucleotide continues to be excreted in the urine over time implies that other tissues had absorbed it, and that the body was capable of absorption for an extended period of time.
  • FIGS. 7B and 7C demonstrate that although the majority of radioactivity in urine was present as degradative products, intact oligonucleotide was also detected, demonstrating that this oligonucleotide is absorbed intact.
  • FIG. 8 shows that approximately 80% of administered oligonucleotide remained or was excreted in feces, indicating that 20% of administered oligonucleotide was absorbed.
  • This oligonucleotide was stable in stomach; no significant degradative products in stomach contents were detected six hours after oral administration (FIG. 9). The majority of administered oligonucleotide in the contents of the large intestine were also present as the intact compound (FIG. 10).
  • the total absorption of hybrid oligonucleotide was determined to be 10.2 ⁇ 2.5% over 6 hr and 25.9 ⁇ 4.7% over 12 hr following oral administration of the radiolabelled hybrid oligonucleotide in rats. Although the total absorption rates were slightly lower than that of the PS oligonucleotide, the hybrid oligonucleotide-derived radioactivity was stable in various tissues. The total absorption of the chimeric oligonucleotide was determined to be 23.6 ⁇ 2.8% over 6 hr and 39.3 ⁇ 2.4% over 12 hr following oral administration of the radiolabelled oligonucleotide. The comparison of oral availability of the three types of oligonucleotides is shown in FIG. 12, expressed as the percentages of administered doses in the gastrointestinal tract plus feces, in plasma, in tissues, and in urine.
  • Unmodified phosphorothioate deoxynucleosides were synthesized on CPG on a 5-6 ⁇ mole scale on an automated synthesizer (model 8700, Millipore, Bedford, Mass.) using the H-phosphonate approach described in U.S. Pat. No. 5,149,798.
  • Deoxynucleoside H-phosphonates were obtained from Millipore (Bedford, Mass.). 2′-O-methyl ribonucleotide H-phosphonates or phosphorothioates were synthesized by standard procedures (see, e.g., “Protocols for Oligonucleotides and Analogs” in Meth. Mol. Biol .
  • oligonucleotides containing 2′-O-methyl nucleoside(s) were assembled by using 2′-O-methyl ribonucleoside H-phosphonates or phosphorothioates for the desired cycles.
  • segments of oligonucleotides containing deoxyribonucleosides were assembled by using deoxynucleoside H-phosphonates for the desired cycles.
  • CPG bound oligonucleotide H-phosphonate was oxidized with sulfur to generate the phosphorothioate linkage. Oligonucleotides were then deprotected in concentrated NH 4 OH at 40° C. for 48 hours.
  • Chimeric oligonucleotide was prepared as described in Zhang et al. ( J. Pharmacol. Exptal. Thera . (1996) 278:(in press)). This chimeric oligonucleotide had 3 methylphosphate internucleotide linkages at the 5′ end, 4 methylphosphonate internucleotide linkages at the 3′ end, and phosphorothioate internucleotide linkages elsewhere in the molecule were prepared and purified as follows. The first four couplings were carried out by using nucleoside methyl-phosphoramidite, followed by oxidation with a standard iodine reagent.
  • CPG Controlled pore glass
  • the solution was removed and the CPG support was washed with carbon disulfide/pyridine/triethylamine (10:10:1) (3 ⁇ 500 ⁇ l) and with acetonitrile (3 ⁇ 700 ⁇ l).
  • the product was deprotected in concentrated ammonium hydroxide (55° C., 14 hr) and evaporated.
  • the resultant product was purified by polyacrylamide gel electrophoresis (20% polyacrylamide containing 7 M urea).
  • the desired band was excised under UV shadowing and the PS-oligonucleotide was extracted from the gel and desalted with a Sep-Pak C18 cartridge (Waters) and Sephadex G-15 column.
  • the yield was 20 A 260 units (600 ⁇ g; specific activity, 1 ⁇ Ci/ ⁇ g).
  • CPG-bound oligonucleotide was treated with a mixture of elemental 35 S (4.5 mCi/mg atom, in 50 ⁇ l of toluene; Amersham) in a solution of carbon disulfide, pyridine and triethylamine (200 ⁇ l, 200 ⁇ l and 4 ⁇ l, respectively) at 25° C. for 1 hr.
  • 3H-1,2-benzodithiole-3-one-1,1-dioxide (1 ml, 2% in acetonitrile) was added, and the reaction mixture was allowed to remain at 25° C. for 10 min.
  • mice Male Sprague-Dawley rats (110+/ ⁇ 10 g, Harlan Laboratories, Indianapolis, Ind.) and male CD-/F2 mice (25 ⁇ 3 g, Charles River Laboratory, Wilmington, Mass.) were used in the study. The animals were fed with commercial diet and water ad libitum for 1 week prior to the study.
  • Unlabelled and 35 S-labelled oligonucleotides were dissolved in physiological saline (0.9% NaCl) in a concentration of 25 mg/ml, and were administered to the fasted animals via gavage at the designated dose (30-50 mg/kg for rats and 10 mg/kg for mice). Doses were based on the pretreatment body weight and rounded to the nearest 0.01 ml. After dosing, each animal was placed in a metabolism cage and fed with commercial diet and water ad libitum. Total voided urine was collected and each metabolism cage was then washed following the collection intervals. Total excreted feces was collected from each animal at various timepoints, and feces samples were homogenized prior to quantitation of radioactivity.
  • the percentage of the absorbed hybrid oligonucleotide-derived radioactivity was determined by the following calculation: ( total ⁇ ⁇ radioactivity ⁇ ⁇ in ⁇ ⁇ the ⁇ ⁇ remainder ⁇ ⁇ of ⁇ ⁇ the ⁇ ⁇ body + total ⁇ ⁇ radioactivity ⁇ ⁇ in ⁇ ⁇ urine ) ( total ⁇ ⁇ radioactivity ⁇ ⁇ in ⁇ ⁇ the ⁇ ⁇ gastrointestinal ⁇ ⁇ tract , feces , urine , plasma , and ⁇ ⁇ the ⁇ ⁇ remainder ⁇ ⁇ of ⁇ ⁇ the ⁇ ⁇ body ) ⁇ 100 ⁇ % .
  • the total radioactivities in tissues and body fluids were determined by liquid scintillation spectrometry (LS 6000TA, Beckman, Irvine, Calif.).
  • biological fluids plasma, 50-100 ⁇ l; urine, 50-100 ⁇ l
  • 6 ml scintillation solvent Budget-Solve, RPI, Mt. Prospect, Ill.
  • Feces were ground and weighed prior to being homogenized in a 9-fold volume of 0.9% NaCl saline.
  • An aliquot of the homogenate (100 ⁇ l) was mixed with solubilizer (TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent (6 ml) to permit quantitation of total radioactivity.
  • tissues were immediately blotted on Whatman No. 1 filter paper and weighed prior to being homogenized in 0.9% NaCl saline (3-5 ml per gram of wet weight).
  • the resulting homogenate 100 ⁇ l was mixed with solubilizer (TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent (6 ml) to determine total radioactivity.
  • TS-2 solubilizer
  • TS-2 solubilizer
  • Mt. Prospect, Ill. solubilizer
  • scintillation solvent 6 ml
  • Mobile phase included two buffers; Buffer A was 5 mM-A reagent (Waters Co., Bedford, Mass.) in water and Buffer B was 4:1 (v/v) Acetonitrile (Fisher)/water.
  • Buffer A was 5 mM-A reagent (Waters Co., Bedford, Mass.) in water and Buffer B was 4:1 (v/v) Acetonitrile (Fisher)/water.
  • the column was eluted at a flow rate of 1.5 ml/min, using the following gradient: (1) 0-4 min, 0% buffer B; (2) 4-15 min 0-35% Buffer B; and (3) 15-70 min 35%-80% Buffer B.
  • the column was equilibrated with Buffer A for at least 30 min prior to the next run.
  • Plasma and tissue homogenates were incubated with proteinase K (2 mg/ml) in extraction buffer (0.5% SDS/10 mM NaCl/20 mM Tris-HCl, pH 7.6/10 mM EDTA) for 1 hr at 60° C. The samples were then extracted twice with phenol/chloroform (1:1, v/v) and once with chloroform. After ethanol precipitation, the extracts were analyzed by electrophoresis in 20% polyacrylamide gels containing 7 M urea. Urine samples were filtered, desalted and then analyzed by polyacrylamide gel electrophoresis (PAGE). The gels were fixed in 10% acetic acid/10% methanol solution and then dried before autoradiography.
  • PAGE polyacrylamide gel electrophoresis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Neurosurgery (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Neurology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Communicable Diseases (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed is a method of down-regulating the expression of a gene in an animal, wherein a pharmacological formulation comprising a chimeric oligonucleotide complementary to the gene is orally administered to an animal. The oligonucleotide administered has at least one phosphorothioate internucleotide linkage and at least one alkylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, phosphoramidite, phosphate ester, carbamate, carbonate, phosphate triester, acetamidate, or carboxymethyl ester internucleotide linkage.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a divisional of patent application Ser. No. 09/587,934, filed Jun. 6, 2000, which is a continuation of patent application Ser. No. 08/758,005, filed Nov. 27, 1996, which is a continuation-in-part of patent application Ser. No. 08/709,910, filed Sep. 9, 1996, now abandoned, which is a continuation-in-part of patent application Ser. No. 08/328,520, filed Oct. 25, 1994, now U.S. Pat. No. 5,591,721.[0001]
  • BACKGROUND OF THE INVENTION
  • The present invention relates to the control of gene expression. More particularly, this invention relates to the use of synthetic, modified oligonucleotides to down-regulate the expression of a gene in an animal. [0002]
  • The potential for the development of an antisense oligonucleotide therapeutic approach was first suggested in three articles published in 1977 and 1978. Paterson et al. ([0003] Proc. Natl. Acad. Sci. (USA) (1977) 74:4370-4374) discloses that cell-free translation of mRNA can be inhibited by the binding of an oligonucleotide complementary to the mRNA. Zamecnik et al. (Proc. Natl. Acad. Sci. (USA) (1978) 75:280-284 and 285-288) discloses that a 13mer synthetic oligonucleotide that is complementary to a part of the Rous sarcoma virus (RSV) genome inhibits RSV replication in infected chicken fibroblasts and inhibits RSV-mediated transformation of primary chick fibroblasts into malignant sarcoma cells.
  • These early indications that synthetic oligonucleotides can be used to inhibit virus propagation and neoplasia have been followed by the use of synthetic oligonucleotides to inhibit a wide variety of viruses, such as HIV (see, e.g., U.S. Pat. No. 4,806,463); influenza (see, e.g., Leiter et al. (1990) ([0004] Proc. Natl. Acad. Sci. (USA) 87:3430-3434); vesicular stomatitis virus (see, e.g., Agris et al. (1986) Biochem. 25:6268-6275); herpes simplex (see, e.g., Gao et al. (1990) Antimicrob. Agents Chem. 34:808-812); SV40 (see, e.g., Birg et al. (1990) (Nucleic Acids Res. 18:2901-2908); and human papilloma virus (see, e.g., Storey et al. (1991) (Nucleic Acids Res. 19:4109-4114). The use of synthetic oligonucleotides and their analogs as antiviral agents has recently been extensively reviewed by Agrawal (Trends in Biotech. (1992) 10:152-158).
  • In addition, synthetic oligonucleotides have been used to inhibit a variety of non-viral pathogens, as well as to selectively inhibit the expression of certain cellular genes. Thus, the utility of synthetic oligonucleotides as agents to inhibit virus propagation, propagation of non-viral, pathogens and selective expression of cellular genes has been well established. [0005]
  • Improved oligonucleotides have more recently been developed that have greater efficacy in inhibiting such viruses, pathogens and selective gene expression. Some of these oligonucleotides having modifications in their internucleotide linkages have been shown to be more effective than their unmodified counterparts. For example, Agrawal et al. ([0006] Proc. Natl. Acad. Sci. (USA) (1988) 85:7079-7083) teaches that oligonucleotide phosphorothioates and certain oligonucleotide phosphoramidates are more effective at inhibiting HIV-1 than conventional phosphodiester-linked oligodeoxynucleotides. Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1989) 86:7790-7794) discloses the advantage of oligonucleotide phosphorothioates in inhibiting HIV-1 in early and chronically infected cells.
  • In addition, chimeric oligonucleotides having more than one type of internucleotide linkage within the oligonucleotide have been developed. Pederson et al. (U.S. Pat. Nos. 5,149,797 and 5,220,007 discloses chimeric oligonucleotides having an oligonucleotide phosphodiester or oligonucleotide phosphorothioate core sequence flanked by nucleotide methylphosphonates or phosphoramidates. Furdon et al. ([0007] Nucleic Acids Res. (1989) 17:9193-9204) discloses chimeric oligonucleotides having regions of oligonucleotide phosphodiesters in addition to either oligonucleotide phosphorothioate or methylphosphonate regions. Quartin et al. (Nucleic Acids Res. (1989) 17:7523-7562) discloses chimeric oligonucleotides having regions of oligonucleotide phosphodiesters and oligonucleotide methylphosphonates. Inoue et al. (FEBS Lett. (1987) 215:237-250) discloses chimeric oligonucleotides having regions of deoxyribonucleotides and 2′-O-methyl-ribonucleotides.
  • Many of these modified oligonucleotides have contributed to improving the potential efficacy of the antisense oligonucleotide therapeutic approach. However, certain deficiencies remain in the known oligonucleotides, and these deficiencies can limit the effectiveness of such oligonucleotides as therapeutic agents. For example, Wickstrom ([0008] J. Biochem. Biophys. Meth. (1986) 13:97-102) teaches that oligonucleotide phosphodiesters are susceptible to nuclease-mediated degradation, thereby limiting their bioavailability in vivo. Agrawal et al. (Proc. Natl. Acad. Sci. (USA) (1990) 87:1401-1405) teaches that oligonucleotide phosphoramidates or methylphosphonates when hybridized to RNA do not activate RNase H, the activation of which can be important to the function of antisense oligonucleotides. Thus, a need for methods of controlling gene expression exists which uses oligonucleotides with improved therapeutic characteristics.
  • Several reports have been published on the development of phosphorothioate-linked oligonucleotides as potential anti-AIDS therapeutic agents. Although extensive studies on chemical and molecular mechanisms of oligonucleotides have demonstrated the potential value of this novel therapeutic strategy, little is known about the pharmacokinetics and metabolism of these compounds in vivo. [0009]
  • Several preliminary studies on this topic have been published. Agrawal et al. ([0010] Proc. Natl. Acad. Sci. (USA) (1991) 88:7595-7599) describes the intravenous and intraperitoneal administration to mice of a 20mer phosphorothioate linked-oligonucleotide. In this study, approximately 30% of the administered dose was excreted in the urine over the first 24 hours with accumulation preferentially in the liver and kidney. Plasma half-lives ranged from about 1 hour (t1/2α) and 40 hours (t1/2α) respectively. Similar results have been reported in subsequent studies (Iversen (1991) Anti-Cancer Drug Design 6:531-538; Iversen (1994) Antisense Res. Devel. 4:43-52; and Sands (1994) Mol. Pharm. 45:932-943). However, stability problems may exist when oligonucleotides are administered intravenously and intraperitoneally. More recently, Agrawal et al. reported that oligonucleotide hybrids containing 2′-O-methyl ribonucleotides at both the 3′- and 5′ ends and deoxyribonucleotide phosphorothioates in the interior portion were absorbed through the gastrointestinal (GI) tract of rats (Biochem. Pharm. (1995) 50:571-576).
  • Thus, there remains a need to develop more effective therapeutic methods of down-regulating the expression of genes which can be easily manipulated to fit the animal and condition to be treated, and the gene to be targeted. Preferably, these methods should be simple, painless, and precise in effecting the target gene. [0011]
  • SUMMARY OF THE INVENTION
  • The present invention provides a method of down-regulating the expression of a gene in an animal which involves the administration of an oligonucleotide complementary to the gene via an oral route, thereby bypassing the complications which may be experienced during intravenous and other modes of in vivo administration. [0012]
  • It has been discovered that hybrid oligonucleotides with other than phosphodiester bonds and having at least one 2′-substituted ribonucleotide and chimeric oligonucleotides with at least two different types of internucleotide linkages are relatively stable in vivo following oral administration to an animal, and that these molecules are successfully absorbed from the gastrointestinal tract and distributed to various body tissues. This discovery has been exploited to develop the present invention, which is a method of down-regulating the expression of a gene in an animal. [0013]
  • This method is also a means of examining the function of various genes in an animal, including those essential to animal development. Presently, gene function can only be examined by the arduous task of making a “knock out” animal such as a mouse. This task is difficult, time-consuming and cannot be accomplished for genes essential to animal development since the “knock out” would produce a lethal phenotype. The present invention overcomes the shortcomings of this model. [0014]
  • In the method of the invention, a pharmaceutical formulation containing an oligonucleotide complementary to the targeted gene is orally administered in a pharmaceutically acceptable carrier to the animal harboring the gene. The oligonucleotide inhibits the expression of the gene, thereby down-regulating its expression. [0015]
  • For purposes of the invention, the term “animal” is meant to encompass humans as well as other mammals, as well as reptiles amphibians, and insects. The term “oral administration” refers to the provision of the formulation via the mouth through ingestion, or via some other part of the gastrointestinal system including the esophagus. [0016]
  • As used herein, the term “oligonucleotide” is meant to include polymers of two or more nucleotides or nucleotide analogs connected together via 5′ to 3′ internucleotide linkages which may include any linkages that are known in the antisense art, including non-phosphodiester linkages. Such molecules have a 3′ terminus and a 5′ terminus. [0017]
  • The term “non-phosphodiester-linkages” as used herein refers to a synthetic covalent attachment between the 5′ end of one nucleotide and the 3′ end of another nucleotide in which the 5′ nucleotide phosphate has been replaced with any number of chemical groups. Preferable synthetic linkages include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphoramidites, phosphate esters, carbamates, carbonates, phosphate triesters, acetamidate, and carboxymethyl esters. In one preferred embodiment of the invention, all of the nucleotides of the oligonucleotide are linked via phosphorothioate and/or phosphorodithioate linkages. [0018]
  • In some embodiments of the invention, the oligonucleotides administered are modified with other than, or in addition to, non-phosphodiester-internucleotide linkages. As used herein, the term “modified oligonucleotide” encompasses oligonucleotides with modified nucleic acid(s), base(s), and/or sugar(s) other than those found in nature. For example, a 3′,5′-substituted oligonucleotide is an oligonucleotide having a sugar which, at both its 3′ and 5′ positions is attached to a chemical group other than a hydroxyl group (at its 3′ position) and other than a phosphate group (at its 5′ position). [0019]
  • A modified oligonucleotide may also be one with added substituents such as diamines, cholestryl, or other lipophilic groups, or a capped species. In addition, unoxidized or partially oxidized oligonucleotides having a substitution in one nonbridging oxygen per nucleotide in the molecule are also considered to be modified oligonucleotides. Also considered as modified oligonucleotides are oligonucleotides having nuclease resistance-conferring bulky substituents at their 3′ and/or 5′ end(s) and/or various other structural modifications not found in vivo without human intervention are also considered herein as modified. [0020]
  • In one embodiment, the oligonucleotide being administered in the method of the invention has non-phosphodiester internucleotide linkages and includes at least one 2′-substituted ribonucleotide. [0021]
  • For purposes of the invention, the term “2′-substituted oligonucleotide” refers to an oligonucleotide having a sugar attached to a chemical group other than a hydroxyl group at its 2′ position. The 2′-OH of the ribose molecule can be substituted with -O-lower alkyl containing 1-6 carbon atoms, aryl or substituted aryl or allyl having 2-6 carbon atoms, e.g., 2′-O-allyl, 2′-O-aryl, 2′-O-alkyl (such as a 2′-O-methyl), 2′-halo, or 2′-amino, but not with 2′-H, wherein allyl, aryl, or alkyl groups may be unsubstituted or substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl or amino groups. [0022]
  • In one preferred embodiment of the invention, the oligonucleotide administered includes at least one 2′-substituted ribonucleotide at its 3′ terminus. In some embodiments, all but four or five nucleotides at its 5′ terminus are 2′-substituted ribonucleotides, and in some embodiments, these four or five unsubstituted 5′ nucleotides are deoxyribonucleotides. In other embodiments, the oligonucleotide has at least one 2′-substituted ribonucleotide at both its 3′ and 5′ termini, and in yet other embodiments, the oligonucleotide is composed of 2′-substituted ribonucleotides in all positions with the exception of at least four or five contiguous deoxyribonucleotide nucleotides in any interior position. Another aspect of the invention includes the administration of an oligonucleotide composed of nucleotides that are all 2′-substituted ribonucleotides. Particular embodiments include oligonucleotides having a 2′-O-alkyl-ribonucleotide such as a 2′-O-methyl. Other embodiments include the administration of chimeric oligonucleotides. In one preferred embodiment, the chimeric oligonucleotide has at least one alkylphosphonate internucleotide linkage at both its 3′ and 5′ ends and having phosphorothioate internucleotide linkages. [0023]
  • In another embodiment of the invention, the oligonucleotide administered has at least one deoxyribonucleotide, and in a preferred embodiment, the oligonucleotide has at least four or five contiguous deoxyribonucleotides capable of activating RNase H. [0024]
  • The oligonucleotide administered is complementary to a gene of a virus, pathogenic organism, or a cellular gene in some embodiments of the invention. In some embodiments, the oligonucleotide is complementary to a gene of a virus involved in AIDS, oral or genital herpes, papilloma warts, influenza, foot and mouth disease, yellow fever, chicken pox, shingles, adult T-cell leukemia, Burkitt's lymphoma, nasopharyngeal carcinoma, or hepatitis. In one particular embodiment, the oligonucleotide is complementary to an HIV gene and includes about 15 to 26 nucleotides linked by phosphorothioate internucleotide linkages, at least one of the nucleotides at the 3′ terminus being a 2′-substituted ribonucleotide, and at least four contiguous deoxyribonucleotides. [0025]
  • In another embodiment, the oligonucleotide is complementary to a gene encoding a protein associated with Alzheimer's disease. [0026]
  • In yet other embodiments, the oligonucleotide is complementary to a gene encoding a protein expressed in a parasite that causes a parasitic disease such as amebiasis, Chagas' disease, toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis, trichomoniasis, malaria, ascariasis, filariasis, trichinosis, or schistosomiasis infections.[0027]
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which: [0028]
  • FIG. 1 is a graphic representation showing the time course of radiolabelled oligonucleotide in liver, kidney and plasma following the oral administration of radiolabelled phosphorothioate (PS) oligonucleotide 11 (SEQ ID NO:10); [0029]
  • FIG. 2A is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of rats at different times following oral administration of PS oligonucleotide; [0030]
  • FIG. 2B is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of rats at different times following oral administration of hybrid oligonucleotide; [0031]
  • FIG. 3A is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of mice at different times following oral administration of hybrid oligonucleotide; [0032]
  • FIG. 3B is a representation of an autoradiogram of radiolabelled oligonucleotide in the stomach, small intestine, and large intestine of mice at different times following oral administration of chimeric oligonucleotide; [0033]
  • FIG. 4A is an HPLC chromatograph of radiolabelled PS oligonucleotide standard; [0034]
  • FIG. 4B is an HPLC chromatogram of oligonucleotides extracted from plasma samples taken 12 hours after the administration of radiolabelled PS oligonucleotide; [0035]
  • FIG. 5A is an HPLC chromatogram of radiolabelled PS oligonucleotide standard; [0036]
  • FIG. 5B is an HPLC chromatogram of oligonucleotides extracted from [0037] rat liver 6 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 5C is an HPLC chromatogram of oligonucleotides extracted from [0038] rat liver 24 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 6 is a graphic representation demonstrating the time course of urinary excretion of radioactivity in rats following the oral administration of radiolabelled PS oligonucleotide; [0039]
  • FIG. 7A is an HPLC chromatogram of radiolabelled PS oligonucleotide standard; [0040]
  • FIG. 7B is an HPLC chromatogram of oligonucleotides extracted from [0041] rat urine 6 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 7C is an HPLC chromatogram of oligonucleotides extracted from [0042] rat urine 12 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 8 is a graphic representation showing the course of radioactivity in the gastrointestinal tract and feces in rats following the oral administration of radiolabelled PS oligonucleotide; [0043]
  • FIG. 9 is an HPLC chromatogram of oligonucleotides extracted from [0044] rat stomach 1 hour, 3 hours, and 6 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 10 is an HPLC chromatogram of oligonucleotides extracted from rat [0045] large intestine 3 hours, 6 hours, and 12 hours after the administration of radiolabelled PS oligonucleotide;
  • FIG. 11A is a representation of an autoradiogram of radiolabelled oligonucleotide in the plasma, liver, kidney, spleen, heart, and lung of [0046] mice 6 hours following oral administration of hybrid oligonucleotide;
  • FIG. 11B is a representation of an autoradiogram of radiolabelled oligonucleotide in the plasma, liver, kidney, spleen, heart, and lung of [0047] mice 6 hours following oral administration of chimeric oligonucleotide; and
  • FIG. 12 is a graphic representation of the distribution of radioactivity in GI+feces, plasma, tissue, and urine at various times following oral administration of PS oligonucleotide (30 mg/kg rat), hybrid oligonucleotide (10 mg/kg mouse), and chimeric oligonucleotide (10 mg/kg mouse).[0048]
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued U.S. patent, allowed patent applications, and articles cited herein are hereby incorporated by reference. [0049]
  • This invention provides a method of down-regulating the expression of a gene in an animal by the oral administration of an oligonucleotide whose nucleotide sequence is complementary to the targeted gene. [0050]
  • It is known that an oligonucleotide, called an “antisense oligonucleotide,” can bind to a target single-stranded nucleic acid molecule according to the Watson-Crick or the Hoogsteen rule of base pairing, and in doing so, disrupt the function of the target by one of several mechanisms: by preventing the binding of factors required for normal transcription, splicing, or translation; by triggering the enzymatic destruction of mRNA by RNase H if a contiguous region of deoxyribonucleotides exists in the oligonucleotide, and/or by destroying the target via reactive groups attached directly to the antisense oligonucleotide. [0051]
  • Thus, because of the properties described above, such oligonucleotides are useful therapeutically by their ability to control or down-regulate the expression of a particular gene in an animal, according to the method of the present invention. [0052]
  • The oligonucleotides useful in the method of the invention are at least 6 nucleotides in length, but are preferably 6 to 50, more preferably 11 to 35, most preferably 15 to 30, and commonly 15 to 25 nucleotides in length. They are composed of deoxyribonucleotides, ribonucleotides, or a combination of both, with the 5′ end of one nucleotide and the 3′ end of another nucleotide being covalently linked by non-phosphodiester internucleotide linkages. Such linkages include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. Oligonucleotides with these linkages can be prepared according to known methods such as phosphoramidate or H-phosphonate chemistry which can be carried out manually or by an automated synthesizer as described by Brown ([0053] A Brief History of Oligonucleotide Synthesis. Protocols for Oligonucleotides and Analogs, Methods in Molecular Biology (1994) 20:1-8). (See also, e.g., Sonveaux “Protecting Groups in Oligonucleotides Synthesis” in Agrawal (1994) Methods in Molecular Biology 26:1-72; Uhlmann et al. (1990) Chem. Rev. 90:543-583).
  • The oligonucleotides of the composition may also be modified in a number of ways without compromising their ability to hybridize to the target nucleic acid. Such modifications include, for example, those which are internal or at the end(s) of the oligonucleotide molecule and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the viral genome. Examples of such modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3′,5′-substituted oligonucleotide having a sugar which, at both its 3′ and 5′ positions is attached to a chemical group other than a hydroxyl group (at its 3′ position) and other than a phosphate group (at its 5′ position). Other modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3′ and/or 5′ end(s), or have a substitution in one nonbridging oxygen per nucleotide. Such modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule. For the preparation of such modified oligonucleotides, see, e.g., Agrawal (1994) [0054] Methods in Molecular Biology 26; Uhlmann et al. (1990) Chem. Rev. 90:543-583).
  • Oligonucleotides which are self-stabilized are also considered to be modified oligonucleotides useful in the methods of the invention (Tang et al. (1993) [0055] Nucleic Acids Res. 20:2729-2735). These oligonucleotides comprise two regions: a target hybridizing region; and a self-complementary region having an oligonucleotide sequence complementary to a nucleic acid sequence that is within the self-stabilized oligonucleotide.
  • The preparation of these unmodified and modified oligonucleotides is well known in the art (reviewed in Agrawal et al. (1992) [0056] Trends Biotechnol. 10:152-158) (see, e.g., Uhlmann et al. (1990) Chem. Rev. 90:543-584; and (1987) Tetrahedron. Lett. 28:(31):3539-3542); Agrawal (1994) Methods in Molecular Biology 20:63-80); and Zhang et al. (1996) J. Pharmacol. Expt. Thera. 278:1-5).
  • The oligonucleotides administered to the animal may be hybrid oligonucleotides in that they contain both deoxyribonucleotides and at least one 2′ substituted ribonucleotide. For purposes of the invention, the term “2′-substituted” means substitution at the 2′ position of the ribose with, e.g., a -O-lower alkyl containing 1-6 carbon atoms, aryl or substituted aryl or allyl having 2-6 carbon atoms e.g., 2′-O-allyl, 2′-O-aryl, 2′-O-alkyl, 2′-halo, or 2′-amino, but not with 2′-H, wherein allyl, aryl, or alkyl groups may be unsubstituted or substituted, e.g., with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl or amino groups. Useful substituted ribonucleotides are 2′-O-alkyls such as 2′-O-methyl. [0057]
  • The hybrid DNA/RNA oligonucleotides useful in the method of the invention resist nucleolytic degradation, form stable duplexes with RNA or DNA, and preferably activate RNase H when hybridized with RNA. They may additionally include at least one unsubstituted ribonucleotide. For example, an oligonucleotide useful in the method of the invention may contain all deoxyribonucleotides with the exception of one 2′ substituted ribonucleotide at the 3′ terminus of the oligonucleotide. Alternatively, the oligonucleotide may have at least one substituted ribonucleotide at both its 3′ and 5′ termini. [0058]
  • One preferred class of oligonucleotides useful in the method of the invention contains four or more deoxyribonucleotides in a contiguous block, so as to provide an activating segment for RNase H. In certain cases, more than one such activating segment will be present at any location within the oligonucleotide. There may be a majority of deoxyribonucleotides in oligonucleotides according to the invention. In fact, such oligonucleotides may have as many as all but one nucleotide being deoxyribonucleotides. Thus, a preferred oligonucleotide having from about 2 to about 50 nucleotides or most preferably from about 12 to about 25 nucleotides, the number of deoxyribonucleotides present ranges from 1 to about 24. Other useful oligonucleotides may consist only of 2′-substituted ribonucleotides. [0059]
  • TABLE 1 lists some representative species of oligonucleotides which are useful in the method of the invention. 2′-substituted nucleotides are underscored. [0060]
    TABLE 1
    OLIGO ID SEQ ID
    NO. OLIGONUCLEOTIDE NO.:
    1. CTCTCGCACCCATCTCTCTCCTTCU 1
    2. CTCTCGCACCCATCTCTCTCCTUCU 2
    3. CTCTCGCACCCATCTCTCTCCUUCU 3
    4. CTCTCGCACCCATCTCUCUCCUUCU 4
    5. CTCTCGCACCCAUCUCUCUCCUUCU 5
    6. CTCTCGCACCCAUCUCUCUCCUUCU 6
    7. CTCTCGCACCCAUCUCUCUCCUUCU 7
    8. CUCUCGCACCCAUCUCUCUCCUUCU 8
    9. C TCTCGCACCCATCTCTCTCCTTCU 1
    10. CUCTCGCACCCATCTCTCTCCTTCU 9
    11. CUCUC GCACCCATCTCTCTCCUUCU 10
    12. CUCUCGCACCCATCTCUCUCCUUCU 11
    13. CUCUCGC ACCCAUCUCUCUCCUUCU 12
    14. CUCUCGCACCCATCTCTCUCCUUCU 13
    15. C TCTCGCACCCAUCUCUCUCCUUCU 5
    16. CUCUCGCACCCAUCTCTCTCCUUCU 14
    17. CUCUCGCACCCATCTCTCTCCUUCU 15
    18. CUCTCGCACCCAUCUCUCUCCUUCU 16
    19. CUCTCGCACCCATCTCTCUCCUUCU 17
  • The oligonucleotides administered to the animal may be chimeric in that they contain more than one type of internucleotide linkage. Such chimeric oligonucleotides are described in U.S. Pat. Nos. 5,149,797 and 5,366,878. For example, chimeric oligonucleotides useful in the method of the invention may include phosphorothioate and alkylphosphonate internucleotide linkages. One preferred alkylphosphonate linkage is a methylphosphonate linkage. [0061]
  • Table 2 lists some representative specifics of chimeric oligonucleotides which are useful in the method of the invention. The alkylphosphonate internucleotide linkages are indicated by “:”; the phosphorothioate linkages are indicated by “-”. [0062]
    TABLE 2
    NO: OLIGONUCLEOTIDE (5′ø3′) SEQ ID NO:
    20 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T:T:C:T 18
    21 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C:T 18
    22 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T:T:C:T 18
    23 C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T:T:C:T 18
    24 C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C:T 18
    25 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T:C:T 18
    26 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T:C:T 18
    27 C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T:C:T 18
    28 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C:T 18
    29 C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T:T:C:T 18
    30 C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T:T:C:T 18
    31 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C:T 18
    32 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C:T 18
    33 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T 19
    34 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    35 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T 19
    36 C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C:T 19
    37 C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    38 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    39 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    40 C:T:C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    41 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    42 C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C:T 19
    43 C:T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    44 C:T:C:T:C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
    45 C:T:C:T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T 19
  • The oligonucleotides according to the invention are effective in inhibiting the expression of various genes in viruses, pathogenic organisms, or in inhibiting the expression of cellular genes. The ability to inhibit such agents is clearly important to the treatment of a variety of disease states. Thus, oligonucleotides according to the method of the invention have a nucleotide sequence which is complementary to a nucleic acid sequence that is from a virus, a pathogenic organism or a cellular gene. Preferably such oligonucleotides are from about 6 to about 50 nucleotides in length. [0063]
  • For purposes of the invention, the term “oligonucleotide sequence that is complementary to a nucleic acid sequence” is intended to mean an oligonucleotide sequence that binds to the target nucleic acid sequence under physiological conditions, e.g., by Watson-Crick base pairing (interaction between oligonucleotide and single-stranded nucleic acid) or by Hoogsteen base pairing (interaction between oligonucleotide and double-stranded nucleic acid) or by any other means including in the case of a oligonucleotide binding to RNA, pseudoknot formation. Such binding (by Watson Crick base pairing) under physiological conditions is measured as a practical matter by observing interference with the function of the nucleic acid sequence. [0064]
  • The nucleic acid sequence to which an oligonucleotide according to the invention is complementary will vary, depending upon the gene to be down-regulated. In some cases, the target gene or nucleic acid sequence will be a virus nucleic acid sequence. The use of antisense oligonucleotides to inhibit various viruses is well known (reviewed in Agrawal (1992) [0065] Trends in Biotech. 10:152-158). Viral nucleic acid sequences that are complementary to effective antisense oligonucleotides have been described for many viruses, including human immunodeficiency virus type 1 (HIV-1) (U.S. Pat. No. 4,806,463), herpes simplex virus (U.S. Pat. No. 4,689,320), influenza virus (U.S. Pat. No. 5,194,428), and human papilloma virus (Storey et al. (1991) Nucleic Acids Res. 19:4109-4114). Sequences complementary to any of these nucleic acid sequences can be used for oligonucleotides according to the invention, as can be oligonucleotide sequences complementary to nucleic acid sequences from any other virus. Additional viruses that have known nucleic acid sequences against which antisense oligonucleotides can be prepared include, but are not limited to, foot and mouth disease virus (see, Robertson et al. (1985) J. Virol. 54:651; Harris et al. (1980) Virol. 36:659), yellow fever virus (see Rice et al. (1985) Science 229:726), varicella-zoster virus (see, Davison and Scott (1986) J. Gen. Virol. 67:2279), Epstein-Barr virus, cytomegalovirus, respiratory syncytial virus (RSV), and cucumber mosaic virus (see Richards et al. (1978) Virol. 89:395).
  • For example, an oligonucleotide has been designed which is complementary to a portion of the HIV-1 gene, and as such, has significant anti-HIV effects (Agrawal (1992) [0066] Antisense Res. Development 2:261-266). The target of this oligonucleotide has been found to be conserved among various HIV-1 isolates. It is 56% G+C rich, water soluble, and relatively stable under physiological conditions. This oligonucleotide binds to a complementary RNA target under physiological conditions, with the T of the duplex approximately being 56° C. The antiviral activity of this oligonucleotide has been tested in several models, including acutely and chronically infected CEM cells, long-term cultures mimicking in vivo conditions, human peripheral blood lymphocytes and macrophages, and isolates from HIV-1 infected patients (Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA) (1992) 89:11209-11213); Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA) (1993) 90:3860-3864); Lisziewicz et al. (Proc. Natl. Acad. Sci. (USA) (1994) 91:7942-7946); Agrawal et al. (J. Ther. Biotech) in press).
  • The oligonucleotides according to the invention alternatively can have an oligonucleotide sequence complementary to a nucleic acid sequence of a pathogenic organism. The nucleic acid sequences of many pathogenic organisms have been described, including the malaria organism, [0067] Plasmodium falciparum, and many pathogenic bacteria. Oligonucleotide sequences complementary to nucleic acid sequences from any such pathogenic organism can be used in oligonucleotides according to the invention. Nonlimiting examples of pathogenic eucaryotes having known nucleic acid sequences against which antisense oligonucleotides can be prepared include Trypanosom abrucei gambiense and Leishmania (See Campbell et al., Nature 311:350 (1984)), and Fasciola hepatica (See Zurita et al., Proc. Natl. Acad. Sci. (USA) 84:2340 (1987).
  • Antifungal oligonucleotides can be prepared using a target hybridizing region having an oligonucleotide sequence that is complementary to a nucleic acid sequence from, e.g., the chitin synthetase gene, and antibacterial oligonucleotides can be prepared using, e.g., the alanine racemase gene. Among fungal diseases that may be treatable by the method of treatment according to the invention are candidiasis, histoplasmosis, cryptococcocis, blastomycosis, aspergillosis, sporotrichosis, chromomycosis, dermatophytosis, and coccidioidomycosis. The method might also be used to treat rickettsial diseases (e.g., typhus, Rocky Mountain spotted fever), as well as sexually transmitted diseases caused by [0068] Chlamydia trachomatis or Lymphogranuloma venereum. A variety of parasitic diseases may be treated by the method according to the invention, including amebiasis, Chagas' disease, toxoplasmosis, pneumocystosis, giardiasis, cryptosporidiosis, trichomoniasis, and Pneumocystis carini pneumonia; also worm (helminthic) diseases such as ascariasis, filariasis, trichinosis, schistosomiasis and nematode or cestode infections. Malaria may be treated by the method of treatment of the invention regardless of whether it is caused by P. falciparum, P. vivas, P. orale, or P. malariae.
  • The infectious diseases identified above may all be treated by the method of treatment according to the invention because the infectious agents for these diseases are known and thus oligonucleotides according to the invention can be prepared, having oligonucleotide sequence that is complementary to a nucleic acid sequence that is an essential nucleic acid sequence for the propagation of the infectious agent, such as an essential gene. [0069]
  • Other disease states or conditions that may be treatable by the method according to the invention are those which result from an abnormal expression or product of a cellular gene. These conditions may be treated by administration of oligonucleotides according to the invention, and have been discussed earlier in this disclosure. [0070]
  • Other oligonucleotides according to the invention can have a nucleotide sequence complementary to a cellular gene or gene transcript, the abnormal expression or product of which results in a disease state. The nucleic acid sequences of several such cellular genes have been described, including prion protein (Stahl et al. (1991) [0071] FASEB J. 5:2799-2807), the amyloid-like protein associated with Alzheimer's disease (U.S. Pat. No. 5,015,570), and various well-known oncogenes and proto-oncogenes, such as c-myb, c-myc, c-abl, and n-ras. In addition, oligonucleotides that inhibit the synthesis of structural proteins or enzymes involved largely or exclusively in spermatogenesis, sperm motility, the binding of the sperm to the egg or any other step affecting sperm viability may be used as contraceptives. Similarly, contraceptives for women may be oligonucleotides that inhibit proteins or enzymes involved in ovulation, fertilization, implantation or in the biosynthesis of hormones involved in those processes.
  • Hypertension may be controlled by oligonucleotides that down-regulate the synthesis of angiotensin converting enzyme or related enzymes in the renin/angiotensin system. Platelet aggregation may be controlled by suppression of the synthesis of enzymes necessary for the synthesis of thromboxane A2 for use in myocardial and cerebral circulatory disorders, infarcts, arteriosclerosis, embolism and thrombosis. Deposition of cholesterol in arterial wall may be inhibited by suppression of the synthesis of fatty acid co-enzyme A: cholesterol acyl transferase in arteriosclerosis. Inhibition of the synthesis of cholinephosphotransferase may be useful in hypolipidemia. [0072]
  • There are numerous neural disorders in which hybridization arrest may be used to reduce or eliminate adverse effects of the disorder. For example, suppression of the synthesis of monoamine oxidase may be used in Parkinson's disease. Suppression of catechol o-methyl transferase may be used to treat depression; and suppression of indole N-methyl transferase may be used in treating schizophrenia. [0073]
  • Suppression of selected enzymes in the arachidonic acid cascade which leads to prostaglandins and leukotrienes may be useful in the control of platelet aggregation, allergy, inflammation, pain and asthma. [0074]
  • Suppression of the protein expressed by the multidrug resistance (mdr-1) gene, which can be responsible for development of resistance of tumors to a variety of anti-cancer drugs and is a major impediment in chemotherapy may prove to be beneficial in the treatment of cancer. Oligonucleotide sequences complementary to nucleic acid sequences from any of these genes can be used for oligonucleotides according to the invention, as can be oligonucleotide sequences complementary to any other cellular gene transcript, the abnormal expression or product of which results in a disease state. [0075]
  • The oligonucleotides described herein are administered orally or enterally to the animal subject in the form of therapeutic pharmaceutical formulations that are effective for treating virus infection, infections by pathogenic organisms, or disease resulting from abnormal gene expression or from the expression of an abnormal gene product. In some aspects or the method according to the invention, the oligonucleotides are administered in conjunction with other therapeutic agents, e.g., AZT in the case of AIDS. [0076]
  • The therapeutic pharmaceutical formulation containing the oligonucleotide includes a physiologically acceptable carrier, such as an inert diluent or an assimilable edible carrier with which the peptide is administered. Suitable formulations that include pharmaceutically acceptable excipients for introducing compounds to the bloodstream by other than injection routes can be found in [0077] Remington's Pharmaceutical Sciences (18th ed.) (Genarro, ed. (1990) Mack Publishing Co., Easton, Pa.). The oligonucleotide and other ingredients may be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet. The oligonucleotide may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. When the oligonucleotide is administered orally, it may be mixed with other food forms and pharmaceutically acceptable flavor enhancers. When the oligonucleotide is administered enterally, they may be introduced in a solid, semi-solid, suspension, or emulsion form and may be compounded with any number of well-known, pharmaceutically acceptable additives. Sustained release oral delivery systems and/or enteric coatings for orally administered dosage forms are also contemplated such as those described in U.S. Pat. Nos. 4,704,295, 4,556,552, 4,309,404, and 4,309,406.
  • The amount of oligonucleotide in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit contains between from about 50 micrograms to about 200 mg per kg body weight of the animal, with 10 mg to 100 mg per kg being most preferable. [0078]
  • It will be appreciated that the unit content of active ingredient or ingredients contained in an individual dose of each dosage form need not in itself constitute an effective amount since the necessary effective amount can be reached by administration of a plurality of dosage units (such as capsules or tablets or combinations thereof). [0079]
  • In order to determine if the oligonucleotide administered according to the method of the invention is absorbed into body tissues, and if so, in which tissues absorption occurs, the following study was performed. Samples of various body tissues from treated rats were analyzed for radioactivity at increasing hours after oral administration of a radioactively labelled phosphorothioate oligonucleotide. FIG. 1 illustrates the plasma, liver, and kidney concentration-time course of an oligonucleotide equivalents after oral administration of the radiolabelled oligonucleotide. These results demonstrate that the drug is absorbed through gastrointestinal tract and accumulated in the kidney and the liver. [0080]
  • As illustrated in FIGS. 2A and 2B, both unmodified and hybrid oligonucleotides were shown to be stable in the stomach up to 6 hr following oral administration. The unmodified oligonucleotide underwent extensive degradation in small and large intestine, the majority of the radioactivity being associated with the different length of truncated oligonucleotide (FIG. 2A). In contrast, the hybrid oligonucleotide was more stable compared to the unmodified oligonucleotide, the majority of the radioactivity in small intestine being associated with the intact oligonucleotide (FIG. 2B). Increased degradation of the hybrid oligonucleotide was observed in the large intestine (FIG. 2B). [0081]
  • [0082] 35S-labelled modified oligonucleotides were also orally administered to mice at a single dose. For the hybrid oligonucleotide, similar profiles of gel electrophoresis of radioactivity in the gastrointestinal tract were observed with mice compared to rats (FIG. 3A). For the chimeric oligonucleotide, gel electrophoresis of radioactivity in the gastrointestinal tract revealed that this compound was stable in stomach and small intestine, with significant degradation in large intestine (FIG. 3B).
  • The chemical form of radioactivity in rat plasma was further evaluated by HPLC as shown in FIGS. 4A and 4B, demonstrating the presence of both intact PS oligonucleotide (A) as well as metabolites (B) 12 hours after oral administration (see FIG. 4B). Intact oligonucleotide was also detected in [0083] rat liver 6 hours (FIG. 5B) and 12 hours (FIG. 5C) after oral administration. Radioactivity in rat brain, thymus, heart, lung, liver, kidney, adrenals, stomach, small intestine, large intestine, skeletal muscle, testes, thyroid, epidermis, whole eye, and bone marrow was detectable 48 hours after oral administration of the radiolabelled oligonucleotide. For unmodified oligonucleotide, minimal intact form was detectable in rat tissue samples. However, as shown in FIG. 11A for the hybrid oligonucleotide and in FIG. 11B for the chimeric oligonucleotide, intact oligonucleotides were detected in plasma and tissue samples of the liver, kidney, spleen, heart, and lung.
  • Further evidence to support the absorption of the oligonucleotide comes from urine sample analysis after radioactively labelled oligonucleotide was orally administered. FIG. 6 shows the cumulative excretion of the radioactively labelled oligonucleotide into the urine over 48 hr following the administration of radiolabelled phosphorothioate oligonucleotide. That the oligonucleotide continues to be excreted in the urine over time implies that other tissues had absorbed it, and that the body was capable of absorption for an extended period of time. FIGS. 7B and 7C demonstrate that although the majority of radioactivity in urine was present as degradative products, intact oligonucleotide was also detected, demonstrating that this oligonucleotide is absorbed intact. [0084]
  • To determine the level of bioavailability of oligonucleotides following oral administration, the level of the oligonucleotide in the gastrointestinal tract (stomach and intestine) and feces was measured. FIG. 8 shows that approximately 80% of administered oligonucleotide remained or was excreted in feces, indicating that 20% of administered oligonucleotide was absorbed. This oligonucleotide was stable in stomach; no significant degradative products in stomach contents were detected six hours after oral administration (FIG. 9). The majority of administered oligonucleotide in the contents of the large intestine were also present as the intact compound (FIG. 10). [0085]
  • In another study, the oral bioavailability of unmodified, hybrid, and chimeric oligonucleotide administered to rat and mouse were compared, based on the quantitation of radioactivity in the gastrointestinal tract, feces, plasma, urine and remaining tissues at various times. Total recovery of radioactivity in the study was 92±6%. The total absorption of unmodified oligonucleotide was shown to be 17.3±5.5% over 6 hr and 35.5±6.0% over 12 hr following oral administration of the radiolabelled unmodified oligonucleotide to rats at a dose of 30 mg/kg. Minimal intact unmodified oligonucleotide was also detected in tissues outside enterohepatic system. [0086]
  • The total absorption of hybrid oligonucleotide was determined to be 10.2±2.5% over 6 hr and 25.9±4.7% over 12 hr following oral administration of the radiolabelled hybrid oligonucleotide in rats. Although the total absorption rates were slightly lower than that of the PS oligonucleotide, the hybrid oligonucleotide-derived radioactivity was stable in various tissues. The total absorption of the chimeric oligonucleotide was determined to be 23.6±2.8% over 6 hr and 39.3±2.4% over 12 hr following oral administration of the radiolabelled oligonucleotide. The comparison of oral availability of the three types of oligonucleotides is shown in FIG. 12, expressed as the percentages of administered doses in the gastrointestinal tract plus feces, in plasma, in tissues, and in urine. [0087]
  • Oral absorption of oligonucleotides in fasting animals was also determined with PS-oligonucleotide and hybrid oligonucleotide. Decreased absorption rates were found, indicating that the retention time of the oligonucleotides in the gastrointestinal tract in the fasting animals may be lower than in non-fasting animals. [0088]
  • These studies indicate that hybrid and chimeric oligonucleotides have enhanced bioavailability, which is associated with their stability in the gastrointestinal tract and other tissues. [0089]
  • Thus, using the method of the invention, successful absorption of oligonucleotides was accomplished through the gastrointestinal tract and distributed throughout the body. Intact oligonucleotides were detected in plasma and various tissues and excreted into the urine. These results demonstrate that oral administration is a potential means for delivery of oligonucleotides as therapeutic agents. [0090]
  • The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results. [0091]
  • EXAMPLES
  • 1. Synthesis and Analysis of Oligonucleotides [0092]
  • An unmodified HIV-specific 25mer oligonucleotide and hybrid 25mer phosphorothioate-linked oligonucleotide having SEQ ID NO:10 and containing 2′-O-[0093] methyl ribonucleotide 3′ and 5′ sequences and a deoxyribonucleotide interior, as well as two hybrid 18mer phosphorothioate-linked oligonucleotides having SEQ ID NOS:20 and 21, and containing 2′-O-methyl ribonucleotide 3′ and 5′ sequences and a deoxyribonucleotide interior, were synthesized, purified, and analyzed as follows.
  • Unmodified phosphorothioate deoxynucleosides were synthesized on CPG on a 5-6 μmole scale on an automated synthesizer (model 8700, Millipore, Bedford, Mass.) using the H-phosphonate approach described in U.S. Pat. No. 5,149,798. Deoxynucleoside H-phosphonates were obtained from Millipore (Bedford, Mass.). 2′-O-methyl ribonucleotide H-phosphonates or phosphorothioates were synthesized by standard procedures (see, e.g., “Protocols for Oligonucleotides and Analogs” in [0094] Meth. Mol. Biol. (1993) volume 20) or commercially obtained (e.g., from Glenn Research, Sterling, Va. and Clontech, Palo Alto, Calif.). Segments of oligonucleotides containing 2′-O-methyl nucleoside(s) were assembled by using 2′-O-methyl ribonucleoside H-phosphonates or phosphorothioates for the desired cycles. Similarly, segments of oligonucleotides containing deoxyribonucleosides were assembled by using deoxynucleoside H-phosphonates for the desired cycles. After assembly, CPG bound oligonucleotide H-phosphonate was oxidized with sulfur to generate the phosphorothioate linkage. Oligonucleotides were then deprotected in concentrated NH4OH at 40° C. for 48 hours.
  • Crude oligonucleotide (about 500 A[0095] 260 units) was analyzed on reverse low pressure chromatography on a C18 reversed phase medium. The DMT group was removed by treatment with 80% aqueous acetic acid, then the oligonucleotides were dialyzed against distilled water and lyophilized.
  • Chimeric oligonucleotide was prepared as described in Zhang et al. ([0096] J. Pharmacol. Exptal. Thera. (1996) 278:(in press)). This chimeric oligonucleotide had 3 methylphosphate internucleotide linkages at the 5′ end, 4 methylphosphonate internucleotide linkages at the 3′ end, and phosphorothioate internucleotide linkages elsewhere in the molecule were prepared and purified as follows. The first four couplings were carried out by using nucleoside methyl-phosphoramidite, followed by oxidation with a standard iodine reagent. The next seven couplings were carried out by using nucleoside β-cyanoethylphosphoramidite, followed by oxidation with 3H-1,2-benzodithiole-3-one-1,1,-dioxide. The eighth coupling was carried out by using nucleoside β-cyanoethylphosphoramidite. After several washes with acetonitrile, the column was removed from the machine, and CPG-bound oligonucleotide was removed from the column and placed in an Eppendorf tube (1.5 ml).
  • 2. Radioactive Labelling of Oligonucleotide [0097]
  • To obtain [0098] 35S-labelled oligonucleotide, synthesis was carried out in two steps. The first 19 nucleotides of the sequence SEQ ID NO:1) from its 3′-end were assembled using the β-cyanoethyl-phosphoramidite approach (see, Beaucage in Protocols for Oligonucleotides and Analogs (Agrawal, ed.), Humana Press, (1993), pp. 33-61). The last six nucleotides were assembled using the H-phosphonate approach (see, Froehler in Protocols for Oligonucleotides and Analogs (Agrawal, ed.) Humana Press, 1993, pp. 63-80). Controlled pore glass (CPG) support-bound oligonucleotide (30 mg of CPG; approximately 1 μM) containing five H-phosphonate linkage was oxidized with 35S8 (4 mCi, 1 Ci/mg, Amersham; 1 Ci=37 GBq) in 60 ml carbon disulfide/pyridine/triethylamine (10:10:1). The oxidation reaction was performed at room temperature for 1 hr with occasional shaking. Then 2 μl, 5 μl, and 200 μl of 5% cold sulfur (32 S8) in same solvent mixture was added every 30 min to complete the oxidation. The solution was removed and the CPG support was washed with carbon disulfide/pyridine/triethylamine (10:10:1) (3×500 μl) and with acetonitrile (3×700 μl). The product was deprotected in concentrated ammonium hydroxide (55° C., 14 hr) and evaporated. The resultant product was purified by polyacrylamide gel electrophoresis (20% polyacrylamide containing 7 M urea). The desired band was excised under UV shadowing and the PS-oligonucleotide was extracted from the gel and desalted with a Sep-Pak C18 cartridge (Waters) and Sephadex G-15 column. The yield was 20 A260 units (600 μg; specific activity, 1 μCi/μg).
  • To prepare [0099] 35S-labelled chimeric oligonucleotide, CPG-bound oligonucleotide was treated with a mixture of elemental 35S (4.5 mCi/mg atom, in 50 μl of toluene; Amersham) in a solution of carbon disulfide, pyridine and triethylamine (200 μl, 200 μl and 4 μl, respectively) at 25° C. for 1 hr. 3H-1,2-benzodithiole-3-one-1,1-dioxide (1 ml, 2% in acetonitrile) was added, and the reaction mixture was allowed to remain at 25° C. for 10 min. The supernatant was removed and the CPG-bound oligonucleotide was washed with CH3CN (10×1 ml). After capping with acetic anhydride (300 μl, tetrahydrofuran-lutidine-acetic anhydride, 8:1:1) and dimethylaminopyridine (300 μl, 0.625% in pyridine), the 35S-CPG-bound oligonucleotide was washed with acetonitrile (10×1 ml) and packed in the column. For the next eight couplings, we used nucleoside β-cyanoethylphosphoramidite followed by oxidation with 3H-1,2-benzodithiole-3-one-1,1-dioxide. The last four couplings were carried out by using nucleoside methylphosphonamidite followed by oxidation with iodine reagent. The crude CPG-bound 25mer chimeric oligonucleotide was treated with concentrated ammonium hydroxide (28%, 3 ml) at 25° C. for 2 hr. Evaporation on a Speed-Vac concentrator yielded a dried yellow pellet as crude 35S-labelled chimeric PS-oligonucleotide, which was immediately treated with a solution of ethylenediamine-ethanol-water (50:45:5, v/v/v/, 4 ml) for 4.5 hr at 25° C. Purification by PAGE (20% polyacrylamide, 7 M urea) gave pure 35S-labeled chimeric oligonucleotide as a white pellet (194 A260 units, 155 μCi, 180 μCi/mol). Other chemicals and reagents used in the present study were of the highest grade available.
  • 3. Animals and Treatment [0100]
  • Male Sprague-Dawley rats (110+/−10 g, Harlan Laboratories, Indianapolis, Ind.) and male CD-/F2 mice (25±3 g, Charles River Laboratory, Wilmington, Mass.) were used in the study. The animals were fed with commercial diet and water ad libitum for 1 week prior to the study. [0101]
  • Unlabelled and [0102] 35S-labelled oligonucleotides were dissolved in physiological saline (0.9% NaCl) in a concentration of 25 mg/ml, and were administered to the fasted animals via gavage at the designated dose (30-50 mg/kg for rats and 10 mg/kg for mice). Doses were based on the pretreatment body weight and rounded to the nearest 0.01 ml. After dosing, each animal was placed in a metabolism cage and fed with commercial diet and water ad libitum. Total voided urine was collected and each metabolism cage was then washed following the collection intervals. Total excreted feces was collected from each animal at various timepoints, and feces samples were homogenized prior to quantitation of radioactivity. Blood samples were collected in heparinized tubes from animals at the various timepoints. Plasma was separated by centrifugation. Animals were euthanized by exsanguination under sodium pentobarbital anesthesia at various times (i.e., 1, 3, 6, 12, 24, and 48 hr; 3 animals/time point). Following euthanasia, the tissues were collected from each animal. All tissues/organs were trimmed of extraneous fat or connective tissue, emptied and cleaned of all contents, individually weighed, and the weights recorded prior to homogenization.
  • To quantitate the total absorption of the hybrid oligonucleotide, two additional groups of animals (3 per group) for each test oligonucleotide were treated using the same procedure as above. Animals were killed at 6 or 12 hr post dosing, and the gastrointestinal tract was then removed. Radioactivities in the gastrointestinal tract, feces, urine, plasma, and the remainder of the body were determined separately. Total recovery of radioactivity was also determined to be 95±6%. The percentage of the absorbed hybrid oligonucleotide-derived radioactivity was determined by the following calculation: [0103] ( total radioactivity in the remainder of the body + total radioactivity in urine ) ( total radioactivity in the gastrointestinal tract , feces , urine , plasma , and the remainder of the body ) × 100 % .
    Figure US20040033980A1-20040219-M00001
  • 4. Total Radioactivity Measurements [0104]
  • The total radioactivities in tissues and body fluids were determined by liquid scintillation spectrometry (LS 6000TA, Beckman, Irvine, Calif.). In brief, biological fluids (plasma, 50-100 μl; urine, 50-100 μl) were mixed with 6 ml scintillation solvent (Budget-Solve, RPI, Mt. Prospect, Ill.) to determine total radioactivity. Feces were ground and weighed prior to being homogenized in a 9-fold volume of 0.9% NaCl saline. An aliquot of the homogenate (100 μl) was mixed with solubilizer (TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent (6 ml) to permit quantitation of total radioactivity. [0105]
  • Following their removal, tissues were immediately blotted on Whatman No. 1 filter paper and weighed prior to being homogenized in 0.9% NaCl saline (3-5 ml per gram of wet weight). The resulting homogenate (100 μl) was mixed with solubilizer (TS-2, RPI, Mt. Prospect, Ill.) and then with scintillation solvent (6 ml) to determine total radioactivity. The volume of 0.9% NaCl saline added to each tissue sample was recorded. The homogenized tissues/organs were kept frozen at ≦−70° C. until the use for further analysis. [0106]
  • 5. HPLC Analysis [0107]
  • The radioactivity in urine was analyzed by paired-ion HPLC using a modification of the method described essentially by Sands et al. ([0108] Mol. Pharm. (1994) 45:932-943). Urine samples were centrifuged and passed through a 0.2-μm Acro filter (Gelman, Ann Arbor, Mich.) prior to analysis. Hybrid oligonucleotide and metabolites in plasma samples were extracted using the above methods in sample preparation for PAGE. A Microsorb MV-C4 column (Rainin Instruments, Woburn, Mass.) was employed in HPLC using a Hewlett Packard 1050 HPLC with a quaternary pump for gradient making. Mobile phase included two buffers; Buffer A was 5 mM-A reagent (Waters Co., Bedford, Mass.) in water and Buffer B was 4:1 (v/v) Acetonitrile (Fisher)/water. The column was eluted at a flow rate of 1.5 ml/min, using the following gradient: (1) 0-4 min, 0% buffer B; (2) 4-15 min 0-35% Buffer B; and (3) 15-70 min 35%-80% Buffer B. The column was equilibrated with Buffer A for at least 30 min prior to the next run. By using a RediFrac fraction collector (Pharmacia LKB Biotechnology, Piscataway, N.J.), 1-min fractions (1.5 ml) were collected into 7-ml scintillation vials and mixed with 5 ml scintillation solvent to determine radioactivity in each fraction.
  • 6. PAGE and Autoradiography [0109]
  • Plasma and tissue homogenates were incubated with proteinase K (2 mg/ml) in extraction buffer (0.5% SDS/10 mM NaCl/20 mM Tris-HCl, pH 7.6/10 mM EDTA) for 1 hr at 60° C. The samples were then extracted twice with phenol/chloroform (1:1, v/v) and once with chloroform. After ethanol precipitation, the extracts were analyzed by electrophoresis in 20% polyacrylamide gels containing 7 M urea. Urine samples were filtered, desalted and then analyzed by polyacrylamide gel electrophoresis (PAGE). The gels were fixed in 10% acetic acid/10% methanol solution and then dried before autoradiography. [0110]
  • Eouivalents [0111]
  • Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims. [0112]
  • 1 21 1 25 DNA Artificial Sequence Antisense DNA/RNA 1 ctctcgcacc catctctctc cttcu 25 2 25 DNA Artificial Sequence Antisense DNA/RNA 2 ctctcgcacc catctctctc ctucu 25 3 25 DNA Artificial Sequence Antisense DNA/RNA 3 ctctcgcacc catctctctc cuucu 25 4 25 DNA Artificial Sequence Antisense DNA/RNA 4 ctctcgcacc catctcucuc cuucu 25 5 25 DNA Artificial Sequence Antisense DNA/RNA 5 ctctcgcacc caucucucuc cuucu 25 6 25 DNA Artificial Sequence Antisense DNA/RNA 6 ctctcgcacc caucucucuc cuucu 25 7 25 DNA Artificial Sequence Antisense DNA/RNA 7 ctctcgcacc caucucucuc cuucu 25 8 25 RNA Artificial Sequence Antisense 8 cucucgcacc caucucucuc cuucu 25 9 25 DNA Artificial Sequence Antisense DNA/RNA 9 cuctcgcacc catctctctc cttcu 25 10 25 DNA Artificial Sequence Antisense DNA/RNA 10 cucucgcacc catctctctc cuucu 25 11 25 DNA Artificial Sequence Antisense DNA/RNA 11 cucucgcacc catctcucuc cuucu 25 12 25 DNA Artificial Sequence Antisense DNA/RNA 12 cucucgcacc caucucucuc cuucu 25 13 25 DNA Artificial Sequence Antisense DNA/RNA 13 cucucgcacc catctctcuc cuucu 25 14 25 DNA Artificial Sequence Antisense DNA/RNA 14 cucucgcacc cauctctctc cuucu 25 15 25 DNA Artificial Sequence Antisense DNA/RNA 15 cucucgcacc catctctctc cuucu 25 16 25 DNA Artificial Sequence Antisense DNA/RNA 16 cuctcgcacc caucucucuc cuucu 25 17 25 DNA Artificial Sequence Antisense DNA/RNA 17 cuctcgcacc catctctcuc cuucu 25 18 25 DNA Artificial Sequence Antisense 18 ctctcgcacc catctctctc cttct 25 19 22 DNA Artificial Sequence Antisense 19 ctctcgcacc catctctctc ct 22 20 18 DNA Artificial Sequence Antisense DNA/RNA 20 gcgugcctcc tcacuggc 18 21 18 DNA Artificial Sequence Mismatched Control DNA/RNA 21 gcaugcatcc gcacaggc 18

Claims (24)

What is claimed is:
1. A method for introducing an intact oligonucleotide into a mammal, comprising the step of orally administering an oligonucleotide of about 15 to about 25 nucleotides, the oligonucleotide comprising at least one phosphorothioate internucleotide linkage, and further comprising at least one 2′-O-alkoxyalkyl ribonucleotide,
wherein the oligonucleotide is present in intact form in the systemic plasma and liver tissue of the mammal at least six hours following oral administration.
2. The method of claim 1, wherein the 2′-O-alkoxyalkyl ribonucleotide is at the 3′ terminus of the oligonucleotide.
3. The method of claim 2, wherein the oligonucleotide comprises at least two 2′-O-alkoxyalkyl ribonucleotides at the 3′ terminus of the oligonucleotide.
4. The method of claim 2, wherein the oligonucleotide further comprises at least one 2′-substituted ribonucleotide at the 5′ terminus.
5. The method of claim 1, wherein the oligonucleotide further comprises a phosphorothioate internucleotide linkage between every nucleotide.
6. The method of claim 1, wherein the 2′-O-alkoxyalkyl ribonucleotide is a 2′-O-methoxyethyl ribonucleotide.
7. A method for introducing an intact oligonucleotide into a mammal, comprising the step of orally administering an oligonucleotide of about 15 to about 25 nucleotides, the oligonucleotide comprising at least one non-phosphodiester internucleotide linkage, and further comprising at least one 2′-O-alkoxyalkyl ribonucleotide at the 5′ terminus and at least one 2′-O-alkoxyalkyl ribonucleotide at the 3′ terminus,
wherein the oligonucleotide is present in intact form in the systemic plasma and liver tissue of the mammal at least six hours following oral administration.
8. The method of claim 7, wherein the 2′-O-alkoxyalkyl ribonucleotide is a 2′-O— methoxyethyl-ribonucleotide.
9. The method of claim 7, wherein oligonucleotide is a hybrid antisense oligonucleotide.
10. The method of claim 9, wherein the oligonucleotide comprises at least one deoxyribonucleotide.
11. The method of claim 9, wherein the oligonucleotide further comprises at least three contiguous deoxyribonucleotides.
12. The method of claim 9, wherein the oligonucleotide comprises a region of at least four contiguous deoxyribonucleotides that activate RNase H activity.
13. The method of claim 7, wherein the oligonucleotide is complementary to a single-stranded target nucleic acid.
14. The method of claim 7, wherein oligonucleotide is complementary to a gene.
15. The method of claim 7, wherein the oligonucleotide is complementary to a partial sequence of a gene or of a gene transcript.
16. The method of claim 7, wherein all of the ribonucleotides in the oligonucleotide are 2′-substituted ribonucleotides.
17. The method of claim 7, wherein the oligonucleotide comprises an internucleotide linkage selected from the group consisting of alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphoramidites, phosphate esters, carbamates, carbonates, phosphate triesters, acetamidate, and carboxymethyl esters.
18. The method of claim 17, wherein essentially all of the nucleotides are linked via phosphorothioate or phosphorodithioate internucleotide linkages.
19. The method of claim 7, wherein the oligonucleotide is modified.
20. The method of claim 7, wherein the oligonucleotide is complementary to a partial sequence of a gene or a gene transcript of a virus, a pathogenic organism, or a cellular gene.
21. The method of claim 7, wherein the oligonucleotide is complementary to a partial sequence of a gene or a gene transcript of a virus involved in a disease selected from the group consisting of AIDS, oral and genital herpes, papilloma warts, influenza, foot and mouth disease, yellow fever, chicken pox, shingles, adult T-cell leukemia, Burkitt's lymphoma, nasopharyngeal carcinoma, and hepatitis.
22. The method of claim 7, wherein the oligonucleotide is complementary to a partial sequence of a gene or a gene transcript encoding a protein associated with Alzheimer's disease.
23. The method of claim 7, wherein the oligonucleotide is complementary to a partial sequence of a gene or a gene transcript encoding a protein in a parasite causing a parasitic disease selected from the group consisting of amebiasis, Chagas' disease, toxoplasmosis, pneumocytosis, giardiasis, cryptoporidiosis, trichomoniasis, malaria, ascariasis, filariasis, trichinosis and schistosomiasis infections.
24. The method of claim 7, wherein the oligonucleotide is complementary to a partial sequence of an HIV gene or a gene transcript and comprises about 15 to 26 nucleotides linked by phosphorothioate internucleoside linkages.
US10/640,898 1994-10-25 2003-08-14 Method of down-regulating gene expression Abandoned US20040033980A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/640,898 US20040033980A1 (en) 1994-10-25 2003-08-14 Method of down-regulating gene expression

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US08/328,520 US5591721A (en) 1994-10-25 1994-10-25 Method of down-regulating gene expression
US70991096A 1996-09-09 1996-09-09
US75800596A 1996-11-27 1996-11-27
US09/587,934 US6608035B1 (en) 1994-10-25 2000-06-06 Method of down-regulating gene expression
US10/640,898 US20040033980A1 (en) 1994-10-25 2003-08-14 Method of down-regulating gene expression

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/587,934 Division US6608035B1 (en) 1994-10-25 2000-06-06 Method of down-regulating gene expression

Publications (1)

Publication Number Publication Date
US20040033980A1 true US20040033980A1 (en) 2004-02-19

Family

ID=24351775

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/587,934 Expired - Fee Related US6608035B1 (en) 1994-10-25 2000-06-06 Method of down-regulating gene expression
US10/640,898 Abandoned US20040033980A1 (en) 1994-10-25 2003-08-14 Method of down-regulating gene expression

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/587,934 Expired - Fee Related US6608035B1 (en) 1994-10-25 2000-06-06 Method of down-regulating gene expression

Country Status (3)

Country Link
US (2) US6608035B1 (en)
AU (1) AU2001275313A1 (en)
WO (1) WO2002008420A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6936593B1 (en) 1994-10-25 2005-08-30 Hybridon, Inc. Method of down-regulating gene expression

Families Citing this family (180)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6608035B1 (en) * 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
US7074768B2 (en) * 1995-08-17 2006-07-11 Idera Pharmaceuticals, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
EP1007657B1 (en) * 1997-08-19 2006-02-08 Idera Pharmaceuticals, Inc. Hiv-specific oligonucleotides and methods of their use
EP1288713A1 (en) * 2001-08-29 2003-03-05 Chugai Photo Chemical Co. Ltd. Processing agent for silver halide color photosensitive material and processing method thereof
US20040014698A1 (en) * 2002-07-18 2004-01-22 Gonzalo Hortelano Oral administration of therapeutic agent coupled to transporting agent
US20040014704A1 (en) * 2002-07-18 2004-01-22 Gonzalo Hortelano Oral administration of therapeutic agent coupled to transporting agent induces tolerance
US20040016013A1 (en) * 2002-07-18 2004-01-22 Gonzalo Hortelano Transgenic animals produced using oral administration of a genetic agent coupled to a transporting agent
US7345163B2 (en) * 2002-08-28 2008-03-18 Quiatech Ab Process for separating and deprotecting oligonucleotides
EP1537208A1 (en) * 2002-09-13 2005-06-08 Replicor, Inc. Non-sequence complementary antiviral oligonucleotides
US20050196382A1 (en) * 2002-09-13 2005-09-08 Replicor, Inc. Antiviral oligonucleotides targeting viral families
US20050208032A1 (en) * 2004-01-16 2005-09-22 Gonzalo Hortelano Oral administration of therapeutic agent coupled to transporting agent
KR101147147B1 (en) 2004-04-01 2012-05-25 머크 샤프 앤드 돔 코포레이션 Modified polynucleotides for reducing off-target effects in rna interference
US20060166234A1 (en) 2004-11-22 2006-07-27 Barbara Robertson Apparatus and system having dry control gene silencing compositions
US7923207B2 (en) 2004-11-22 2011-04-12 Dharmacon, Inc. Apparatus and system having dry gene silencing pools
US7935811B2 (en) 2004-11-22 2011-05-03 Dharmacon, Inc. Apparatus and system having dry gene silencing compositions
US8252755B2 (en) 2006-09-22 2012-08-28 Dharmacon, Inc. Duplex oligonucleotide complexes and methods for gene silencing by RNA interference
MY153691A (en) 2007-05-22 2015-03-13 Arcturus Therapeutics Inc Hydroxymethyl substituted rna oligonucleotides and rna complexes
US7845686B2 (en) * 2007-12-17 2010-12-07 S & B Technical Products, Inc. Restrained pipe joining system for plastic pipe
US8188060B2 (en) 2008-02-11 2012-05-29 Dharmacon, Inc. Duplex oligonucleotides with enhanced functionality in gene regulation
BRPI0922355A8 (en) 2008-12-03 2017-12-12 Marina Biotech Inc NUCLEIC ACIDS, METHODS FOR REDUCING EXPRESSION OF A GENE IN A CELL IN VITRO, USE OF NUCLEIC ACID, RNA COMPLEX AND USE OF RNA COMPLEX
WO2011153323A2 (en) 2010-06-02 2011-12-08 Alnylam Pharmaceuticals, Inc. Compositions and methods directed to treating liver fibrosis
AU2011325956B2 (en) 2010-11-12 2016-07-14 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
WO2012079046A2 (en) 2010-12-10 2012-06-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of klf-1 and bcl11a genes
EP2649182A4 (en) 2010-12-10 2015-05-06 Alnylam Pharmaceuticals Inc Compositions and methods for increasing erythropoietin (epo) production
KR102481317B1 (en) 2011-03-29 2022-12-26 알닐람 파마슈티칼스 인코포레이티드 Compositions and methods for inhibiting expression of tmprss6 gene
EP2694660B1 (en) 2011-04-03 2018-08-08 The General Hospital Corporation Efficient protein expression in vivo using modified rna (mod-rna)
MX345095B (en) 2011-06-21 2017-01-17 Alnylam Pharmaceuticals Inc Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof.
EP3597750B1 (en) 2011-06-23 2022-05-04 Alnylam Pharmaceuticals, Inc. Serpina1 sirnas: compositions of matter and methods of treatment
US20140328811A1 (en) 2011-08-01 2014-11-06 Alnylam Pharmaceuticals, Inc. Method for improving the success rate of hematopoietic stem cell transplants
CA2848753C (en) 2011-09-14 2022-07-26 Rana Therapeutics, Inc. Multimeric oligonucleotide compounds
US9133461B2 (en) 2012-04-10 2015-09-15 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US9127274B2 (en) 2012-04-26 2015-09-08 Alnylam Pharmaceuticals, Inc. Serpinc1 iRNA compositions and methods of use thereof
JP2015518713A (en) 2012-05-16 2015-07-06 ラナ セラピューティクス インコーポレイテッド Compositions and methods for modulating UTRN expression
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
WO2013173598A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating atp2a2 expression
EA201492116A1 (en) 2012-05-16 2015-05-29 Рана Терапьютикс, Инк. COMPOSITIONS AND METHODS FOR MODULATING THE EXPRESSION OF MECP2
EP2850188A4 (en) 2012-05-16 2016-01-20 Rana Therapeutics Inc Compositions and methods for modulating hemoglobin gene family expression
CA2873794A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics Inc. Compositions and methods for modulating smn gene family expression
CA2884608A1 (en) 2012-09-14 2014-03-20 Rana Therapeutics, Inc. Multimeric oligonucleotide compounds
CA2890207A1 (en) 2012-11-05 2014-05-08 Foundation Medicine, Inc. Novel ntrk1 fusion molecules and uses thereof
CA3150658A1 (en) 2013-01-18 2014-07-24 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
US20150366890A1 (en) 2013-02-25 2015-12-24 Trustees Of Boston University Compositions and methods for treating fungal infections
KR102342916B1 (en) 2013-03-14 2021-12-24 알닐람 파마슈티칼스 인코포레이티드 Complement component c5 irna compositions and methods of use thereof
CN115261411A (en) 2013-04-04 2022-11-01 哈佛学院校长同事会 Therapeutic uses of genome editing with CRISPR/Cas systems
EP3587578A1 (en) 2013-05-22 2020-01-01 Alnylam Pharmaceuticals, Inc. Tmprss6 irna compositions and methods of use thereof
PT2999785T (en) 2013-05-22 2018-07-09 Alnylam Pharmaceuticals Inc Serpina1 irna compositions and methods of use thereof
WO2014197835A2 (en) 2013-06-06 2014-12-11 The General Hospital Corporation Methods and compositions for the treatment of cancer
WO2015050990A1 (en) 2013-10-02 2015-04-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
US10119143B2 (en) 2013-10-04 2018-11-06 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
CA2928779A1 (en) 2013-10-21 2015-04-30 The General Hospital Corporation Methods relating to circulating tumor cell clusters and the treatment of cancer
CN105814205B (en) 2013-12-12 2019-11-19 阿尔尼拉姆医药品有限公司 Complement component iRNA composition and its application method
JP6599334B2 (en) 2013-12-20 2019-10-30 ザ ジェネラル ホスピタル コーポレイション Methods and assays for circulating tumor cells in the blood
EA201691587A1 (en) 2014-02-11 2017-01-30 Элнилэм Фармасьютикалз, Инк. COMPOSITIONS BASED ON iRNA FOR KETOGEXOKINASE (KHK) AND METHODS OF THEIR APPLICATION
CN106460025A (en) 2014-03-25 2017-02-22 阿克丘勒斯治疗公司 UNA oligomers having reduced off-target effects in gene silencing
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
JP6771387B2 (en) 2014-03-25 2020-10-21 アークトゥラス・セラピューティクス・インコーポレイテッドArcturus Therapeutics,Inc. Transthyretin allele-selective UNA oligomer for gene silencing
TW201607559A (en) 2014-05-12 2016-03-01 阿尼拉製藥公司 Methods and compositions for treating a SERPINC1-associated disorder
KR20220087576A (en) 2014-05-22 2022-06-24 알닐람 파마슈티칼스 인코포레이티드 Angiotensinogen (agt) irna compositions and methods of use thereof
WO2015187541A1 (en) 2014-06-02 2015-12-10 Children's Medical Center Corporation Methods and compositions for immunomodulation
CA2959386A1 (en) 2014-08-29 2016-03-03 Lee Adam Wheeler Methods and compositions for the treatment of cancer
EP3191591A1 (en) 2014-09-12 2017-07-19 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
JOP20200115A1 (en) 2014-10-10 2017-06-16 Alnylam Pharmaceuticals Inc Compositions And Methods For Inhibition Of HAO1 (Hydroxyacid Oxidase 1 (Glycolate Oxidase)) Gene Expression
EP3207138B1 (en) 2014-10-17 2020-07-15 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof
EP3212794B1 (en) 2014-10-30 2021-04-07 Genzyme Corporation Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
CA2966044A1 (en) 2014-10-30 2016-05-06 The General Hospital Corporation Methods for modulating atrx-dependent gene repression
JOP20200092A1 (en) 2014-11-10 2017-06-16 Alnylam Pharmaceuticals Inc HEPATITIS B VIRUS (HBV) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
EP3221451A1 (en) 2014-11-17 2017-09-27 Alnylam Pharmaceuticals, Inc. Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof
WO2016130943A1 (en) 2015-02-13 2016-08-18 Rana Therapeutics, Inc. Hybrid oligonucleotides and uses thereof
JP2018510621A (en) 2015-02-13 2018-04-19 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain-containing 3 (PNPLA3) iRNA compositions and methods of use thereof
US10900036B2 (en) 2015-03-17 2021-01-26 The General Hospital Corporation RNA interactome of polycomb repressive complex 1 (PRC1)
KR20180020125A (en) 2015-03-27 2018-02-27 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 Modified T cells and methods for their manufacture and use
WO2016161299A1 (en) 2015-04-01 2016-10-06 Arcturus Therapeutics, Inc. Therapeutic una oligomers and uses thereof
US10745702B2 (en) 2015-04-08 2020-08-18 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the LECT2 gene
WO2016201301A1 (en) 2015-06-12 2016-12-15 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
EP3310918B1 (en) 2015-06-18 2020-08-05 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
WO2016209862A1 (en) 2015-06-23 2016-12-29 Alnylam Pharmaceuticals, Inc. Glucokinase (gck) irna compositions and methods of use thereof
US10494632B2 (en) 2015-07-10 2019-12-03 Alnylam Pharmaceuticals, Inc. Insulin-like growth factor binding protein, acid labile subunit (IGFALS) compositions and methods of use thereof
WO2017015671A1 (en) 2015-07-23 2017-01-26 Arcturus Therapeutics, Inc. Compositions for treating amyloidosis
WO2017040078A1 (en) 2015-09-02 2017-03-09 Alnylam Pharmaceuticals, Inc. PROGRAMMED CELL DEATH 1 LIGAND 1 (PD-L1) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
MA45295A (en) 2016-04-19 2019-02-27 Alnylam Pharmaceuticals Inc HIGH DENSITY LIPOPROTEIN BINDING PROTEIN (HDLBP / VIGILINE) RNA COMPOSITION AND METHODS FOR USING THEM
EP3469083A1 (en) 2016-06-10 2019-04-17 Alnylam Pharmaceuticals, Inc. COMPLEMENT COMPONENT C5 iRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING PAROXYSMAL NOCTURNAL HEMOGLOBINURIA (PNH)
SG10201913552UA (en) 2016-12-16 2020-03-30 Alnylam Pharmaceuticals Inc Methods for treating or preventing ttr-associated diseases using transthyretin (ttr) irna compositions
CA3059446A1 (en) 2017-04-18 2018-10-25 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (hbv) infection
AU2018301477A1 (en) 2017-07-13 2020-02-27 Alnylam Pharmaceuticals Inc. Lactate dehydrogenase a (LDHA) iRNA compositions and methods of use thereof
WO2019089922A1 (en) 2017-11-01 2019-05-09 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof
US20200385719A1 (en) 2017-11-16 2020-12-10 Alnylam Pharmaceuticals, Inc. Kisspeptin 1 (kiss1) irna compositions and methods of use thereof
WO2019100039A1 (en) 2017-11-20 2019-05-23 Alnylam Pharmaceuticals, Inc. Serum amyloid p component (apcs) irna compositions and methods of use thereof
US20200308588A1 (en) 2017-12-18 2020-10-01 Alnylam Pharmaceuticals, Inc. High mobility group box-1 (hmgb1) irna compositions and methods of use thereof
TW202016304A (en) 2018-05-14 2020-05-01 美商阿尼拉製藥公司 Angiotensinogen (agt) irna compositions and methods of use thereof
JP2021533767A (en) 2018-08-13 2021-12-09 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) dsRNA substance composition and its usage
US20210348162A1 (en) 2018-08-16 2021-11-11 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
CN112424355A (en) 2018-09-18 2021-02-26 阿尔尼拉姆医药品有限公司 Ketohexokinase (KHK) iRNA compositions and methods of use thereof
US10913951B2 (en) 2018-10-31 2021-02-09 University of Pittsburgh—of the Commonwealth System of Higher Education Silencing of HNF4A-P2 isoforms with siRNA to improve hepatocyte function in liver failure
CN113631709A (en) 2018-12-20 2021-11-09 普拉克西斯精密药物股份有限公司 Compositions and methods for treating KCNT 1-related disorders
CN113543791A (en) 2018-12-20 2021-10-22 维尔生物科技有限公司 Combination HBV therapy
SG11202107669WA (en) 2019-01-16 2021-08-30 Genzyme Corp Serpinc1 irna compositions and methods of use thereof
SG11202112240VA (en) 2019-05-13 2021-12-30 Vir Biotechnology Inc Compositions and methods for treating hepatitis b virus (hbv) infection
WO2021022109A1 (en) 2019-08-01 2021-02-04 Alnylam Pharmaceuticals, Inc. SERPIN FAMILY F MEMBER 2 (SERPINF2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021022108A2 (en) 2019-08-01 2021-02-04 Alnylam Pharmaceuticals, Inc. CARBOXYPEPTIDASE B2 (CPB2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021030522A1 (en) 2019-08-13 2021-02-18 Alnylam Pharmaceuticals, Inc. SMALL RIBOSOMAL PROTEIN SUBUNIT 25 (RPS25) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
CN114616331A (en) 2019-09-03 2022-06-10 阿尔尼拉姆医药品有限公司 Compositions and methods for inhibiting expression of LECT2 gene
WO2021067747A1 (en) 2019-10-04 2021-04-08 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing ugt1a1 gene expression
EP4045652A1 (en) 2019-10-18 2022-08-24 Alnylam Pharmaceuticals, Inc. Solute carrier family member irna compositions and methods of use thereof
CN115176004A (en) 2019-10-22 2022-10-11 阿尔尼拉姆医药品有限公司 Complement component C3 iRNA compositions and methods of use thereof
US20230040920A1 (en) 2019-11-01 2023-02-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing dnajb1-prkaca fusion gene expression
AR120341A1 (en) 2019-11-01 2022-02-09 Alnylam Pharmaceuticals Inc COMPOSITIONS OF RNAi AGENTS AGAINST HUNTINGTINE (HTT) AND THEIR METHODS OF USE
BR112022009216A2 (en) 2019-11-13 2022-08-02 Alnylam Pharmaceuticals Inc METHODS AND COMPOSITIONS TO TREAT AN ANGIOTENSINOGEN-ASSOCIATED DISORDER (AGT)
US20230056569A1 (en) 2019-11-22 2023-02-23 Alnylam Pharmaceuticals, Inc. Ataxin3 (atxn3) rnai agent compositions and methods of use thereof
BR112022011417A2 (en) 2019-12-13 2022-08-30 Alnylam Pharmaceuticals Inc COMPOSITIONS OF THE IRNA AGENT OF THE OPEN READING PHASE 72 OF HUMAN CHROMOSOME 9 (C9ORF72) AND METHODS OF USE THEREOF
TW202138559A (en) 2019-12-16 2021-10-16 美商阿尼拉製藥公司 Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
WO2021154941A1 (en) 2020-01-31 2021-08-05 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions for use in the treatment of amyotrophic lateral sclerosis (als)
KR20220140593A (en) 2020-02-10 2022-10-18 알닐람 파마슈티칼스 인코포레이티드 Compositions and methods for silencing VEGF-A expression
IL295496A (en) 2020-02-18 2022-10-01 Alnylam Pharmaceuticals Inc Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof
WO2021178607A1 (en) 2020-03-05 2021-09-10 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof for treating or preventing complement component c3-associated diseases
AU2021232014A1 (en) 2020-03-06 2022-10-06 Alnylam Pharmaceuticals, Inc. Ketohexokinase (KHK) IRNA compositions and methods of use thereof
WO2021188611A1 (en) 2020-03-18 2021-09-23 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant
JP2023519274A (en) 2020-03-26 2023-05-10 アルナイラム ファーマシューティカルズ, インコーポレイテッド CORONAVIRUS iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US20230190785A1 (en) 2020-03-30 2023-06-22 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing dnajc15 gene expression
US20230295622A1 (en) 2020-04-06 2023-09-21 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing myoc expression
JP2023521094A (en) 2020-04-07 2023-05-23 アルナイラム ファーマシューティカルズ, インコーポレイテッド Compositions and methods for silencing SCN9A expression
EP4133076A1 (en) 2020-04-07 2023-02-15 Alnylam Pharmaceuticals, Inc. Angiotensin-converting enzyme 2 (ace2) irna compositions and methods of use thereof
WO2021206922A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. Transmembrane serine protease 2 (tmprss2) irna compositions and methods of use thereof
JP2023523993A (en) 2020-04-27 2023-06-08 アルナイラム ファーマシューティカルズ, インコーポレイテッド Apolipoprotein E (ApoE) iRNA agent compositions and methods of use thereof
CN116096381A (en) 2020-04-30 2023-05-09 阿尔尼拉姆医药品有限公司 Complement Factor B (CFB) iRNA compositions and methods of use thereof
EP4150078A1 (en) 2020-05-15 2023-03-22 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of argininosuccinate lyase (asl)
WO2021231675A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of argininosuccinate synthetase (ass1)
WO2021231679A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of gap junction protein beta 2 (gjb2)
WO2021231692A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of otoferlin (otof)
EP4150089A1 (en) 2020-05-15 2023-03-22 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of retinoschisin 1 (rs1)
EP4150086A1 (en) 2020-05-15 2023-03-22 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of leucine rich repeat kinase 2 (lrrk2)
EP4150077A1 (en) 2020-05-15 2023-03-22 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of transmembrane channel-like protein 1 (tmc1)
EP4150076A1 (en) 2020-05-15 2023-03-22 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of methyl-cpg binding protein 2 (mecp2)
EP4153746A1 (en) 2020-05-21 2023-03-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting marc1 gene expression
AU2021274944A1 (en) 2020-05-22 2022-12-15 Wave Life Sciences Ltd. Double stranded oligonucleotide compositions and methods relating thereto
US11408000B2 (en) 2020-06-03 2022-08-09 Triplet Therapeutics, Inc. Oligonucleotides for the treatment of nucleotide repeat expansion disorders associated with MSH3 activity
EP4162050A1 (en) 2020-06-09 2023-04-12 Alnylam Pharmaceuticals, Inc. Rnai compositions and methods of use thereof for delivery by inhalation
CA3184289A1 (en) 2020-06-18 2021-12-23 Alnylam Pharmaceuticals, Inc. Xanthine dehydrogenase (xdh) irna compositions and methods of use thereof
CA3182458A1 (en) 2020-06-24 2021-12-30 Laura ROSEN Engineered hepatitis b virus neutralizing antibodies and uses thereof
EP4217489A1 (en) 2020-09-24 2023-08-02 Alnylam Pharmaceuticals, Inc. Dipeptidyl peptidase 4 (dpp4) irna compositions and methods of use thereof
WO2022076291A1 (en) 2020-10-05 2022-04-14 Alnylam Pharmaceuticals, Inc. G protein-coupled receptor 75 (gpr75) irna compositions and methods of use thereof
AU2021365822A1 (en) 2020-10-21 2023-06-08 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating primary hyperoxaluria
EP4232582A1 (en) 2020-10-23 2023-08-30 Alnylam Pharmaceuticals, Inc. Mucin 5b (muc5b) irna compositions and methods of use thereof
IL302709A (en) 2020-11-13 2023-07-01 Alnylam Pharmaceuticals Inc COAGULATION FACTOR V (F5) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
CA3201452A1 (en) 2020-12-01 2022-06-09 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression
EP4259795A1 (en) 2020-12-08 2023-10-18 Alnylam Pharmaceuticals, Inc. Coagulation factor x (f10) irna compositions and methods of use thereof
WO2022140702A1 (en) 2020-12-23 2022-06-30 Flagship Pioneering, Inc. Compositions of modified trems and uses thereof
WO2022150260A1 (en) 2021-01-05 2022-07-14 Alnylam Pharmaceuticals, Inc. COMPLEMENT COMPONENT 9 (C9) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022174000A2 (en) 2021-02-12 2022-08-18 Alnylam Pharmaceuticals, Inc. Superoxide dismutase 1 (sod1) irna compositions and methods of use thereof for treating or preventing superoxide dismutase 1- (sod1-) associated neurodegenerative diseases
WO2022182864A1 (en) 2021-02-25 2022-09-01 Alnylam Pharmaceuticals, Inc. Prion protein (prnp) irna compositions and methods and methods of use thereof
AU2022226098A1 (en) 2021-02-26 2023-08-24 Alnylam Pharmaceuticals, Inc. KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
IL305418A (en) 2021-03-04 2023-10-01 Alnylam Pharmaceuticals Inc Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof
WO2022192519A1 (en) 2021-03-12 2022-09-15 Alnylam Pharmaceuticals, Inc. Glycogen synthase kinase 3 alpha (gsk3a) irna compositions and methods of use thereof
AR125230A1 (en) 2021-03-29 2023-06-28 Alnylam Pharmaceuticals Inc COMPOSITIONS OF ANTI-HUNTINGTIN (HTT) RNAi AGENTS AND THEIR METHODS OF USE
EP4314293A1 (en) 2021-04-01 2024-02-07 Alnylam Pharmaceuticals, Inc. Proline dehydrogenase 2 (prodh2) irna compositions and methods of use thereof
EP4330392A1 (en) 2021-04-26 2024-03-06 Alnylam Pharmaceuticals, Inc. Transmembrane protease, serine 6 (tmprss6) irna compositions and methods of use thereof
WO2022232343A1 (en) 2021-04-29 2022-11-03 Alnylam Pharmaceuticals, Inc. Signal transducer and activator of transcription factor 6 (stat6) irna compositions and methods of use thereof
WO2022245583A1 (en) 2021-05-18 2022-11-24 Alnylam Pharmaceuticals, Inc. Sodium-glucose cotransporter-2 (sglt2) irna compositions and methods of use thereof
EP4341405A1 (en) 2021-05-20 2024-03-27 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2022256283A2 (en) 2021-06-01 2022-12-08 Korro Bio, Inc. Methods for restoring protein function using adar
TW202317762A (en) 2021-06-02 2023-05-01 美商艾拉倫製藥股份有限公司 Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
IL308743A (en) 2021-06-04 2024-01-01 Alnylam Pharmaceuticals Inc HUMAN CHROMOSOME 9 OPEN READING FRAME 72 (C9ORF72) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
AR126070A1 (en) 2021-06-08 2023-09-06 Alnylam Pharmaceuticals Inc COMPOSITIONS AND METHODS FOR TREATING OR PREVENTING STARGARDT DISEASE AND/OR DISORDERS ASSOCIATED WITH RETINOL BORDER PROTEIN 4 (RBP4)
US20230194709A9 (en) 2021-06-29 2023-06-22 Seagate Technology Llc Range information detection using coherent pulse sets with selected waveform characteristics
WO2023278410A1 (en) 2021-06-29 2023-01-05 Korro Bio, Inc. Methods and compositions for adar-mediated editing
KR20240026203A (en) 2021-06-30 2024-02-27 알닐람 파마슈티칼스 인코포레이티드 Methods and compositions for treating angiotensinogen (AGT)-related disorders
TW202333748A (en) 2021-07-19 2023-09-01 美商艾拉倫製藥股份有限公司 Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder
IL309905A (en) 2021-07-23 2024-03-01 Alnylam Pharmaceuticals Inc Beta-catenin (ctnnb1) irna compositions and methods of use thereof
WO2023009687A1 (en) 2021-07-29 2023-02-02 Alnylam Pharmaceuticals, Inc. 3-hydroxy-3-methylglutaryl-coa reductase (hmgcr) irna compositions and methods of use thereof
WO2023014677A1 (en) 2021-08-03 2023-02-09 Alnylam Pharmaceuticals, Inc. Transthyretin (ttr) irna compositions and methods of use thereof
TW202337474A (en) 2021-08-04 2023-10-01 美商艾拉倫製藥股份有限公司 Irna compositions and methods for silencing angiotensinogen (agt)
TW202334413A (en) 2021-08-13 2023-09-01 美商艾拉倫製藥股份有限公司 Factor xii (f12) irna compositions and methods of use thereof
WO2023044370A2 (en) 2021-09-17 2023-03-23 Alnylam Pharmaceuticals, Inc. Irna compositions and methods for silencing complement component 3 (c3)
WO2023044094A1 (en) 2021-09-20 2023-03-23 Alnylam Pharmaceuticals, Inc. Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof
CA3234835A1 (en) 2021-10-22 2023-04-27 Korro Bio, Inc. Methods and compositions for disrupting nrf2-keap1 protein interaction by adar mediated rna editing
WO2023076450A2 (en) 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
TW202333749A (en) 2021-10-29 2023-09-01 美商艾拉倫製藥股份有限公司 Complement factor b (cfb) irna compositions and methods of use thereof
WO2023141314A2 (en) 2022-01-24 2023-07-27 Alnylam Pharmaceuticals, Inc. Heparin sulfate biosynthesis pathway enzyme irna agent compositions and methods of use thereof
WO2024039776A2 (en) 2022-08-18 2024-02-22 Alnylam Pharmaceuticals, Inc. Universal non-targeting sirna compositions and methods of use thereof
WO2024059165A1 (en) 2022-09-15 2024-03-21 Alnylam Pharmaceuticals, Inc. 17b-hydroxysteroid dehydrogenase type 13 (hsd17b13) irna compositions and methods of use thereof

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4309404A (en) * 1979-08-09 1982-01-05 American Home Products Corporation Sustained release pharmaceutical compositions
US4309406A (en) * 1979-07-10 1982-01-05 American Home Products Corporation Sustained release pharmaceutical compositions
US4556552A (en) * 1983-09-19 1985-12-03 Colorcon, Inc. Enteric film-coating compositions
US4704295A (en) * 1983-09-19 1987-11-03 Colorcon, Inc. Enteric film-coating compositions
US5149797A (en) * 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5271941A (en) * 1990-11-02 1993-12-21 Cho Chung Yoon S Antisense oligonucleotides of human regulatory subunit RI.sub.α of cAMP-dependent protein kinases
US5403709A (en) * 1992-10-06 1995-04-04 Hybridon, Inc. Method for sequencing synthetic oligonucleotides containing non-phosphodiester internucleotide linkages
US5442049A (en) * 1992-11-19 1995-08-15 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating the effects of cytomegalovirus infections
US5470967A (en) * 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5510239A (en) * 1993-10-18 1996-04-23 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of multidrug resistance-associated protein
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5563255A (en) * 1994-05-31 1996-10-08 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US5578716A (en) * 1993-12-01 1996-11-26 Mcgill University DNA methyltransferase antisense oligonucleotides
US5587361A (en) * 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5591721A (en) * 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5612212A (en) * 1993-11-12 1997-03-18 The University Of Pennsylvania Selective inhibition of cell proliferation by vav antisense oligonucleotides
US5652355A (en) * 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5948898A (en) * 1992-03-16 1999-09-07 Isis Pharmaceuticals, Inc. Methoxyethoxy oligonucleotides for modulation of protein kinase C expression
US5969117A (en) * 1995-08-17 1999-10-19 Hybridon, Inc. Modified protein kinase a-specific oligonucleotide
US6143881A (en) * 1992-07-23 2000-11-07 University Of Massachusetts Worcester Hybrid oligonucleotide phosphorothioates
US6608035B1 (en) * 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
US6645943B1 (en) * 1994-10-25 2003-11-11 Hybridon, Inc. Method of down-regulating gene expression

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL108206A0 (en) 1993-01-06 1994-04-12 Univ Johns Hopkins Oligomers having improved stability at acid ph
NZ263985A (en) 1993-03-31 1997-07-27 Hybridon Inc Oligonucleotide complementary to an essential amino acid sequence of influenza virus

Patent Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4309406A (en) * 1979-07-10 1982-01-05 American Home Products Corporation Sustained release pharmaceutical compositions
US4309404A (en) * 1979-08-09 1982-01-05 American Home Products Corporation Sustained release pharmaceutical compositions
US4556552A (en) * 1983-09-19 1985-12-03 Colorcon, Inc. Enteric film-coating compositions
US4704295A (en) * 1983-09-19 1987-11-03 Colorcon, Inc. Enteric film-coating compositions
US5149797A (en) * 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5470967A (en) * 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5271941A (en) * 1990-11-02 1993-12-21 Cho Chung Yoon S Antisense oligonucleotides of human regulatory subunit RI.sub.α of cAMP-dependent protein kinases
US5587361A (en) * 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5948898A (en) * 1992-03-16 1999-09-07 Isis Pharmaceuticals, Inc. Methoxyethoxy oligonucleotides for modulation of protein kinase C expression
US6143881A (en) * 1992-07-23 2000-11-07 University Of Massachusetts Worcester Hybrid oligonucleotide phosphorothioates
US5652355A (en) * 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5403709A (en) * 1992-10-06 1995-04-04 Hybridon, Inc. Method for sequencing synthetic oligonucleotides containing non-phosphodiester internucleotide linkages
US5442049A (en) * 1992-11-19 1995-08-15 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating the effects of cytomegalovirus infections
US5510239A (en) * 1993-10-18 1996-04-23 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of multidrug resistance-associated protein
US5612212A (en) * 1993-11-12 1997-03-18 The University Of Pennsylvania Selective inhibition of cell proliferation by vav antisense oligonucleotides
US5578716A (en) * 1993-12-01 1996-11-26 Mcgill University DNA methyltransferase antisense oligonucleotides
US5563255A (en) * 1994-05-31 1996-10-08 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US5591721A (en) * 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US6608035B1 (en) * 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
US6645943B1 (en) * 1994-10-25 2003-11-11 Hybridon, Inc. Method of down-regulating gene expression
US6936593B1 (en) * 1994-10-25 2005-08-30 Hybridon, Inc. Method of down-regulating gene expression
US5969117A (en) * 1995-08-17 1999-10-19 Hybridon, Inc. Modified protein kinase a-specific oligonucleotide

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6936593B1 (en) 1994-10-25 2005-08-30 Hybridon, Inc. Method of down-regulating gene expression

Also Published As

Publication number Publication date
AU2001275313A1 (en) 2002-02-05
WO2002008420A3 (en) 2002-10-17
WO2002008420A2 (en) 2002-01-31
US6608035B1 (en) 2003-08-19

Similar Documents

Publication Publication Date Title
US6645943B1 (en) Method of down-regulating gene expression
US6608035B1 (en) Method of down-regulating gene expression
US5591721A (en) Method of down-regulating gene expression
Zhang et al. Pharmacokinetics and tissue distribution in rats of an oligodeoxynucleotide phosphorothioate (GEM 91) developed as a therapeutic agent for human immunodeficiency virus type-1
Agrawal et al. Pharmacokinetics, biodistribution, and stability of oligodeoxynucleotide phosphorothioates in mice.
US5968909A (en) Method of modulating gene expression with reduced immunostimulatory response
US6346614B1 (en) Hybrid oligonucleotide phosphorothioates
EP1007657B1 (en) Hiv-specific oligonucleotides and methods of their use
JPH09507502A (en) Antisense oligonucleotide regulation of raf gene expression
WO2000071703A2 (en) Inhibition of histone deacetylase
AU5402894A (en) Therapeutic anti-hiv oligonucleotide and pharmaceutical
JPH10508760A (en) Antisense oligonucleotide regulation of raf gene expression
US20070105808A1 (en) Inhibition of histone deacetylase
JP2002534086A (en) Therapeutic phosphodiesterase inhibitors
JPH09500787A (en) Promoting inhibition of oligonucleotides on protein production, cell growth and / or growth of infectious disease pathogens
WO1996031600A1 (en) Method of modulating gene expression without depleting complement
EP1007098B1 (en) Down-regulation of gene expression by colorectal administration of synthetic oligonucleotides
WO1996023878A1 (en) Human immunodeficiency virus transcription inhibitors and methods of their use
WO1998049287A2 (en) Antisense oligonucleotides specific for thymidylate synthase
WO1997033992A1 (en) Selected oligonucleotides with anti-cytomegalovirus activity
US20030099959A1 (en) Cooperative oligonucleotides

Legal Events

Date Code Title Description
AS Assignment

Owner name: IDERA PHARMACEUTICALS, INC.,MASSACHUSETTS

Free format text: CERTIFICATE OF OWNERSHIP AND MERGER;ASSIGNOR:HYBRIDON INC.;REEL/FRAME:016835/0938

Effective date: 20050912

Owner name: IDERA PHARMACEUTICALS, INC., MASSACHUSETTS

Free format text: CERTIFICATE OF OWNERSHIP AND MERGER;ASSIGNOR:HYBRIDON INC.;REEL/FRAME:016835/0938

Effective date: 20050912

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION