EP2228132A1 - Isothermic PCR device - Google Patents

Isothermic PCR device Download PDF

Info

Publication number
EP2228132A1
EP2228132A1 EP09154744A EP09154744A EP2228132A1 EP 2228132 A1 EP2228132 A1 EP 2228132A1 EP 09154744 A EP09154744 A EP 09154744A EP 09154744 A EP09154744 A EP 09154744A EP 2228132 A1 EP2228132 A1 EP 2228132A1
Authority
EP
European Patent Office
Prior art keywords
chamber
temperature
reaction liquid
liquid
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09154744A
Other languages
German (de)
French (fr)
Inventor
Dr. Thomas Rothmann
Dr. Ralf Himmelreich
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qiagen GmbH
Original Assignee
Qiagen GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qiagen GmbH filed Critical Qiagen GmbH
Priority to EP09154744A priority Critical patent/EP2228132A1/en
Publication of EP2228132A1 publication Critical patent/EP2228132A1/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00—Heating or cooling apparatus; Heat insulating devices
    • B01L7/52—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B01L7/525—Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01F—MIXING, e.g. DISSOLVING, EMULSIFYING OR DISPERSING
    • B01F33/00—Other mixers; Mixing plants; Combinations of mixers
    • B01F33/30—Micromixers
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01F—MIXING, e.g. DISSOLVING, EMULSIFYING OR DISPERSING
    • B01F33/00—Other mixers; Mixing plants; Combinations of mixers
    • B01F33/45—Magnetic mixers; Mixers with magnetically driven stirrers
    • B01F33/452—Magnetic mixers; Mixers with magnetically driven stirrers using independent floating stirring elements
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/08—Geometry, shape and general structure
    • B01L2300/0832—Geometry, shape and general structure cylindrical, tube shaped
    • B01L2300/0841—Drums
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/08—Geometry, shape and general structure
    • B01L2300/0861—Configuration of multiple channels and/or chambers in a single devices
    • B01L2300/0867—Multiple inlets and one sample wells, e.g. mixing, dilution
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/18—Means for temperature control
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/18—Means for temperature control
    • B01L2300/1838—Means for temperature control using fluid heat transfer medium
    • B01L2300/185—Means for temperature control using fluid heat transfer medium using a liquid as fluid
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00—Moving or stopping fluids
    • B01L2400/04—Moving fluids with specific forces or mechanical means
    • B01L2400/0403—Moving fluids with specific forces or mechanical means specific forces
    • B01L2400/0457—Moving fluids with specific forces or mechanical means specific forces passive flow or gravitation
    • F—MECHANICAL ENGINEERING; LIGHTING; HEATING; WEAPONS; BLASTING
    • F28—HEAT EXCHANGE IN GENERAL
    • F28C—HEAT-EXCHANGE APPARATUS, NOT PROVIDED FOR IN ANOTHER SUBCLASS, IN WHICH THE HEAT-EXCHANGE MEDIA COME INTO DIRECT CONTACT WITHOUT CHEMICAL INTERACTION
    • F28C3/00—Other direct-contact heat-exchange apparatus
    • F28C3/04—Other direct-contact heat-exchange apparatus the heat-exchange media both being liquids
    • F—MECHANICAL ENGINEERING; LIGHTING; HEATING; WEAPONS; BLASTING
    • F28—HEAT EXCHANGE IN GENERAL
    • F28D—HEAT-EXCHANGE APPARATUS, NOT PROVIDED FOR IN ANOTHER SUBCLASS, IN WHICH THE HEAT-EXCHANGE MEDIA DO NOT COME INTO DIRECT CONTACT
    • F28D21/00—Heat-exchange apparatus not covered by any of the groups F28D1/00 - F28D20/00
    • F28D2021/0019—Other heat exchangers for particular applications; Heat exchange systems not otherwise provided for
    • F28D2021/0052—Other heat exchangers for particular applications; Heat exchange systems not otherwise provided for for mixers

Definitions

  • the invention relates to a method and a device for carrying out a polymerase chain reaction, which is abbreviated PCR.
  • a PCR is used to amplify the genetic material DNA using the enzyme DNA polymerase. More specifically, only a short, well-defined part of a DNA strand can be amplified by PCR. In PCR, the products of previous cycles serve as starting materials for the next cycle. It is an exponential duplication achieved. For example, a PCR process includes 12-50 cycles.
  • One cycle of a PCR begins with a denaturation.
  • the reaction liquid containing the double-stranded DNA therein is heated to typically 94-96 ° C to separate the strands of DNA.
  • the reaction liquid with the separated DNA strands is cooled to a few degrees below the melting point of the primer used, so that a primer hybridization takes place. This temperature is typically 55-65 ° C.
  • the temperature is maintained at 55-65 ° C for about 30 seconds to allow specific attachment of the primers to the DNA.
  • the reaction liquid is reheated to a temperature of typically 68-72 ° C for about 30 seconds per 500 base pairs. The exact temperature depends on the working optimum of the DNA polymerase used. This last step of a cycle is called elongation or amplification.
  • the DNA polymerase fills in the missing strands with free nucleotides.
  • an apparatus for rapidly heating and cooling a reaction vessel to various temperatures for carrying out a polymerase chain reaction comprises two surfaces for contact with the reaction vessel enclosed therebetween. An area serves as a heater. A cavity of the device is used for cooling, by cooling air in the cavity is introduced.
  • the device comprises sensors with which the respective desired temperature is measured and controlled. Disadvantageously, the entire device must always be cooled and then reheated to effect the temperature changes. Therefore, a relatively large amount of energy has to be expended and the respectively desired temperatures of the reaction liquid are reached relatively slowly.
  • the publication EP 0 402 995 B1 discloses a device for charging a reaction vessel with at least two temperature changes.
  • the apparatus includes heating elements for heating at least one sidewall of a selected chamber portion of the reaction vessel and moving means which move the reaction vessel and the heating elements along a predetermined path relative to each other.
  • the apparatus further includes cooling elements that deliver cooling fluid over the heating elements to directly cool them at repeating intervals, and that are movable in unison with the heating elements.
  • 89 A1 is a Thermocyler for carrying out a PCR is known, which includes a reaction vessel with a particularly large, the heat transfer surface serving, so as to be able to cool mainly fast.
  • the desired temperature change is brought about solely by heating or cooling with the aid of heating or cooling elements provided for this purpose.
  • Is heated in the prior art for example, with Peltier elements, infrared radiation or a hot fluid by heat exchange. Cooling is done, for example, with a cold fluid via heat exchange or with the help of Peltier elements.
  • reaction liquid for carrying out a PCR through a microfluidic system with chambers of different temperatures.
  • first chamber which is heated to such an extent that the reaction liquid reaches the temperature required for denaturation, which is also hereafter
  • the reaction liquid is then pumped into a next chamber, which is cooled in such a way that the reaction liquid in this chamber is brought to the annealing temperature, ie the temperature required for the primer hybridization.
  • reaction liquid is heated from the annealing to the temperature required for the amplification or elongation, hereinafter also called elongation temperature,
  • elongation temperature the temperature required for the amplification or elongation
  • only small volumes of liquid can be used. It must be pumped very precisely to ensure that the reaction liquid is in the desired range.
  • three chambers and connecting lines are needed to perform the PCR can.
  • a required temperature of a reaction liquid is adjusted by mixing with a second liquid whose temperature is suitably different from the temperature of the reaction liquid.
  • the second liquid may also be a reaction liquid. Since a desired temperature of a reaction liquid is obtained by mixing two previously differently tempered liquids, it is not necessary to additionally heat or cool a reaction chamber, which would be energy-consuming and lead to large time delays. For the implementation of the method, only a suitable temperature-controlled chamber and means for mixing are needed.
  • the structure can be correspondingly simple and inexpensive.
  • reaction liquid which has been previously brought to Denaturierungstemperatur and whose temperature is therefore above the temperature required for the amplification or elongation
  • reaction liquid previously has been brought to Annealingstemperatur and therefore the temperature is below the temperature required for the amplification. It is thus achieved that the part of the reaction liquid which is to be brought from the annealing temperature to the elongation temperature is heated very rapidly in the desired manner by the mixing. Since reaction liquid is used for heating, which must be cooled anyway, the desired result in an energetically favorable manner reached. Larger amounts of liquid can be tempered in the desired manner quickly and easily in the desired manner,
  • a device for carrying out the method is therefore particularly suitable for mobile use, which is powered by an internal power supply such as battery, fuel cell and / or by solar cells with energy.
  • the ratio between the two liquid volumes of the reaction liquids or liquids to be mixed is selected such that the temperature can not be exceeded or exceeded by mixing the warmer (reaction) liquid with the cooler (reaction) liquid. It therefore does not have to be tempered additionally in order to achieve the desired elongation temperature.
  • the PCR is carried out in a chamber which comprises a first and one spatially different second region.
  • the first area of this chamber is heated so that a reaction liquid in this area can be heated to Denaturéesstemperatur.
  • the second region is cooled in such a way that a reaction liquid located in this second region can be cooled to the annealing temperature.
  • the first area is spatially separated from the second area.
  • the part of the reaction liquid which is in the first region is heated to denaturation temperature and held until the present double strands of DNA have been separated to the desired extent in this part of the reaction liquid.
  • the reaction liquid located there is at the annealing temperature cooled and held until the desired extent the primer hybridization is carried out, then the two parts of the reaction liquid are mixed by means of a stirring element, so as to reach the elongation temperature.
  • the chamber in which the PCR is carried out according to the claim is flat.
  • a chamber is made flat if the width and / or depth of the chamber exceeds the height of the chamber by a multiple.
  • large heat transfer surfaces are available to heat the first area and to cool the second area.
  • an agitating element is positioned in one embodiment of the invention so that the stirring element contributes to the spatial separation. For example, if the first area is in a left half of the compartment and the second area is in a right half of the chamber, then the agitating element is placed and aligned so that it separates the left half of the compartment from the right, When the reaction liquid is to be cooled or heated, the stirring element then extends along the boundary between the first and second chamber regions and thus spatially separates the two parts of the reaction liquid.
  • the stirring element may for example be part of a magnetic stirrer or connected to a shaft extending into the chamber. If it is a magnetic stirrer, then the desired alignment is achieved, for example, by means of a suitably oriented magnetic field.
  • the two regions of the chamber can be separated from one another by a separating means, so as to be able to heat part of the reaction liquid in the first chamber, without this part of the liquid being able to mix with the second part of the reaction liquid, during which is cooled.
  • a release agent may comprise pressing means, which compress the boundary area between the first and second area and thus seal the two areas against each other.
  • the shell of the chamber is made of deformable material.
  • the mixing is effected by compressing parts of the chamber and then releasing them again.
  • the walls of the chamber to be cooled or heated are preferably made of a material which is able to conduct heat well in comparison to a band-shaped wall region which lies between the area to be heated and the area to be cooled.
  • This embodiment of a chamber further contributes to the fact that the method can be performed energetically favorable.
  • the energy is supplied in particular by means of a battery, a solar cell and / or a fuel cell, that is generally by an internal power supply, so that the process can be carried out mobile independently of an external power supply. Especially with one internal energy supply, it is important to use as little energy as possible.
  • the reaction liquid contained in the chamber comprises heat-stable polymerase, nucleobases, primers, salt and pH buffer as well as template nucleic acid RNA or DNA.
  • the oils or metals form a second phase in the PCR reaction, which on the one hand can be easily separated from the reaction liquid and on the other hand do not endanger the PCR.
  • an oil first floats on the reaction liquid and is heated to a suitable temperature together with a suitable portion of the reaction chamber.
  • the reaction liquid is cooled in a lower chamber area and brought to annealing temperature.
  • the oil is mixed with the reaction liquid.
  • the chamber is rotated 180 ° such that the heated area of the chamber is at the bottom and the cooled area at the top. If the mixing is stopped, the oil passes by gravity into the cooled chamber area of the reaction chamber.
  • the reaction liquid then passes into the region of the chamber which is heated.
  • the reaction liquid is brought to the denaturation and the oil to a suitable low temperature, so as to cool the reaction liquid in due time by mixing again quickly and in an energetically favorable manner.
  • reaction liquid floats on the liquid metal when not mixed. In principle, therefore, the same method can be carried out, as has been described above using the example of the oil.
  • a total of three different liquids are used, such as a liquid metal, a reaction liquid and an oil. It is convenient to heat the oil in an upper portion of the chamber and then to cool the liquid metal in a lower portion. In principle, however, it is not excluded that the upper area is cooled and the lower one is heated. The reaction liquid therebetween is mixed with the heated liquid when the temperature of the reaction liquid is to be appropriately increased. The reaction liquid therebetween is mixed with the cooled liquid when the temperature of the reaction liquid is appropriately lowered.
  • a liquid metal such as a liquid metal, a reaction liquid and an oil. It is convenient to heat the oil in an upper portion of the chamber and then to cool the liquid metal in a lower portion. In principle, however, it is not excluded that the upper area is cooled and the lower one is heated. The reaction liquid therebetween is mixed with the heated liquid when the temperature of the reaction liquid is to be appropriately increased. The reaction liquid therebetween is mixed with the cooled liquid when the temperature of the reaction liquid is appropriately lowered.
  • FIG. 1 shows a plan view of a flat-shaped chamber 1, in which a PCR is performed.
  • the chamber 1 has a circular base whose diameter is several times greater than the height of the chamber.
  • a left half 1a of the chamber is provided with heating means, not shown, in order to heat this left chamber portion 1a can.
  • a Mederhwood shown on the right 1b is provided with coolants, which are able to cool the right half of the chamber 1 b,
  • a stirring rod 2 of a magnetic stirrer In the basic position this separates the left half of the chamber 1 a from the right half of the chamber 1 b.
  • Suitable heating and cooling means are the known, for example initially mentioned means for these and for other embodiments of the invention.
  • FIG. 2a shows a side section of a further embodiment of a chamber according to the invention
  • an associated supervision is shown in FIG. 2b.
  • the commercial half shown on the left can be heated with a first Peltier element 3.
  • the commercial half shown on the right can be cooled with a second Peltier element 4.
  • the height of the chamber with a square base is 1 mm. Width and length or depth of the chamber are 10 mm.
  • the chamber volume is about 100 ⁇ l.
  • a stirring rod 2 of a magnetic stirrer In the chamber 1 is again a stirring rod 2 of a magnetic stirrer.
  • the qPCR was each set up with a standard dilution series of genomic DNA from E. coli. For every 25 ⁇ l final PCR volume 20 ng / 2 ng / 0.2 ng / 0.02 ng of genomic Escherichia coli DNA, ie different amounts were used for calibration measurements. To this end, in a PCR tube 1, 2.5 ⁇ l QIAGEN QuantiTect Probe PCR Master Mix, 0.1 ⁇ l EFwd (5 pmol / ⁇ l); 0.1 ⁇ l ERev (5 pmol / ⁇ l); 0.05 ⁇ L EPro (5 pmol / ⁇ L), 10.25 ⁇ L bidistilled water and 2 ⁇ L E.coli standard dilution solution started.
  • the evaluation of the qPCR shows that even under the unusual 4-step cycling conditions a PCR is successful.
  • the standards in the Amplification Plot ( Fig. 3 ) or in the evaluation graphic ( Fig. 4 ) do not differ significantly from each other.
  • the structure of the chamber together with associated facilities is simple and therefore inexpensive. The simple structure allows a small design of the overall device with which the process is performed.

Abstract

The method involves delivering a reaction liquid on a denaturing temperature, annealing temperature and elongation temperature. The temperature of the reaction liquid is changed by mixing with a warmer or cooler liquid. Parts of the reaction liquid are mixed for the temperature change. Ratio between liquid volumes of the part of the liquids is adjusted such that the elongation temperature is maintained by mixing the warmer liquid with the cooler liquid. One of the parts of the reaction liquid is heated in a region of a chamber (1) in the annealing temperature. An independent claim is also included for a chamber for implementing a polymerase chain reaction.

Description

Die Erfindung betrifft ein Verfahren und eine Vorrichtung zur Durchführung einer Polymerase-Kettenreaktion, die abgekürzt als PCR bezeichnet wird. Eine PCR dient der Vervielfältigung der Erbsubstanz DNA unter Verwendung des Enzyms DNA-Polymerase. Genauer gesagt kann mittels PCR nur ein kurzer, genau definierter Teil eines DNA-Strangs vervielfältigt werden. Bei der PCR dienen die Produkte vorheriger Zyklen als Ausgangsstoffe für den nächsten Zyklus. Es wird so eine exponentielle Vervielfältigung erreicht. Ein PCR-Prozess umfasst beispielsweise 12-50 Zyklen.The invention relates to a method and a device for carrying out a polymerase chain reaction, which is abbreviated PCR. A PCR is used to amplify the genetic material DNA using the enzyme DNA polymerase. More specifically, only a short, well-defined part of a DNA strand can be amplified by PCR. In PCR, the products of previous cycles serve as starting materials for the next cycle. It is an exponential duplication achieved. For example, a PCR process includes 12-50 cycles.

Ein Zyklus einer PCR beginnt mit einer Denaturierung. Die Reaktionsflüssigkeit mit der darin befindlichen doppelsträngigen DNA wird auf typischerweise 94-96 °C erhitzt, um die Stränge der DNA zu trennen. Anschließend wird die Reaktionsflüssigkeit mit den getrennten DNA-Strängen auf wenige Grad unter dem Schmelzpunkt der eingesetzten Primer abgekühlt, damit eine Primerhybridisierung erfolgt. Diese Temperatur liegt typischerweise bei 55-65 °C, Während der Primerhybridisierung wird die Temperatur von 55-65 °C ca. 30 Sekunden lang gehalten, um eine spezifische Anlagerung der Primer an die DNA zu ermöglichen. Abschließend wird die Reaktionsflüssigkeit auf eine Temperatur von typischerweise 68-72°C für etwa 30 Sekunden je 500 Basenpaare wieder erwärmt. Die genaue Temperatur hängt vom Arbeitsoptimum der verwendeten DNA-Polymerase ab. Dieser letzte Schritt eines Zyklus wird Elongation oder Amplifikation genannt. Dabei füllt die DNA-Polymerase die fehlenden Stränge mit freien Nukleotiden auf.One cycle of a PCR begins with a denaturation. The reaction liquid containing the double-stranded DNA therein is heated to typically 94-96 ° C to separate the strands of DNA. Subsequently, the reaction liquid with the separated DNA strands is cooled to a few degrees below the melting point of the primer used, so that a primer hybridization takes place. This temperature is typically 55-65 ° C. During primer hybridization, the temperature is maintained at 55-65 ° C for about 30 seconds to allow specific attachment of the primers to the DNA. Finally, the reaction liquid is reheated to a temperature of typically 68-72 ° C for about 30 seconds per 500 base pairs. The exact temperature depends on the working optimum of the DNA polymerase used. This last step of a cycle is called elongation or amplification. The DNA polymerase fills in the missing strands with free nucleotides.

Aus der Druckschrift EP 0606961 B1 ist eine Vorrichtung zum schnellen Aufheizen und Abkühlen eines Reaktionsgefäßes auf verschiedene Temperaturen zur Durchführung einer Polymerase-Kettenreaktion bekannt. Die Vorrichtung umfasst zwei Flächen für den Kontakt mit dem Reaktionsgefäß, das dazwischen eingeschlossen ist. Eine Fläche dient als Heizung. Ein Hohlraum der Vorrichtung dient der Kühlung, indem Kühlluft in den Hohlraum eingeleitet wird. Darüber hinaus umfasst die Vorrichtung Sensoren, mit denen die jeweils gewünschte Temperatur gemessen und gesteuert wird. Nachteilhaft muss stets die gesamte Einrichtung gekühlt und anschließend wieder erwärmt werden, um die Temperaturwechsel zu bewirken. Es muss daher relativ viel Energie aufgewendet werden und die jeweils gewünschten Temperaturen der Reaktionsflüssigkeit werden relativ langsam erreicht.From the publication EP 0606961 B1 For example, there is known an apparatus for rapidly heating and cooling a reaction vessel to various temperatures for carrying out a polymerase chain reaction. The device comprises two surfaces for contact with the reaction vessel enclosed therebetween. An area serves as a heater. A cavity of the device is used for cooling, by cooling air in the cavity is introduced. In addition, the device comprises sensors with which the respective desired temperature is measured and controlled. Disadvantageously, the entire device must always be cooled and then reheated to effect the temperature changes. Therefore, a relatively large amount of energy has to be expended and the respectively desired temperatures of the reaction liquid are reached relatively slowly.

Die Druckschrift EP 0 402 995 B1 offenbart eine Vorrichtung zum Beaufschlagen eines Reaktionsgefäßes mit mindestens zwei Temperaturwechseln. Die Vorrichtung weist Heizelemente zum Erwärmen mindestens einer Seitenwand eines ausgewählten Kammerabschnitts des Reaktionsgefäßes sowie Bewegungsmittel auf, die das Reaktionsgefäß und die Heizelemente entlang einer vorgegebenen Bahn relativ zueinander bewegen. Die Vorrichtung umfasst weiter Kühlelemente, die Kühlflüssigkeit über die Heizelemente fördern, um diese in sich wiederholenden Zeitabständen direkt abzukühlen, und die gemeinsam mit den Heizelementen bewegbar sind.The publication EP 0 402 995 B1 discloses a device for charging a reaction vessel with at least two temperature changes. The apparatus includes heating elements for heating at least one sidewall of a selected chamber portion of the reaction vessel and moving means which move the reaction vessel and the heating elements along a predetermined path relative to each other. The apparatus further includes cooling elements that deliver cooling fluid over the heating elements to directly cool them at repeating intervals, and that are movable in unison with the heating elements.

Aus der Druckschrift US 2003/00361 89 A1 ist ein Thermocyler für die Durchführung einer PCR bekannt, der ein Reaktionsgefäß mit besonders großer, der Wärmeübertragung dienenden Oberfläche umfasst, um so vor allem schnell kühlen zu können.From the publication US 2003/00361 89 A1 is a Thermocyler for carrying out a PCR is known, which includes a reaction vessel with a particularly large, the heat transfer surface serving, so as to be able to cool mainly fast.

Die Durchführung einer PCR in einem mikrofluidischen System geht aus der US 6,171,850 B1 hervor.The implementation of a PCR in a microfluidic system is based on the US 6,171,850 B1 out.

Beim genannten Stand der Technik wird der gewünschte Temperaturwechsel allein durch Heizen oder Kühlen mit Hilfe von dafür vorgesehenen Heiz- oder Kühlelementen herbeigeführt. Erhitzt wird beim Stand der Technik beispielsweise mit Peltierelementen, Infrarotstrahlung oder einem heißen Fluid per Wärmeaustausch. Gekühlt wird beispielsweise mit einem kalten Fluid über Wärmeaustausch oder aber mit Hilfe von Peltierelementen. Für ein schnelles Ändern einer Temperatur wird relativ viel Energie benötigt, Ein Betrieb ohne externe Stromversorgung erfordert dann sehr leistungsfähige Batterien. Auch dauert es relativ lange, um den gewünschten Temperaturwechsel zu bewirken, wenn das Volumen der Reaktionsflüssigkeit mehr als einige wenige 1 00 µl beträgt,In the cited prior art, the desired temperature change is brought about solely by heating or cooling with the aid of heating or cooling elements provided for this purpose. Is heated in the prior art, for example, with Peltier elements, infrared radiation or a hot fluid by heat exchange. Cooling is done, for example, with a cold fluid via heat exchange or with the help of Peltier elements. For a Changing a temperature quickly requires a relatively large amount of energy. Operation without an external power supply then requires very powerful batteries. It also takes a relatively long time to effect the desired temperature change if the volume of the reaction liquid is more than a few 100 μl,

Es ist aus " Kopp MU, Mello AJ, Manz A., Chemical amplification: continousflow PCR on a chip, Sience, 1998 May 15; 280(5366):1046-8 " bekannt, eine Reaktionsflüssigkeit für die Durchführung einer PCR durch ein mikrofluidisches System mit unterschiedlich temperierten Kammern zu pumpen. Zunächst gelangt die Reaktionsflüssigkeit in eine erste Kammer, die so stark erwärmt wird, dass die Reaktionsflüssigkeit die für die Denaturierung erforderliche Temperatur erreicht, die nachfolgend auch Denaturierungstemperatur genannt wird. Anschließend wird die Reaktionsflüssigkeit in eine nächste Kammer gepumpt, die so gekühlt wird, dass in dieser Kammer die Reaktionsflüssigkeit auf Annealingstemperatur gebracht wird, d. h. auf die Temperatur, die für die Primerhybridisierung benötigt wird. Eine dritte nachfolgende Kammer ist so temperiert, dass die Reaktionsflüssigkeit von der Annealingstemperatur auf die Temperatur erwärmt wird, die für die Amplifikation bzw, Elongation erforderlich ist, nachfolgend auch Elongationstemperatur genannt, Bei diesem Verfahren gelingt es, auf energetisch günstige Weise schnell die erforderlichen Temperaturen zu erreichen. Allerdings können nur kleine Flüssigkeitsvolumina eingesetzt werden. Es muss sehr exakt gepumpt werden, um so sicherzustellen, dass sich die Reaktionsflüssigkeit im jeweils gewünschten Bereich befindet. Ferner werden drei Kammern nebst Verbindungsleitungen benötigt, um die PCR durchführen zu können.It's out " Kopp MU, Mello AJ, Manz A., Chemical amplification: continuous flow PCR on a chip, Science, 1998 May 15; 280 (5366): 1046-8 "It is known to pump a reaction liquid for carrying out a PCR through a microfluidic system with chambers of different temperatures." First, the reaction liquid passes into a first chamber, which is heated to such an extent that the reaction liquid reaches the temperature required for denaturation, which is also hereafter The reaction liquid is then pumped into a next chamber, which is cooled in such a way that the reaction liquid in this chamber is brought to the annealing temperature, ie the temperature required for the primer hybridization. that the reaction liquid is heated from the annealing to the temperature required for the amplification or elongation, hereinafter also called elongation temperature, In this method, it is possible to quickly energetically favorable erfo to reach dangerous temperatures. However, only small volumes of liquid can be used. It must be pumped very precisely to ensure that the reaction liquid is in the desired range. Furthermore, three chambers and connecting lines are needed to perform the PCR can.

Aus der Druckschrift WO 03/007677 A2 ist bekannt, gemäß dem eine PCR-Kammer zwischen unterschiedlich beheizten Zonen zu verfahren, um so eine gewünschte Temperatur in einer Kammer einstellen zu können. Das hieraus bekannte Verfahren kann mit einem vergleichsweise niedrigen Energiebedarf durchgeführt werden, da neben der Reaktionsflüssigkeit nur noch die Wände der Kammer aufgeheizt und gekühlt werden müssen. Allerdings dient das Aufheizen und Kühlen der Wände nicht dem Erreichen des gewünschten Ergebnisses und ist lediglich aus technischen Gründen erforderlich, um das Verfahren durchführen zu können, Hinzu kommt, dass der Platzbedarf relativ groß ist.From the publication WO 03/007677 A2 It is known to move according to a PCR chamber between different heated zones, so as to be able to set a desired temperature in a chamber. The method known from this can be carried out with a comparatively low energy requirement, since apart from the reaction liquid only the walls of the chamber have to be heated and cooled. However that serves Heating and cooling the walls not to achieve the desired result and is only necessary for technical reasons to perform the process can, in addition, that the space requirement is relatively large.

Es ist Aufgabe der Erfindung, eine PCR energetisch günstig, schnell und einfach durchführen zu können.It is an object of the invention to be able to carry out a PCR energetically favorable, fast and easy.

Zur Lösung der Aufgabe wird eine erforderliche Temperatur einer Reaktionsflüssigkeit durch Mischen mit einer zweiten Flüssigkeit eingestellt, deren Temperatur sich geeignet von der Temperatur der Reaktionsflüssigkeit unterscheidet, Die zweite Flüssigkeit kann ebenfalls eine Reaktionsflüssigkeit sein. Da eine gewünschte Temperatur einer Reaktionsflüssigkeit durch Mischen von zwei zuvor unterschiedlich temperierten Flüssigkeiten erhalten wird, ist es nicht erforderlich, zusätzlich eine Reaktionskammer zu heizen oder zu kühlen, was energetisch aufwändig und zu großen zeitlichen Verzögerungen führen würde. Für die Durchführung des Verfahrens werden nur eine geeignet temperierbare Kammer sowie Mittel für das Mischen benötigt. Der Aufbau kann entsprechend einfach und kostengünstig sein.To achieve the object, a required temperature of a reaction liquid is adjusted by mixing with a second liquid whose temperature is suitably different from the temperature of the reaction liquid. The second liquid may also be a reaction liquid. Since a desired temperature of a reaction liquid is obtained by mixing two previously differently tempered liquids, it is not necessary to additionally heat or cool a reaction chamber, which would be energy-consuming and lead to large time delays. For the implementation of the method, only a suitable temperature-controlled chamber and means for mixing are needed. The structure can be correspondingly simple and inexpensive.

Zur Lösung dieser Aufgabe wird in einer Ausführungsform der Erfindung im Rahmen der Durchführung einer PCR Reaktionsflüssigkeit, die zuvor auf Denaturierungstemperatur gebracht worden ist und deren Temperatur daher oberhalb der Temperatur liegt, die für die Amplifikation bzw. Elongation erforderlich ist, mit Reaktionsflüssigkeit gemischt, die zuvor auf Annealingstemperatur gebracht worden ist und deren Temperatur daher unterhalb der Temperatur liegt, die für die Amplifikation erforderlich ist. Es wird so erreicht, dass der Teil der Reaktionsflüssigkeit, der von der Annealingstemperatur auf die Elongationstemperatur zu bringen ist, durch das Mischen sehr schnell in gewünschter Weise erwärmt wird. Da für das Erwärmen Reaktionsflüssigkeit eingesetzt wird, die ohnehin gekühlt werden muss, wird das gewünschte Ergebnis auf energetisch günstige Weise erreicht. Es können größere Mengen an Flüssigkeit in gewünschter Weise schnell und einfach in gewünschter Weise temperiert werden,To achieve this object, in one embodiment of the invention in the context of carrying out a PCR reaction liquid, which has been previously brought to Denaturierungstemperatur and whose temperature is therefore above the temperature required for the amplification or elongation, mixed with reaction liquid previously has been brought to Annealingstemperatur and therefore the temperature is below the temperature required for the amplification. It is thus achieved that the part of the reaction liquid which is to be brought from the annealing temperature to the elongation temperature is heated very rapidly in the desired manner by the mixing. Since reaction liquid is used for heating, which must be cooled anyway, the desired result in an energetically favorable manner reached. Larger amounts of liquid can be tempered in the desired manner quickly and easily in the desired manner,

Die Temperatur einer Reaktionskammer nebst weiteren daran beteiligten Einrichtungen muss nicht während der Temperaturänderungen der Flüssigkeiten ebenfalls entsprechend aktiv geändert werden. Hierdurch wird vor allem Energie eingespart, was beispielsweise für Batterie betriebene Vorrichtungen wichtig ist. Eine Vorrichtung zur Durchführung des Verfahrens eignet sich daher insbesondere für den mobilen Einsatz, welche durch eine interne Energieversorgung wie Batterie, Brennstoffzelle und/ oder durch Solorzellen mit Energie versorgt wird.The temperature of a reaction chamber, together with other devices involved, does not have to be correspondingly actively changed during the temperature changes of the liquids. As a result, energy is saved above all, which is important, for example, for battery-powered devices. A device for carrying out the method is therefore particularly suitable for mobile use, which is powered by an internal power supply such as battery, fuel cell and / or by solar cells with energy.

In einer Ausführungsform der Erfindung wird das Verhältnis zwischen den beiden Flüssigkeitsvolumina der zu mischenden Reaktionsflüssigkeiten bzw. Flüssigkeiten so gewählt, dass durch das Mischen der wärmeren (Reaktions-) flüssigkeit mit der kühleren (Reaktions-)flüssigkeit die Elongationstemperatur weder unterschritten noch überschritten werden kann. Es muss also nicht zusätzlich temperiert werden, um die gewünschte Elongationstemperatur zu erreichen.In one embodiment of the invention, the ratio between the two liquid volumes of the reaction liquids or liquids to be mixed is selected such that the temperature can not be exceeded or exceeded by mixing the warmer (reaction) liquid with the cooler (reaction) liquid. It therefore does not have to be tempered additionally in order to achieve the desired elongation temperature.

In einer weiteren Ausführungsform der Erfindung wird die PCR in einer Kammer durchgeführt, die einen ersten und einen davon räumlich anderen zweiten Bereich umfasst. Der erste Bereich dieser Kammer wird so beheizt, dass eine in diesem Bereich befindliche Reaktionsflüssigkeit auf Denaturierungstemperatur erwärmt werden kann. Der zweite Bereich wird so gekühlt, dass eine in diesem zweiten Bereich befindliche Reaktionsflüssigkeit auf Annealingstemperatur abgekühlt werden kann. Der erste Bereich ist vom zweiten Bereich räumlich getrennt. Bei dieser Ausführungsform der Erfindung wird der Teil der Reaktionsflüssigkeit, der sich im ersten Bereich befindet, auf Denaturierungstemperatur erwärmt und gehalten, bis in diesem Teil der Reaktionsflüssigkeit die vorhandenen Doppelstränge einer DNA im gewünschten Umfang getrennt worden sind. Im zweiten Bereich der Kammer wird die dort befindliche Reaktionsflüssigkeit auf Annealingstemperatur abgekühlt und gehalten, bis im gewünschten Umfang die Primerhybridisierung erfolgt ist, Anschließend werden die beiden Teile der Reaktionsflüssigkeit mit Hilfe eines Rührelements gemischt, um so die Elongationstemperatur zu erreichen.In a further embodiment of the invention, the PCR is carried out in a chamber which comprises a first and one spatially different second region. The first area of this chamber is heated so that a reaction liquid in this area can be heated to Denaturierungstemperatur. The second region is cooled in such a way that a reaction liquid located in this second region can be cooled to the annealing temperature. The first area is spatially separated from the second area. In this embodiment of the invention, the part of the reaction liquid which is in the first region is heated to denaturation temperature and held until the present double strands of DNA have been separated to the desired extent in this part of the reaction liquid. In the second region of the chamber, the reaction liquid located there is at the annealing temperature cooled and held until the desired extent the primer hybridization is carried out, then the two parts of the reaction liquid are mixed by means of a stirring element, so as to reach the elongation temperature.

Zwar wird durch dieses Verfahren die Effizienz eines Zyklus im Vergleich zum Stand der Technik reduziert, bei dem stets das gesamte Reaktionsvolumen nacheinander die drei Schritte eines Zyklus durchlaufen. Wie Versuche gezeigt haben, kann dies dadurch kompensiert werden, indem mehr Zyklen durchlaufen werden. Der Geschwindigkeitsvorteil des erfindungsgemäßen Verfahrens ist so groß, dass das gewünschte Endergebnis trotz einer größeren Anzahl an Zyklen dennoch in kürzerer Zeit im Vergleich zu klassischen PCR-Verfahren erhalten wird. Versuche haben insbesondere auch ergeben, dass es sich nicht nachteilhaft auswirkt, wenn ein Teil der Reaktionsflüssigkeit im Anschluss an die Denaturierung nicht wie beim Stand der Technik sofort auf die Annealingstemperatur abgekühlt wird, sondern zunächst auf Elongationstemperatur gebracht und gehalten wird.Although this method reduces the efficiency of a cycle as compared to the prior art, always the entire reaction volume will successively go through the three steps of a cycle. As tests have shown, this can be compensated for by going through more cycles. The speed advantage of the method according to the invention is so great that, despite a larger number of cycles, the desired final result is nevertheless obtained in a shorter time compared to classical PCR methods. In particular, tests have also shown that it does not have a disadvantageous effect if a portion of the reaction liquid is not immediately cooled to the annealing temperature after denaturing as in the prior art, but is first brought to and maintained at the elongation temperature.

In einer Ausführungsform der Erfindung ist die Kammer, in der die PCR anspruchsgemäß durchgeführt wird, flach ausgestaltet. Eine Kammer ist flach ausgestaltet, wenn die Breite und/ oder Tiefe der Kammer die Höhe der Kammer um ein Mehrfaches übersteigt. Es stehen so einerseits große Wärmeübertragungsflächen bereit, um den ersten Bereich zu erwärmen und den zweiten Bereich zu kühlen. Andererseits gelingt es so, die in beiden Bereichen befindlichen Flüssigkeiten hinreichend während des Erwärmens bzw. Kühlens voneinander getrennt zu halten.In one embodiment of the invention, the chamber in which the PCR is carried out according to the claim is flat. A chamber is made flat if the width and / or depth of the chamber exceeds the height of the chamber by a multiple. On the one hand, large heat transfer surfaces are available to heat the first area and to cool the second area. On the other hand, it is possible to keep the liquids in both areas sufficiently separated during heating or cooling.

Um die gewünschte räumliche Trennung von Teilen der Reaktionsflüssigkeiten während des Erwärmens bzw. Kühlens verbessert aufrecht zu erhalten, wird in einer Ausführungsform der Erfindung ein Rührelement so positioniert, dass das Rührelement zur räumlichen Trennung beiträgt. Befindet sich beispielsweise der erste Bereich in einer linken Kommerhälfte und der zweite Bereich in einer rechten Kammerhälfte, so wird das Rührelement so platziert und ausgerichtet, dass es die linke Kommerhälfte von der rechten trennt, wenn Reaktionsflüssigkeit gekühlt bzw, erwärmt werden soll, Das Rührelement erstreckt sich dann entlang der Grenze zwischen erstem und zweitem Kammerbereich und trennt so räumlich die beiden Teile der Reaktionsfiüssigkeit.In order to maintain the desired spatial separation of parts of the reaction liquids during the heating or cooling, an agitating element is positioned in one embodiment of the invention so that the stirring element contributes to the spatial separation. For example, if the first area is in a left half of the compartment and the second area is in a right half of the chamber, then the agitating element is placed and aligned so that it separates the left half of the compartment from the right, When the reaction liquid is to be cooled or heated, the stirring element then extends along the boundary between the first and second chamber regions and thus spatially separates the two parts of the reaction liquid.

Das Rührelement kann zum Beispiel Teil eines Magnetrührers oder aber mit einer in die Kammer hineinreichende Welle verbunden sein. Handelt es sich um einen Magnetrührer, so gelingt die gewünschte Ausrichtung beispielsweise mittels eines geeignet ausgerichteten Magnetfeldes.The stirring element may for example be part of a magnetic stirrer or connected to a shaft extending into the chamber. If it is a magnetic stirrer, then the desired alignment is achieved, for example, by means of a suitably oriented magnetic field.

In einer Ausführungsform der Erfindung können die beiden Bereiche der Kammer durch ein Trennmittel voneinander getrennt werden, um so einen Teil der Reaktionsflüssigkeit in der ersten Kammer heizen zu können, ohne dass sich dieser Teil der Flüssigkeit mit dem zweiten Teil der Reaktionsflüssigkeit vermischen kann, der währenddessen gekühlt wird. Ein solches Trennmittel kann Pressmittel umfassen, die den Grenzbereich zwischen erstem und zweitem Bereich zusammenpressen und so die beiden Bereiche gegeneinander abdichten.In one embodiment of the invention, the two regions of the chamber can be separated from one another by a separating means, so as to be able to heat part of the reaction liquid in the first chamber, without this part of the liquid being able to mix with the second part of the reaction liquid, during which is cooled. Such a release agent may comprise pressing means, which compress the boundary area between the first and second area and thus seal the two areas against each other.

In einer Ausführungsform der Erfindung besteht die Hülle der Kammer aus verformbaren Material. Das Mischen wird bewirkt, in dem Teile der Kammer zusammengedrückt und anschließend wieder entspannt werden.In one embodiment of the invention, the shell of the chamber is made of deformable material. The mixing is effected by compressing parts of the chamber and then releasing them again.

Die zu kühlenden bzw. zu heizenden Wände der Kammer bestehen vorzugsweise aus einem Material, welches Wärme gut zu leitenden vermag im Vergleich zu einem bandförmig verlaufenden Wandbereich, der zwischen dem zu heizenden und dem zu kühlenden Bereich liegt. Diese Ausführungsform einer Kammer trägt weiter dazu bei, dass das Verfahren energetisch günstig durchgeführt werden kann.The walls of the chamber to be cooled or heated are preferably made of a material which is able to conduct heat well in comparison to a band-shaped wall region which lies between the area to be heated and the area to be cooled. This embodiment of a chamber further contributes to the fact that the method can be performed energetically favorable.

Die Energieversorgung erfolgt insbesondere mittels einer Batterie, einer Solarzelle und/ oder einer Brennstoffzelle, also allgemein durch eine interne Energieversorgung, damit das Verfahren mobil unabhängig von einer externen Energieversorgung durchgeführt werden kann. Gerade bei einer internen Energieversorgung kommt es darauf, möglichst wenig Energie zu verbrauchen.The energy is supplied in particular by means of a battery, a solar cell and / or a fuel cell, that is generally by an internal power supply, so that the process can be carried out mobile independently of an external power supply. Especially with one internal energy supply, it is important to use as little energy as possible.

Um eine PCR durchführen zu können, umfasst die in der Kammer befindliche Reaktionsflüssigkeit hitzestabile Polymerase, Nukleoditde, Primer, Salz und pH-Puffer sowie Templat-Nukleinsäure RNA oder DNA.In order to be able to carry out a PCR, the reaction liquid contained in the chamber comprises heat-stable polymerase, nucleobases, primers, salt and pH buffer as well as template nucleic acid RNA or DNA.

Es ist grundsätzlich auch möglich, dass eine weitere Flüssigkeit, die keine Reaktionsflüssigkeit ist, eingesetzt wird, um durch Mischen die gewünschten Temperaturen schnell zu erreichen. Grundsätzlich ist es möglich, die vorgenannten vorteilhaften Ausführungsformen auf diesen Fall entsprechend zu übertragen, Im Unterschied zu dem Fall, dass ausschließlich Reaktionsflüssigkeit eingesetzt wird, ist es dann aber nicht erforderlich, die weitere Flüssigkeit exakt auf Denaturierungstemperatur zu erwärmen oder aber exakt auf Annealingstemperatur zu kühlen. Statt dessen kann die kühlere oder wärmere Temperatur so gewählt werden, dass das Verfahren optimiert durchgeführt werden kann. In Betracht kommen vor allem Flüssigkeiten wie Öl oder flüssiges Metall, Geeignete Öle sind im Bereich der Mineralöle (Typenbezeichung "PCR-grade") und Siliconöle (Typenbezeichung DC200) zu finden. An Flüssigmetallen sind die Produkte der Firma Coollaboratory (Ebendorf; Deutschland) geeignet. So kann beispielsweise eine RealTime PCR unter Anwesenheit von ca. 10 mg "Coollaboratory Liquid MetalPad for PS3

Figure imgb0001
" oder 50 mg "Coollaboratory Liquid Pro" erfolgreich durchgeführt werden.It is also possible in principle for another liquid, which is not a reaction liquid, to be used in order to rapidly reach the desired temperatures by mixing. In principle, it is possible to correspondingly transfer the aforementioned advantageous embodiments to this case. In contrast to the case where exclusively reaction liquid is used, it is then not necessary to heat the further liquid exactly to the denaturing temperature or to cool it precisely to the annealing temperature , Instead, the cooler or warmer temperature may be chosen so that the process can be optimized. In particular, liquids such as oil or liquid metal are suitable. Suitable oils are to be found in the mineral oils (type designation "PCR-grade") and silicone oils (type designation DC200). The products of Coollaboratory (Ebendorf, Germany) are suitable for liquid metals. Thus, for example, a RealTime PCR in the presence of about 10 mg "Coollaboratory Liquid MetalPad for PS3
Figure imgb0001
"or 50 mg" Coollaboratory Liquid Pro "successfully performed.

Die Öle bzw. Metalle bilden in der PCR Reaktion eine zweite Phase, die einerseits leicht von der Reaktionsflüssigkeit getrennt werden können und andererseits die PCR nicht gefährden. Bei dieser Ausführungsform schwimmt beispielsweise ein Öl zunächst auf der Reaktionsflüssigkeit und wird zusammen mit einem dafür geeigneten Bereich der Reaktionskammer auf eine geeignete Temperatur erhitzt. Zeitgleich wird die Reaktionsflüssigkeit in einem unteren Kammerbereich gekühlt und auf Annealingstemperatur gebracht. Um zu gegebener Zeit die Elongationstemperatur zu erreichen, wird das Öl mit der Reaktionsflüssigkeit gemischt. Soll im Anschluss daran die Reaktionsflüssigkeit auf Denaturierungstemperatur gebracht werden, so wird beispielsweise die Kammer so um 180° gedreht, dass der beheizte Bereich der Kammer sich dann unten befindet und der gekühlte Bereich oben. Wird das Mischen gestoppt, so gelangt das Öl aufgrund der Schwerkraft in den gekühlten Kammerbereich der Reaktionskammer. Die Reaktionsflüssigkeit gelangt dann in den Bereich der Kammer, der erhitzt wird. Die Reaktionsflüssigkeit wird so auf die Denaturierungstemperatur gebracht und das Öl auf eine geeignet tiefe Temperatur, um so die Reaktionsflüssigkeit zu gegebener Zeit durch Mischen wieder rasch und auf energetisch günstige Weise abkühlen zu können.The oils or metals form a second phase in the PCR reaction, which on the one hand can be easily separated from the reaction liquid and on the other hand do not endanger the PCR. In this embodiment, for example, an oil first floats on the reaction liquid and is heated to a suitable temperature together with a suitable portion of the reaction chamber. At the same time, the reaction liquid is cooled in a lower chamber area and brought to annealing temperature. In order to reach the elongation temperature in due course, the oil is mixed with the reaction liquid. Should subsequently the For example, the chamber is rotated 180 ° such that the heated area of the chamber is at the bottom and the cooled area at the top. If the mixing is stopped, the oil passes by gravity into the cooled chamber area of the reaction chamber. The reaction liquid then passes into the region of the chamber which is heated. The reaction liquid is brought to the denaturation and the oil to a suitable low temperature, so as to cool the reaction liquid in due time by mixing again quickly and in an energetically favorable manner.

Wird flüssiges Metall anstelle eines Öls eingesetzt, so schwimmt die Reaktionsflüssigkeit auf dem flüssigen Metall, wenn nicht gemischt wird. Im Prinzip kann daher das gleiche Verfahren durchgeführt werden, wie zuvor am Beispiel des Öls beschrieben worden ist.When liquid metal is used instead of an oil, the reaction liquid floats on the liquid metal when not mixed. In principle, therefore, the same method can be carried out, as has been described above using the example of the oil.

Wird eine Flüssigkeit eingesetzt, die keine Reaktionsflüssigkeit ist, so kommt es bei den zuvor beschriebenen Verfahren also darauf an, dass sich diese Flüssigkeit von der Reaktionsflüssigkeit trennen lässt, was insbesondere dann leicht möglich ist, wenn die Trennung aufgrund der Schwerkraft zwangsläufig einsetzt, sobald nicht aktiv zum Beispiel durch Rühren mit einem Rührelement gemischt wird.If a liquid is used which is not a reaction liquid, then it is important in the above-described processes that this liquid can be separated from the reaction liquid, which is easily possible, in particular, if the separation inevitably begins, if not due to gravity is actively mixed, for example by stirring with a stirring element.

Es ist auch möglich, dass insgesamt drei verschiedene Flüssigkeiten eingesetzt werden, so zum Beispiel ein Flüssigmetall, eine Reaktionsflüssigkeit sowie ein Öl. Es ist zweckmäßig, das Öl in einem oberen Bereich der Kammer zu erwärmen und das Flüssigmetall in einem unteren Bereich dann zu kühlen. Grundsätzlich ist es aber auch nicht ausgeschlossen, dass der obere Bereich gekühlt und der untere erwärmt wird. Die dazwischen befindliche Reaktionsflüssigkeit wird mit der erwärmten Flüssigkeit gemischt, wenn die Temperatur der Reaktionsflüssigkeit geeignet erhöht werden soll. Die dazwischen befindliche Reaktionsflüssigkeit wird mit der gekühlten Flüssigkeit gemischt, wenn die Temperatur der Reaktionsflüssigkeit geeignet herabgesetzt werden soll.It is also possible that a total of three different liquids are used, such as a liquid metal, a reaction liquid and an oil. It is convenient to heat the oil in an upper portion of the chamber and then to cool the liquid metal in a lower portion. In principle, however, it is not excluded that the upper area is cooled and the lower one is heated. The reaction liquid therebetween is mixed with the heated liquid when the temperature of the reaction liquid is to be appropriately increased. The reaction liquid therebetween is mixed with the cooled liquid when the temperature of the reaction liquid is appropriately lowered.

Nachfolgend wird die Erfindung anhand eines Ausführungsbeispiels näher erläutert.The invention will be explained in more detail with reference to an embodiment.

Figur 1 zeigt eine Aufsicht auf eine flach ausgestaltete Kammer 1 , in der eine PCR durchgeführt wird. Die Kammer 1 weist eine kreisrunde Grundfläche auf, deren Durchmesser um ein Mehrfaches größer ist als die Höhe der Kammer. Eine links gezeigte Hälfte 1a der Kammer ist mit nicht dargestellten Heizmitteln versehen, um diesen linken Kammerbereich 1a beheizen zu können. Eine rechts gezeigte Kommerhälfte 1b ist mit Kühlmitteln versehen, die die rechte Kammerhälfte 1 b zu kühlen vermögen, In der Kammer 1 befindet sich ein Rührstab 2 eines Magnetrührers, In der Grundstellung trennt dieser die linke Kammerhälfte 1a von der rechten Kammerhälfte 1b. Als Heiz- und Kühlmittel eignen sich die bekannten, beispielsweise eingangs genannten Mittel für diese und für andere Ausführungsformen der Erfindung. FIG. 1 shows a plan view of a flat-shaped chamber 1, in which a PCR is performed. The chamber 1 has a circular base whose diameter is several times greater than the height of the chamber. A left half 1a of the chamber is provided with heating means, not shown, in order to heat this left chamber portion 1a can. A Kommerhälfte shown on the right 1b is provided with coolants, which are able to cool the right half of the chamber 1 b, In the chamber 1 is a stirring rod 2 of a magnetic stirrer, In the basic position this separates the left half of the chamber 1 a from the right half of the chamber 1 b. Suitable heating and cooling means are the known, for example initially mentioned means for these and for other embodiments of the invention.

Figur 2a zeigt einen seitlichen Schnitt eines weiteren Ausführungsbeispiels einer erfindungsgemäßen Kammer, In Figur 2b wird eine zugehörige Aufsicht gezeigt. Die links gezeigte Kommerhälfte kann mit einem ersten Peltierelement 3 beheizt werden. Die rechts gezeigte Kommerhälfte kann mit einem zweiten Peltierelement 4 gekühlt werden. FIG. 2a shows a side section of a further embodiment of a chamber according to the invention, In FIG. 2b an associated supervision is shown. The commercial half shown on the left can be heated with a first Peltier element 3. The commercial half shown on the right can be cooled with a second Peltier element 4.

Die Höhe der Kammer mit quadratischer Grundfläche beträgt 1 mm. Breite und Länge bzw. Tiefe der Kammer betragen 10 mm. Das Kammervolumen liegt bei ca. 100 µl. In der Kammer 1 befindet sich wiederum ein Rührstab 2 eines Magnetrührers.The height of the chamber with a square base is 1 mm. Width and length or depth of the chamber are 10 mm. The chamber volume is about 100 μl. In the chamber 1 is again a stirring rod 2 of a magnetic stirrer.

Im Rahmen eines Ausführungsbeispiels wurde eine quantitative Real Time PCR mit genomischer DNA das Bakteriums Escherichia coli untersucht.In the context of one embodiment, a quantitative real-time PCR with genomic DNA of the bacterium Escherichia coli was investigated.

Folgende PCR-Primer wurden eingesetzt:

  • EFwd: CGATGATGCTACCCCTGAAAAACT
  • ERev: TATTGTCGCTTGAACTGATTTCCTC
  • EPro: "6-Fam"-CGTTGTTAAGTCAATGGAAAACCTG- BHQ1
The following PCR primers were used:
  • EFwd: CGATGATGCTACCCCTGAAAAACT
  • ERev: TATTGTCGCTTGAACTGATTTCCTC
  • EPro: "6-Fam" -CGTTGTTAAGTCAATGGAAAACCTG- BHQ1

Die qPCR wurde jeweils mit einer Standard-Verdünnungsreihe genomischer DNA von E. coli angesetzt. Pro 25µl PCR Endvolumen wurden 20 ng / 2 ng / 0,2ng / 0,02 ng von genomischer Escherichia coli DNA, also unterschiedliche Mengenfür Eichmessungen eingesetzt. Dazu wurden in ein PCR Tube 1 2,5 µl QIAGEN QuantiTect Probe PCR Mastermix, 0,1 µl EFwd (5 pmol/µl); 0,1 µl ERev (5 pmol/µl); 0,05 µl EPro(5 pmol/µl), 10,25 µl bidestilliertes Wasser und 2 µl E.coli Standard-Verdünnungslösung gestartet. Die Zyklus-Bedingungen sind in der nachfolgenden Tabelle dargestellt. 3-Step-Cycling 4-Step-Cycling Taq Activierung 3 min 95°C 3 min 95°C 40 cycles 4 sec 95°C 4 sec 95°C 4 sec 56°C 4 sec 72°C 8 sec 72°C 4 sec 4 sec 56°C 72°C Final Elongation 1 min 72°C 1 min 72°C Hold infinite ∞ 4°C ∞ 4°C The qPCR was each set up with a standard dilution series of genomic DNA from E. coli. For every 25 μl final PCR volume 20 ng / 2 ng / 0.2 ng / 0.02 ng of genomic Escherichia coli DNA, ie different amounts were used for calibration measurements. To this end, in a PCR tube 1, 2.5 μl QIAGEN QuantiTect Probe PCR Master Mix, 0.1 μl EFwd (5 pmol / μl); 0.1 μl ERev (5 pmol / μl); 0.05 μL EPro (5 pmol / μL), 10.25 μL bidistilled water and 2 μL E.coli standard dilution solution started. The cycle conditions are shown in the table below. 3-Step Cycling 4-Step-Cycling Taq activation 3 min 95 ° C 3 min 95 ° C 40 cycles 4 sec 95 ° C 4 sec 95 ° C 4 sec 56 ° C 4 sec 72 ° C 8 sec 72 ° C 4 sec. 4 sec 56 ° C 72 ° C Final elongation 1 min 72 ° C 1 min 72 ° C Hold infinite ∞ 4 ° C ∞ 4 ° C

Die Auswertung der qPCR zeigt, dass auch unter den ungewöhnlichen 4-Schritt Cycling Bedingungen erfolgreich eine PCR durchzuführen ist. Die Standards im Amplification Plot (Fig. 3) bzw. in der Auswertungsgrafik (Fig. 4) unterscheiden sich nicht signifikant von einander.The evaluation of the qPCR shows that even under the unusual 4-step cycling conditions a PCR is successful. The standards in the Amplification Plot ( Fig. 3 ) or in the evaluation graphic ( Fig. 4 ) do not differ significantly from each other.

Da während der PCR ein Bereich der Kammer konstant erhitzt wird und ein anderer Bereich der Kammer konstant gekühlt wird, wird relativ wenig Energie benötigt, um die PCR durchzuführen. Der Aufbau der Kammer nebst zugehörigen Einrichtungen ist einfach und daher preiswert. Der einfache Aufbau ermöglicht eine kleine Bauform der Gesamtvorrichtung, mit der das Verfahren durchgeführt wird.Since one area of the chamber is constantly heated during the PCR and another area of the chamber is constantly cooled, relatively little energy is needed to perform the PCR. The structure of the chamber together with associated facilities is simple and therefore inexpensive. The simple structure allows a small design of the overall device with which the process is performed.

Eine Simulation hat ergeben, dass das Verfahren selbst dann vergleichsweise schnell durchgeführt werden kann, wenn als Flüssigkeit ausschließlich Reaktionsflüssigkeit eingesetzt wird, Es ergeben sich also auch Geschwindigkeitsvorteile, was wiederum den Energieverbrauch auch aus diesem Grund zu senken vermag.A simulation has shown that the method can be carried out comparatively quickly even if only liquid is used as the liquid. Thus, there are also speed advantages, which in turn can reduce the energy consumption for this reason.

Claims (15)

Verfahren zur Durchführung einer Polymerase-Kettenreaktion, bei dem eine Reaktionsflüssigkeit zyklisch auf Denaturierungstemperatur, Annealingstemperatur und Elongationstemperatur gebracht wird, dadurch gekennzeichnet, dass eine Temperatur der Reaktionsflüssigkeit durch Mischen mit einer wärmeren oder kühleren Flüssigkeit geändert wird.A process for carrying out a polymerase chain reaction in which a reaction liquid is cyclically brought to denaturation temperature, annealing temperature and elongation temperature, characterized in that a temperature of the reaction liquid is changed by mixing with a warmer or cooler liquid. Verfahren zur Durchführung einer Polymerase-Kettenreaktion nach Anspruch 1 , dadurch gekennzeichnet, dass ein Teil der Reaktionsflüssigkeit auf Denaturierungstemperatur gebracht wird, ein anderer Teil der Reaktionsflüssigkeit auf Annealingstemperatur gebracht wird und die beiden Teile der Reaktionsflüssigkeiten zwecks Temperaturveränderung gemischt werden.A method for carrying out a polymerase chain reaction according to claim 1, characterized in that a portion of the reaction liquid is brought to Denaturierungstemperatur, another part of the reaction liquid is brought to Annealingstemperatur and the two parts of the reaction liquids are mixed for the purpose of temperature change. Verfahren nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass das Verhältnis zwischen den beiden Flüssigkeitsvolumina des ersten und zweiten Teils der zu mischenden Flüssigkeiten so eingestellt wird, dass durch das Mischen der wärmeren Flüssigkeit mit der kühleren Flüssigkeit die Elongationstemperatur erhalten wird.A method according to claim 1 or 2, characterized in that the ratio between the two liquid volumes of the first and second parts of the liquids to be mixed is adjusted so that the elongation temperature is obtained by mixing the warmer liquid with the cooler liquid. Verfahren nach Anspruch 2 oder 3, dadurch gekennzeichnet, dass der erste Teil der Reaktionsflüssigkeit in einem ersten Bereich einer Kammer auf Denaturierungstemperatur erwärmt wird, der zweite Teil der Reaktionsflüssigkeit in einem zweiten Bereich der Kammer auf Annealingstemperatur gekühlt wird und anschließend mit Hilfe eines in der Kammer befindlichen Rührelements die unterschiedlich temperierten Teile der Reaktionsflüssigkeiten gemischt werden.A method according to claim 2 or 3, characterized in that the first part of the reaction liquid is heated to denaturation temperature in a first region of a chamber, the second part of the reaction liquid in a second region of the chamber is cooled to annealing temperature and then with the aid of one in the chamber located stirring element, the different temperature parts of the reaction liquids are mixed. Verfahren nach einem der drei vorhergehenden Ansprüche, bei dem im Anschluss an das Mischen wieder ein Teil der Reaktionsflüssigkeit auf Denaturierungstemperatur und ein anderer Teil der Reaktionsflüssigkeit wieder auf Annealingstemperatur gebracht wird und zwar insbesondere in einem ersten und einem zweiten Bereich einer Kammer.Method according to one of the three preceding claims, in which after mixing again a part of the reaction liquid is brought to Denaturierungstemperatur and another part of the reaction liquid is brought back to annealing temperature in particular in a first and a second area of a chamber. Verfahren nach einem der vorhergehenden Ansprüche, bei dem die Reaktionsflüssigkeit in einer flach ausgestalteten Kammer zyklisch auf Denaturierungstemperatur, Annealingstemperatur und Elongationstemperatur gebracht wird.Method according to one of the preceding claims, wherein the reaction liquid is cyclically brought in a flat-shaped chamber to denaturation temperature, annealing temperature and elongation temperature. Verfahren nach einem der fünf vorhergehenden Ansprüche, bei dem ein Rührelement die zwei Teile der Reaktionsflüssigkeit voneinander trennt, wenn diese auf Denaturierungstemperatur bzw. Annealingstemperatur gebracht werden.Method according to one of the five preceding claims, wherein a stirring element separates the two parts of the reaction liquid from each other when they are brought to denaturation or annealing temperature. Verfahren nach einem der vorhergehenden Ansprüche, bei dem die Höhe der Kammer maximal 2 mm, vorzugsweise maximal 1 mm beträgt.Method according to one of the preceding claims, in which the height of the chamber is a maximum of 2 mm, preferably a maximum of 1 mm. Verfahren nach einem der vorhergehenden Ansprüche, bei dem die Breite, Tiefe oder Durchmesser der Kammer wenigstens 5 mm, vorzugsweise wenigstens 10 mm beträgt.Method according to one of the preceding claims, in which the width, depth or diameter of the chamber is at least 5 mm, preferably at least 10 mm. Kammer zur Durchführung eines Verfahrens nach einem der vorhergehenden Ansprüche, die einen ersten und zweiten Bereich umfasst, wobei der erste Bereich der Kammer mit einem Heizmittel versehen ist und der zweite Bereich mit einem Kühlmittel.A chamber for carrying out a method according to any one of the preceding claims, comprising a first and second region, wherein the first region of the chamber is provided with a heating means and the second region with a coolant. Kammer nach dem vorhergehenden Anspruch mit Mitteln für das Mischen einer in der Kammer befindlichen Flüssigkeit.A chamber according to the preceding claim including means for mixing a liquid in the chamber. Kammer nach einem der beiden vorhergehenden Ansprüche mit einer in der Kammer befindlichen Reaktionsflüssigkeit, die Polymerase, Nukleoditde, Primer, Salz und pH Puffer sowie Templat-Nukleinsäure RNA oder DNA umfasst,Chamber according to one of the two preceding claims with a reaction liquid in the chamber, the polymerase, nucleobases, primers, salt and pH buffer and template nucleic acid comprises RNA or DNA, Kammer nach einem der drei vorhergehenden Ansprüche mit einem bandförmigen Wandbereich, der aus einem Material besteht, dessen Wärmeleitfähigkeit gering ist im Vergleich zu dem Material von angrenzenden Wandbereichen der Kammer, wobei sich der bandförmige Wandbereich zwischen dem ersten und zweiten Bereich der Kammer befindet.A chamber according to any one of the preceding three claims, comprising a band-shaped wall portion made of a material whose thermal conductivity is low compared to that of adjacent wall portions of the chamber, the band-shaped wall portion being between the first and second portions of the chamber. Kammer nach einem der vier vorhergehenden Ansprüche mit Mitteln zur Ausrichtung des Rührelements derart, dass im ausgerichteten Zustand das Rührelement den ersten Kammerbereich vom zweiten Kammerbereich trennt.Chamber according to one of the four preceding claims, comprising means for aligning the stirring element such that in the aligned state the stirring element separates the first chamber area from the second chamber area. Vorrichtung umfassend eine Kammer nach einem der fünf vorhergehenden Ansprüche mit einer internen Energieversorgung für die Durchführung einer PCR,Device comprising a chamber according to one of the five preceding claims with an internal power supply for carrying out a PCR,
EP09154744A 2009-03-10 2009-03-10 Isothermic PCR device Withdrawn EP2228132A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP09154744A EP2228132A1 (en) 2009-03-10 2009-03-10 Isothermic PCR device

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP09154744A EP2228132A1 (en) 2009-03-10 2009-03-10 Isothermic PCR device

Publications (1)

Publication Number Publication Date
EP2228132A1 true EP2228132A1 (en) 2010-09-15

Family

ID=40897586

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09154744A Withdrawn EP2228132A1 (en) 2009-03-10 2009-03-10 Isothermic PCR device

Country Status (1)

Country Link
EP (1) EP2228132A1 (en)

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0402995B1 (en) 1989-06-12 1994-12-14 Johnson & Johnson Clinical Diagnostics, Inc. Temperature control device and reaction vessel
EP0606961B1 (en) 1989-06-12 1997-03-05 Johnson & Johnson Clinical Diagnostics, Inc. Temperature control device for reaction vessel
US6171850B1 (en) 1999-03-08 2001-01-09 Caliper Technologies Corp. Integrated devices and systems for performing temperature controlled reactions and analyses
US20020127152A1 (en) * 2001-03-09 2002-09-12 The Regents Of The University Of California Convectively driven PCR thermal-cycling
WO2003007677A2 (en) 2001-07-16 2003-01-30 Idaho Technology, Inc. Thermal cycling system and method of use
US20030036189A1 (en) 1998-11-25 2003-02-20 The Regents Of The University Of California PCR thermocycler
US20040132051A1 (en) * 2002-07-26 2004-07-08 Andersen Mark R. Mg-mediated hot start biochemical reactions
EP1464399A2 (en) * 2003-04-02 2004-10-06 Hitachi, Ltd. Nucleic-acid amplifying apparatus and nucleic-acid amplifying method
DE102004050139A1 (en) * 2004-10-14 2006-04-20 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Microfluid processor, for executing PCR in a sample, comprises two high-grade steel chambers, for incubating the sample at different temperatures, having a base in which two micro-channels are arranged as reaction chambers
EP1860060A1 (en) * 2006-05-22 2007-11-28 Micronas Holding GmbH Method and apparatus for mixing microdroplets
US20080153152A1 (en) * 2006-11-22 2008-06-26 Akira Wakabayashi Microfluidic chip
US20080176292A1 (en) * 2007-01-23 2008-07-24 Texas A&M University System Portable buoyancy driven pcr thermocycler

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0402995B1 (en) 1989-06-12 1994-12-14 Johnson & Johnson Clinical Diagnostics, Inc. Temperature control device and reaction vessel
EP0606961B1 (en) 1989-06-12 1997-03-05 Johnson & Johnson Clinical Diagnostics, Inc. Temperature control device for reaction vessel
US20030036189A1 (en) 1998-11-25 2003-02-20 The Regents Of The University Of California PCR thermocycler
US6171850B1 (en) 1999-03-08 2001-01-09 Caliper Technologies Corp. Integrated devices and systems for performing temperature controlled reactions and analyses
US20020127152A1 (en) * 2001-03-09 2002-09-12 The Regents Of The University Of California Convectively driven PCR thermal-cycling
WO2003007677A2 (en) 2001-07-16 2003-01-30 Idaho Technology, Inc. Thermal cycling system and method of use
US20040132051A1 (en) * 2002-07-26 2004-07-08 Andersen Mark R. Mg-mediated hot start biochemical reactions
EP1464399A2 (en) * 2003-04-02 2004-10-06 Hitachi, Ltd. Nucleic-acid amplifying apparatus and nucleic-acid amplifying method
DE102004050139A1 (en) * 2004-10-14 2006-04-20 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Microfluid processor, for executing PCR in a sample, comprises two high-grade steel chambers, for incubating the sample at different temperatures, having a base in which two micro-channels are arranged as reaction chambers
EP1860060A1 (en) * 2006-05-22 2007-11-28 Micronas Holding GmbH Method and apparatus for mixing microdroplets
US20080153152A1 (en) * 2006-11-22 2008-06-26 Akira Wakabayashi Microfluidic chip
US20080176292A1 (en) * 2007-01-23 2008-07-24 Texas A&M University System Portable buoyancy driven pcr thermocycler

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KOPP MU; MELLO AJ; MANZ A.: "Chemical amplification: continousflow PCR on a chip", SIENCE, vol. 280, no. 5366, 15 May 1998 (1998-05-15), pages 046 - 8

Similar Documents

Publication Publication Date Title
DE60217375T2 (en) METHOD AND DEVICE FOR THE AMPLIFICATION OF NUCLEIC ACID SEQUENCES THROUGH THE THERMAL CONVECTION
EP2497840B1 (en) Oven system and process for partially heating steel blanks
EP2324938B1 (en) Method and thermal recasting assembly for producing a hardened, thermally recast workpiece
WO2015158852A1 (en) Mixing and thawing device
EP1786737B1 (en) Foamed glass cooling run
WO2017211901A1 (en) Temperature-control device for components
DE102010053979A1 (en) Hearth furnace multiple superposed heated planes for reception of flat or partially deformed steel plates, where each plane has two heating units
EP2828917B1 (en) Method of operating a fuel cell system
EP2228132A1 (en) Isothermic PCR device
DE10190053B4 (en) Laboratory temperature control unit with temperature-controlled tempering block
WO2016070945A1 (en) Pcr method for super-amplification
EP3414350A1 (en) Heat treatment method and heat treatment device
DE102013215166B3 (en) PCR process for superamplification
EP2861400B1 (en) Process to change the temperature of an object
EP3303960B1 (en) Tube furnace and chemical conversion method
DE60010467T2 (en) annealing furnace
WO2010040758A1 (en) Device and method for carrying out a plurality of multiplex flow-through pcr reactions
DE202007018930U1 (en) Thermal oscillation for the cyclic tempering of biological medical and chemical samples
DE102010027439C5 (en) Tower furnace for heating hardenable sheet metal blanks
AT520316B1 (en) Method and device for foaming an expandable particle foam material
DE102016202766A1 (en) Heat treatment process and heat treatment device
DE102013022382B3 (en) Method for multiplying nucleic acids
DE102016112969A1 (en) Discharge device for a shaft furnace and method for discharging firing material from a shaft furnace
DE102010064605B3 (en) deck oven
DE102019120831A1 (en) Batch holder, nitriding furnace and heat treatment system

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA RS

17P Request for examination filed

Effective date: 20101012

AKX Designation fees paid

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20120731