CN1280310C

CN1280310C - Fusion protein with cold proventing and curing function and its encoding gene and use

Info

Publication number: CN1280310C
Application number: CN 200410080414
Authority: CN
Inventors: 陈应华; 刘万里
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2004-09-29
Filing date: 2004-09-29
Publication date: 2006-10-18
Anticipated expiration: 2024-09-29
Also published as: CN1616491A

Abstract

The present invention discloses fusion protein with a flu preventing and curing function and encoding genes and application thereof. The fusion protein has the purpose of providing the fusion protein with the flu preventing and curing function and encoding genes thereof and vaccine medicine with the protein as an active component. The fusion protein with the flu preventing and curing function provided by the present invention has one of the following amino acid residue sequences: 1) SEQ ID No. 1 in a sequence table, 2) protein which has a flu virus inhibiting function and is formed by means that the amino acid residue sequence of the SEQ ID No. 1 in the sequence table is replaced, deleted or added by one to ten amino acid residues. The fusion protein with the flu preventing and curing function of The present invention can be used as vaccine for preventing flu virus.

Description

Have the fusion rotein and encoding gene and the application that prevent and treat the influenza effect

Technical field

The present invention relates to have the fusion rotein and encoding gene and the application that prevent and treat the influenza effect, particularly have the fusion rotein of preventing and treating the influenza effect and encoding gene thereof and be the vaccine of activeconstituents with this albumen.

Background technology

Influenza is a kind of common, multiple communicate illness that is caused by virus, to the mankind particularly the more weak people of old man, children and health very big threat is arranged, flu outbreak simultaneously also seriously influences entire society, Economic development.Existing influenza vaccines have following three kinds: (1) inactivated influenza virus vaccine, this vaccine are extensive use of in the adult at present, are to utilize the pathogenic agent behind the inactivated influenza virus to make.But this vaccine strain need in time be changed with the strains of influenza viruses antigenic variation, otherwise immune effect is just unsecured, even invalid.The needed virus of these type of influenza vaccines need be bred collection in the chicken embryo, in case the influenza large-scale outbreak, qualified chicken embryo supply often is difficult to guarantee; And, the chicken embryo that can't remove fully in this type of vaccine can in the part crowd, cause in vain allergic symptom appearance (Virus Research 2004,103:173-176).(2) influenza virus attenuated live vaccine, this vaccine begins to be used in a large number human body in nineteen sixty, also is to utilize the pathogenic agent behind the influenza virus attenuation to make.This vaccine strain also need in time be changed with the strains of influenza viruses antigenic variation, at present, and the domestic and international screening experiment that is carrying out the novel vaccine strain.(3) influenza virus subunit vaccine, this vaccine is the influenza vaccines that at present external children are using, it is the viral surface antigen induction of immunity protection that utilizes gene recombination, viral surface antigen also need in time be changed with influenza strain antigenic variation, otherwise immune effect is just unsecured, even invalid.

The total characteristics of present business-like influenza vaccines are the antigenic variations that not can do with the influenza virus strain.The variability of influenza virus is very strong, and antigenic variation constantly takes place.Above-mentioned influenza vaccines not can do with the variation of influenza virus, basic reason is because the design of above-mentioned influenza vaccines substantially all is based on the surperficial membrane-associated protein HA (hemagglutinin) of influenza virus, external studies show that in a large number, influenza virus is as positive chain RNA virus, and the RNA polymerase of its RNA dependent form (RNA dependent RNA polymerase) lacks the examination activity (Proof Reading Activity) that Eukaryotic archaeal dna polymerase has in genomic reproduction process.So the continuous variation of the main surface protein antigen HA of influenza virus has caused the immunologic escape of influenza virus, the HA mutation rate is respectively 6.7 * 10 ^-3(Annu Rev Genet 2,002 36 305-332).

Eighties of last century begins the another one surface membrane-associated protein M2 that influenza virus is transferred in many research after the nineties, and the research work of the overwhelming majority is with the proteic whole extracellular region sequence of M2 (aa1-24), as the design target spot of influenza virus vaccine.This mainly is because M2 albumen is compared HA outstanding conservative property is arranged, and a large amount of early-stage Study shows and the proteic extracellular region sequence of M2 can induce very effective protective humoral response (NatureMedicine 1999,5:1157-1163; Vaccine 2003,21:2616-2626; Vaccine 1995,13:1339-1342; Vaccine 2004,22:2993-3003; Virus Research 2004,103:173-176; Euro J Immunol 2002,32:3305-14).

Adopt mostly at present that (Vaccine 2003,21:2616-2626 with mentality of designing that the carrier proteins coupling joins with the M2e epitope polypeptide based on the influenza vaccines of influenza m 2 e epi-position design; Vaccine 2004,22:2993-3003; Virus Research 2004,103:173-176; Euro J Immunol 2002,32:3305-14), such influenza vaccines design can't guarantee successfully to be coupled to the quantity of the M2e epitope polypeptide on the carrier proteins on the one hand; On the other hand, in with polypeptide and carrier coupling connection process, to use the deleterious chemical coupling molecule of part, for example Chang Yong MBS (m-maleimidobenzoyl-N-hydroxy succinimide ester) and glutaraldehyde, and the DMSO that may use in melting the polypeptide process is that Sigma company clearly shows deleterious material, will certainly influence production and the popularization of these type of influenza vaccines like this.

A/PR/8/34 is one of representative strain of influenza virus A hominis H1N1 hypotype, often is ball-type, diameter 80-120nm.Minus-stranded rna virus, genome total length are 13.6Kb, virus replication in the cycle clear and definite protein product have 10.Reassortant virus adaptation of virus in mouse (Balb/c), make mouse invasion death can obtain the cause death mouse lung adapted strain of type of mouse, the mouse that generally the is used for influenza virus at home and abroad use strain of C-type virus C attack model that causes death.

Summary of the invention

The purpose of this invention is to provide a kind of fusion rotein and encoding gene thereof of preventing and treating the influenza effect that have.

Provided by the present invention have a fusion rotein of preventing and treating the influenza effect, and name is called GST-(M2e) ₁₆, be SEQ ID № in the sequence table: the protein shown in 1:

SEQ ID № in the sequence table: 1 is made up of 645 amino-acid residues.In the sequence 1, from the 1st-224 amino acids residue of aminoterminal is Thiadiazolidine isomerase, from the 225th-226 amino acids residue of aminoterminal is connection peptides GS, from the M2e protective epi-position of the 227th-640 amino acids residue of aminoterminal, be end peptide RSILL from the 641st-645 amino acids residue of aminoterminal for 16 copies using two peptide linkers (linker) RS linearity and link together.

Above-mentioned encoding gene with fusion rotein of preventing and treating the influenza effect also belongs to protection scope of the present invention.

Above-mentioned encoding gene with fusion rotein of preventing and treating the influenza effect can be SEQ ID № in the sequence table: 2 dna sequence dna.

SEQ ID № in the sequence table: 2 by 1938 based compositions, and its encoding sequence is from 5 ' end the 1st to the 1938th bit base.

Contain expression carrier of the present invention, clone and engineering bacteria and all belong to protection scope of the present invention,, contain the e. coli bl21 (DE3) of pGEX-4T-M16 as pGEX-4T-M16.

Increase and above-mentionedly have in the fusion rotein encoding gene of preventing and treating the influenza effect arbitrary segmental primer also within protection scope of the present invention.

Another object of the present invention provides a kind of vaccine of flu-prevention virus.

The vaccine of flu-prevention virus provided by the present invention, its activeconstituents are the above-mentioned fusion roteins of preventing and treating the influenza effect that has.

When needing, in above-mentioned vaccine, can also add one or more pharmaceutically acceptable carriers.Described carrier comprises thinner, absorption enhancer of pharmaceutical field routine etc.

Vaccine of the present invention can be made injection liquid, and the medicine of this formulation can be according to the ordinary method preparation of pharmaceutical field.

The immune consumption of above-mentioned vaccine be generally 0.5-2.5mg have the fusion rotein/kg body weight of preventing and treating the influenza effect/time.

Of the present invention have a fusion rotein GST-(M2e) that prevents and treats the influenza effect ₁₆The protective sequences Design that is based on influenza virus membrane-associated protein M2 extracellular region forms, be with Thiadiazolidine isomerase (Glutathione-S-transferase, GST) and use the recombination fusion protein of the M2e protective epi-position of 16 copies that two peptide linkers (linker) RS linearity links together, improved the copy number (epi-position density) of M2e protective epitope sequences specifically.And GST-(M2e) ₁₆Use the biological engineering method fermentation to form, mature production technology, its security greatly improves than the chemical coupling vaccine.

Experimental results show that identical immunizing dose and approach immune mouse or New Zealand white rabbit, GST-(M2e) ₁₆Induce the humoral immunoresponse(HI) at the M2e epitope sequences of generation significantly to be better than fusion rotein GST-M2e or the GST-(M2e) that only contains one or four M2e epitope sequences copy ₄Inductive M2e specificity humoral is replied; And show GST-(M2e) at the experiment of New Zealand white rabbit ₁₆Induce as immunizing agent that the specific antibody concentration of M2e epitope sequences is significantly higher than GST-M2e or GST-(M2e) in the antiserum(antisera) of generation ₄Induce the antiserum(antisera) of generation as immunizing agent; Moreover, GST-(M2e) ₁₆Induce the antiserum(antisera) of generation significantly to be better than GST-(M2e) or GST-(M2e) in ability aspect the identification influenza m 2 native protein ₄Induce the antiserum(antisera) of generation; Of paramount importancely be that mouse is intravital attacks the poison experiment and show GST-(M2e) ₁₆As immunizing agent can 100% the attack of deadly type influenza virus of protection mouse opposing lethal dose, GST-(M2e) ₄Can only protect 50% mouse to be immune against attacks respectively, and GST-M2e can not provide effective protection.And a large amount of neutralizing epitope that studies have shown that the influenza virus membrane-associated protein M2 that the present invention uses (the extracellular region aminoacid sequence (aa1-24:MSLLTEVETPIRNEWGCRCNDSSD) of influenza virus membrane-associated protein M2), very conservative (Nature Medicine 1999,5:1157-1163 in all human influenza virus; Vaccine 2004,22:2993-3003), so GST-of the present invention (M2e) ₁₆Have the protective ability of potential, GST-(M2e) at the influenza virus of different subtype ₁₆To in the control of influenza, play a significant role.

Description of drawings

Figure 1A is plasmid pGEX-4T-M1, pGEX-4T-M4, and pGEX-4T-M16 identifies collection of illustrative plates through the BamHI+XhoI double digestion

Figure 1B is GST-M2e, GST-(M2e) ₄, GST-(M2e) ₁₆The SDS-PAGE collection of illustrative plates

Fig. 2 is the fusion rotein GST-(M2e) behind the purifying ₁₆, GST-(M2e) ₄, the interactional immunoblotting collection of illustrative plates of GST-M2e and the specific monoclonal antibody of M2e epitope sequences

Fig. 3 is with GST, GST-M2e, GST-(M2e) ₄, GST-(M2e) ₁₆Carry out the legend formula explanation of immunization experiment

Fig. 4 A-Fig. 4 C is GST-(M2e) ₁₆, GST-(M2e) ₄Carry out respectively for the first time with GST-M2e, for the second time, immune for the third time back 15 days, the mensuration curve of the antibody titers of M2e epitope specificity in the mice serum of collection

Fig. 4 D-Fig. 4 F is GST-(M2e) ₁₆, GST-(M2e) ₄Carry out respectively for the first time with GST-M2e, for the second time, immune for the third time back 20 days, the mensuration curve of the antibody titers of M2e epitope specificity in the New Zealand white rabbit serum of collection

Fig. 5 is for using GST-(M2e) respectively ₁₆, GST-(M2e) ₄Carry out for the first time with GST-M2e, for the second time, immune for the third time back 20 days, the concentration histogram of M2e epitope specificity antibody in the New Zealand white rabbit serum of collection

6A-Fig. 6 B is PBS and uses GST, GST-(M2e) respectively ₁₆, GST-(M2e) ₄Discern the proteic flow cytometer detection curve of the natural M2 of influenza virus with the New Zealand white rabbit serum that GST-M2e gathered in immune for the third time back 20 days

Fig. 7 is to GST-(M2e) ₁₆, GST-(M2e) ₄Or after the immune for the third time back 15 days mouse of GST-M2e attacked poison, the body weight of mouse was with the change curve of attacking the poison time

Fig. 8 is to GST-(M2e) ₁₆, GST-(M2e) ₄Or after the immune for the third time back 15 days mouse of GST-M2e attacked poison, the survival rate of mouse was with the change curve of attacking the poison time

Embodiment

Embodiment 1, GST-(M2e) ₁₆, GST-(M2e) ₄Preparation and evaluation with GST-M2e

1, GST-(M2e) ₁₆, GST-(M2e) ₄Structure with three kinds of antigen-4 fusion protein genes of GST-M2e

Adopt 8909 Expedite nucleic acid automatic DNA synthesizer DNA device synthetic oligonucleotide chain L1 by Beijing AudioCodes biotechnology limited liability company, L2, P1 and P2, and identify through gel-purified.Their sequence is as follows: L1:5`GCGC GGATCCATGTCCCTGCTGACTGAAGTTGAAACTCCGATCCGTAACGAATG 3` (base of band underscore is a BamH I recognition sequence);

L2:5` GTTATCA AGATCTGTCGGAGGAGTCGTTGCAACGGCAACCCCATTCGTTACGG 3` (base of band underscore is a Bgl II recognition sequence);

P1:5` GTGCGC GGATCC3` (base of band underscore is a BamH I recognition sequence);

P2:5` CTCGAGTTATCA AGATCT3` (base of 5` end band underscore is an Xho I recognition sequence, and the base of 3` end band underscore is a Bgl II recognition sequence)

Adopt P1 and P2 as the upstream and downstream primer, adopt L1 and L2 to close the thuja acid chain, adopts following PCR (polymerase chain reaction) program, finish the artificial gene structure of fusion rotein as the nested widow of nested PCR (overlapping PCR).Reaction system is: each 4 μ L of 2.5pmol/L primer P1 and P2, the nested widow of 10pmol/L closes each 5 μ L of thuja acid chain L1 and L2 as template, 10mmol/L dNTPs 1 μ l, Taq enzyme 1U (can widely collect biotech firm available from the Shen, Shanghai), Buffer 5 μ l, pure water is supplied 50 μ l.Reaction conditions is: 94 ℃ of sex change 30 seconds, and 45 ℃ of annealing 30 seconds, 72 ℃ were extended 30 seconds, 30 circulations, last 72 ℃ were extended 5 minutes.Agarose gel electrophoresis detects the PCR product and purifying reclaims.PCR product and back the spending the night in 4 ℃ of T-easy carrier (available from U.S. Promega company) mixing are connected, and transformed into escherichia coli DH5 α bacterial strain competent cell, the blue hickie screening positive clone of IPTG, X-gal utilized.Extract the plasmid order-checking in the positive colony, the connection product called after pGEM-T-MO that will contain nested PCR product (nucleotide sequence) with sequence 3 in the sequence table, it contains M2e epitope gene segment in multiple clone site, this fragment gene segment has following characteristics: this segmental 5 ' end contains the recognition site of restriction enzyme BamHI; 3 ' end contains the recognition site of restriction enzyme BglII and XhoI.Use BglII enzyme and XhoI (available from Takata company) double digestion pGEM-T-MO, use DNA glue to reclaim test kit (can widely collect company) purifying and reclaim the carrier segment available from the Shen, Shanghai.(this dna segment is according to Liu Zuqiang at the dna fragmentation that is connected into a 614bp between pulsating two restriction enzyme sites of carrier of double digestion that passes through that reclaims to use the T4 dna ligase, Chen Yinghua, Recombinant Technology:Design and construction of a recombinant epitope-peptide gene as a universalepitope-vaccine strategy, Journal of Immunological Methods 2004, the method preparation of 285:93-97, it has the nucleotide sequence of sequence 5 in the sequence table), this fragment has following characteristics: 5 ' end contains the recognition site of the restriction enzyme of BglII (AGATCT), be right after terminator codon (TAA), i.e. 5`-thereafter AGATCTATTCTACTG TAA3`; 3 ' end contains the recognition site of XhoI; Have only single BglII and XhoI in this fragment, do not have the BamHI site.Should connect product transformed into escherichia coli DH5 α bacterial strain competent cell, utilize the blue hickie screening positive clone of IPTG, X-gal.Extract the plasmid order-checking in the positive colony, will contain the connection product called after pGEM-T-M1 of the GST-M2e gene (nucleotide sequence) of the M2e epi-position of encoding, M2e epi-position of this genes encoding with sequence 4 in the sequence table.PGEM-T-M1 reclaims small segment with BamHI+XhoI digestion, the carrier segments that insertion obtains behind BglII+XhoI digestion pGEM-T-M1, should connect product transformed into escherichia coli DH5 α bacterial strain competent cell, utilize blue hickie screening of IPTG, X-gal and order-checking, obtain containing the GST-(M2e) of two M2e epi-positions of encoding ₂The connection product pGEM-T-M2 of gene.According to above-mentioned principle, substantially repeat top step, pGEM-T-M2 reclaims small segment with BamHI+XhoI digestion, the carrier segments that insertion obtains behind BglII+XhoI digestion pGEM-T-M2, should connect product transformed into escherichia coli DH5 α bacterial strain competent cell, utilize blue hickie screening of IPTG, X-gal and order-checking, obtain containing the GST-(M2e) of 4 M2e epi-positions of encoding ₄The positive plasmid pGEM-T-M4 of gene.Repeat above-mentioned steps twice again according to above-mentioned principle, obtain positive plasmid pGEM-T-M16, this plasmid contains the GST-(M2e) of 16 the M2e epi-positions of encoding ₁₆Gene (nucleotide sequence) with sequence 2 in the sequence table.Obtain three kinds of recombinant plasmid pGEM-T-M1 like this, pGEM-T-M4 and pGEM-T-M16 have respectively can encode one, the gene of four and 16 M2e epi-positions.The BamHI+XhoI enzyme is cut above-mentioned three kinds of plasmids, reclaim three kinds of epitope gene segments of cutting release through enzyme, insert pGEX-4T-2 (available from AmershamBiosciences company) respectively through BamHI+XhoI digestion, obtain positive colony pGEX-4T-M1 respectively through screening, pGEX-4T-M4, pGEX-4T-M16.These positive plasmids identify that through the BamHI+XhoI double digestion (Figure 1A,

swimming lane

1,2,3 are respectively GST-M2e gene, GST-(M2e) ₄Gene, GST-(M2e) ₁₆Gene) and dna sequencing identify and to show that structure is correct.

2, GST-(M2e) ₁₆, GST-(M2e) ₄, GST-M2e Expression of Fusion Protein purifying

Respectively with pGEX-4T-M1, pGEX-4T-M4, pGEX-4T-M16 and pass through CaCl as the pGEX-4T-2 plasmid of negative control ₂Method transforms BL21 (DE3) bacterium, utilizes blue hickie screening of IPTG, X-gal and order-checking, obtains positive colony.Each BL21 (DE3) mono-clonal bacterial strain that has transformed the reorganization prokaryotic expression plasmid all carries out the Expression of Fusion Protein purifying according to following condition.37 ℃, 220rpm shaking culture spend the night in the LB substratum, are transferred in the fresh LB substratum with 1: 50 in second day to carry out abduction delivering.Expression condition is: arrive about 0.6 o'clock of OD A600 at bacterial growth, add IPTG to final concentration be 1mmol/L, induce 3-4 hour (the long more target protein degraded of induction time ratio is high more) for 37 ℃, 10, the centrifugal results of 000rpm bacterium, (PBS pH7.2) washs once ,-20 ℃ frozen (freezing cracking that helps bacterium) of bacterium precipitation with phosphate buffered saline buffer.

The fusion rotein purification step is as follows:

(1) the resuspended 500ml bacterial precipitation of the PBS that 20ml is ice-cold (pH7.2), add N,O-Diacetylmuramidase powder 20mg, add 2ml 10%Triton X-100 PBS solution, add 100ul 5mg/ml DNase and Rnase, ice bath stirs 30 minutes simultaneously fast to solution thickness no longer.Adding proteinase inhibitor PMSF simultaneously is 100mmol/L to final concentration.

(2) supernatant is collected in ice-bath ultrasonic cracking.0.45 μ m membrane filtration supernatant, filtrate is used for the affinity purification fusion rotein.

(3) filtering supernatant is flow through affinity column Glutathione-Sepharose 4B affinity column (available from Amersham Biosciences company), flow velocity is 30ml/h.50-100ml 0.6-1M NaCl PBS (pH7.2) solution is washed post, removes the albumen of most of non-specific adsorption.

(4) under FPLC system (Pharmacia) monitoring, continue with PBS (pH7.2) balance affinity column, utilize the recombinant antigen of the competitive wash-out absorption of 10mM reduced glutathion 50mM Tris-HCl (pH8.0) solution, collect the albumen of wash-out, obtain the immunity recombinant antigen.

Utilize 12% polyacrylamide gel electrophoresis (SDS-PAGE) to detect the purity of the fusion rotein of purifying, the result shows to obtain electrophoretically pure fusion rotein (Figure 1B,

swimming lane

1,2,3 is respectively GST-M2e, GST-(M2e) shown in Figure 1B ₄, GST-(M2e) ₁₆)

4, GST-(M2e) ₁₆, GST-(M2e) ₄, the protein concentration of GST-M2e fusion rotein and antigenicity identify the protein concentration of measuring purifying with Bradford method (Coomassie brilliant blue method), wherein, measure A630nm, with the protein content is Y-axis, A630nm is the point that X-axis is put on standardized solution, in Microsoft Excel, utilize the binomialexpression method to carry out curve fitting, calculate the concentration of agnoprotein again with the curve equation that obtains.The result shows the GST-(M2e) that step 2 is expressed ₁₆, GST-(M2e) ₄, GST-M2e protein concentration be respectively 0.30,0.50,0.67g/L.

Measure the antigenicity of fusion rotein at the M2e epi-position with Immunoblotting (immunoblotting) method, concrete steps are as follows:

(1) at first finishes four kinds of sample GST-(M2e) ₁₆, GST-(M2e) ₄, GST-M2e and GST contrast 12% polyacrylamide gel electrophoresis (SDS-PAGE).

(2) prepare and identical 6 filter paper and 1 the mixed nitrate cellulose filter membrane of gel size.

(3) 3 filter paper and nitrocellulose filter are placed electrotransfer device anode flat plate successively, and (preparation of transfering buffering liquid: take by weighing the 11.17g glycine, 2.42gTris alkali adds water to 800ml to be soaked in transfering buffering liquid, transfer pH to 8.0 with concentrated hydrochloric acid, add 200ml methyl alcohol again) in.

(4) gel that electrophoresis is finished places on the nitrocellulose filter, above coated with 3 filter paper and electrotransfer device negative electrode flat board.In the electrotransfer groove, add transfering buffering liquid.With constant voltage 14V electrotransfer more than 8 hours.

(5) change film and finish after, with 10 * ponceau staining fluid (10 * ponceau formula for dye liquor: Ponceau S 2g, trichoroacetic acid(TCA) 30g, sulphosalicylic acid 30g adds water to 100ml) labelled protein and cut band.Place the PBS solution room temperature condition that contains 1% skim-milk to seal more than 2 hours down the nitrocellulose filter that downcuts.

(6) with through monoclonal antibody (the 5 μ g/ml of the M2e of PBS solution dilution epitope specificity, this monoclonal antibody is according to Liu Wanli, Zou Peng, Chen Yinghua, Monoclonal antibodies recognizing EVETPIRNepitope of influenza A virus M2 protein could protect mice from lethalinfluenza A virus challenge, Immunology letters 2004, the method for 93:131-136 preparation) room temperature condition reaction 30 minutes down.With PBS solution rinsing film three times, each 10 minutes.

(7) concentration that adds through the PBS dilution is that lucifuge was reacted 30 minutes under 1 μ g/ml two anti-(the anti-mouse Ig-HRP of rabbit (available from DAKO) of covalency coupling connection horseradish peroxidase) the solution room temperature condition.PBS solution rinsing film three times, each 10 minutes.

(8) add the substrate solution of fresh configuration, the lucifuge reaction develops the color when observing protein band that (substrate solution: (3,3 '-diaminobenzidine Sigma) is dissolved among the 10ml PBS, adds the H of 15 μ 1 30% with 6mg DAB from substrate solution with film when apparent in view ₂O ₂, mix and can use) in take out and with rinsed with deionized water with termination reaction, the preservation of taking pictures.

The result shows GST-(M2e) as shown in Figure 2 ₁₆, GST-(M2e) ₄All can be had good immunogenicity with GST-M2e by the identification of the monoclonal antibody of M2e epitope specificity.Among Fig. 2,

swimming lane

1,2,3 and 4 is represented GST, GST-M2e, GST-(M2e) respectively ₄And GST-(M2e) ₁₆

Embodiment 2, GST-(M2e) ₁₆The experiment of inductive antibody horizontal

Fig. 3 represents GST, GST-M2e, GST-(M2e) visually with legend ₄And GST-(M2e) ₁₆The epi-position density situation of middle M2e is represented GST, GST-M2e, GST-(M2e) respectively with M0, M1, M4 and M16 ₄And GST-(M2e) ₁₆

Carry out mouse (BALB/c) and New Zealand white rabbit immunization experiment as follows as animal model:

Totally 32 of female Balb/c mouse 16-20 grams are divided into four groups at random, with immunogen (GST, GST-M2e, GST-(M2e) ₄Or GST-(M2e) ₁₆) 8 mouse of difference peritoneal immunity.Every mouse is injected the former 50 μ g of recombinant immune of complete freund adjuvant (PIERCE company product) emulsive PBS dilution in 1: 1 for the first time, and immune volume 200 μ l carry out subcutaneous first multiple spot (4 point) injecting immune, every some subcutaneous injection 50 μ L.Later on every the fortnight immunity once, incomplete freund adjuvant emulsification is used in twice immunity in back, and immunizing dose is constant.Got blood with each immune back 15 days from the tail vein before the immunity.Female New Zealand white rabbits 1.7-1.9kg, every kind of immunogen is with subcutaneous immune three rabbits.Every rabbit is injected the former 200 μ g of recombinant immune of complete freund adjuvant (PIERCE company product) emulsive PBS dilution in 1: 1 for the first time, and immune volume 1000 μ l carry out subcutaneous first multiple spot (4 point) injecting immune, every some subcutaneous injection 250 μ L.Later on every the fortnight immunity once, incomplete freund adjuvant emulsification is used in twice immunity in back, and immunizing dose is constant.Got blood from auricular vein in back 20 days with each immunity before the immunity, last immunity was passed through the carotid artery bloodletting in back 20 days and is obtained a large amount of serum.

Identify the identification of the serum obtain at the M2e epitope polypeptide with enzyme-linked immunosorbent assay (ELISA):

The M2e epitope polypeptide is (synthetic by U.S. Genemed Synthesis company, San Francisco, CA, USA), its aminoacid sequence is N-KSLLTEVETPIRNEWGCRCNDSSD-C, the M2e polypeptide is coated on the polystyrene elisa plate of solid phase (available from Costar), the antiserum(antisera) that obtains with each immunity blood sampling in back 15 days was as first antibody and antigen room temperature reaction 1 hour; PBS-Tween (0.05%Tween is available from Sigma) washing, uncombined antibody is washed off; The anti-mouse Ig-HRP of rabbit of covalency coupling connection horseradish peroxidase is as colour developing two anti-(available from DAKO); After the PBS-Tween washing, add the adjacent stupid diamines (OPD is available from Sigma) of chromogenic substrate; Use microplate reader (, model550) to measure absorbancy under the 450nm at last available from Bio-Rad.No matter the result shows at mouse model still in the New Zealand white rabbit model GST-M2e, GST-(M2e) shown in Fig. 4 A-Fig. 4 F ₄And GST-(M2e) ₁₆The inductive antiserum(antisera) can be discerned the M2e epitope polypeptide of influenza m 2 protein extracellular region.GST-(M2e) ₁₆Under the situation of identical immunizing dose, can induce remarkable enhanced M2e epitope polypeptide antigen-specific immune responses; Behind the mouse initial immunity 15 days (rabbit 20 days), GST-(M2e) ₁₆The specific antibody titers of inductive M2e has surpassed 1: 1600, and comprises the fusion rotein GST-(M2e) of lower M2e epi-position density ₄, the specific antibody titers of GST-M2e inductive M2e does not all have to surpass 1: 400 (Fig. 4 A, Fig. 4 D).Behind the New Zealand white rabbit second immunisation 20 days (mouse 15 days), GST-(M2e) ₁₆The specific antibody titers of inductive M2e has surpassed 1: 25600, and the specific antibody titers of fusion rotein GST-M2e inductive M2e is only near 1: 1600 (Fig. 4 B, Fig. 4 E).After immunity for the third time, GST-in New Zealand white rabbit (M2e) ₁₆The specific antibody titers of inductive M2e surpasses the specific antibody titers of GST-M2e inductive M2e more than ten times; GST-in mouse (M2e) ₁₆The specific antibody horizontal of inductive M2e is also obvious must to surpass the specific antibody horizontal of GST-M2e inductive M2e (Fig. 4 C, Fig. 4 F).

Embodiment 3, GST-M2e, GST-(M2e) ₄And GST-(M2e) ₁₆Inductive rabbit anteserum M2e specific antibody concentration and the proteic experiment of the identification natural M2 of influenza virus

1, use the specific affinity column of M2e epitope polypeptide to identify GST-(M2e) ₁₆, GST-(M2e) ₄, the principle and the step of the preparation of the experiment affinity column of M2e epitope polypeptide specific antibody concentration in the GST-M2e inductive rabbit anti-serum: utilize the active group NHS-on the post section product Sepharose4-FAST of Pharmacia company to be easy to and the amino acid whose NH of M2e epitope polypeptide ₂-group is in conjunction with reacting and metastable coupling is associated in the preparation that together characteristics are finished affinity column.

(1) draw the NHS-activated_Sepharose4-FAST post material (Pharmacia company) of 1ml, with the M2e epitope polypeptide of 2mg (synthetic by U.S. Genemed Synthesis company, San Francisco, CA, USA; Its aminoacid sequence is N-KSLLTEVETPIRNEWGCRCNDSSD-C) use deionized water dissolving.With the NHS group on the HCl activation post material of 1mM.

(2) the post material is placed the 0.1M NaHCO of 1ml ₃(PH7.7) in, add the M2e epitope polypeptide of the 2mg after dissolving, light shaking 0.5 hour, then shaken over night on shaking table.

(3) with adding the 0.5M Tris-0.5M NaCl (PH8.3) of 1ml in the post material after centrifugal, sealed 2 hours, with the still unreacted NHS group of sealing, centrifugal usefulness 20% ethanol is washed several standby all over the back.

Prove that through preliminary experiment the specific affinity column of the M2e of preparation can adsorb the specific antibody of M2e all in the rabbit anteserum of 1ml completely, and the reusable efficient height of this affinity column.

The determination step of M2e epitope polypeptide specific antibody concentration is as follows in the rabbit anteserum:

(1) use 5ml ultrapure water and 5ml PBS (pH7.2) to clean the specific affinity column of M2e epitope polypeptide that was kept at originally in 20% ethanol.

(2) with GST, GST-M2e, GST-(M2e) ₄And GST-(M2e) ₁₆The rabbit anteserum 1ml that immunity obtains, high speed centrifugation is 5 minutes under the condition of 12000g, with 5 times of 4ml PBS (pH7.2) dilutions, with 0.45 μ m membrane filtration.

(3) filterable serum is by M2e specificity affinity column, and flow velocity is 30ml/h (crossing post in 4 ℃ of refrigerators, to reduce protein denaturation as far as possible), repeats sample once.

(4) 5-10ml PBS (pH7.2) solution is washed post, removes the albumen of most of non-specific adsorption.

(5) under FPLC system (Pharmacia) monitoring, continue to utilize the specific antibody of M2e of glycine solution (pH2.5) the wash-out absorption of 0.15mM with PBS (pH7.2) balance affinity column.

(6) utilize the elution peak of FPLC system monitoring wash-out M2e specific antibody, utilize FPLC system software integration to obtain the quality (μ g) of the M2e specific antibody of this elution peak correspondence.

(7) just can access the specific antibody concentration of rabbit anteserum M2e epitope polypeptide (the μ g/ml of unit) with the size of this quality divided by the initial 1ml rabbit anteserum that is used for initially going up sample.

The result shows GST-(M2e) as shown in Figure 5 ₁₆Just exempting from back 20 days, back 20 days of immunity for the second time immune for the third time back 20 days, has all been induced in rabbit anteserum than the higher specific antibody concentration of M2e epitope polypeptide at every turn, and will obviously must be higher than fusion rotein GST-(M2e) ₄, the concentration of the specific antibody of GST-M2e inductive M2e; Concentration in the serum of gathering in immune back 20 days for the third time is up to 420 μ g/ml.Among Fig. 5, M0, M1, M4 and M16 represent GST, GST-M2e, GST-(M2e) respectively ₄And GST-(M2e) ₁₆

2, fluidic cell marker detection method (FACS) detection influenza virus amalgamation protein vaccine induces rabbit anteserum to the proteic identification of the natural M2 of influenza virus

10 ⁷-10 ⁸Individual mdck cell (available from American Type Culture Collecti, ATCC) middle inoculation 10 ⁵-10 ⁶Influenza virus A/wuhan/359/95 (A/wuhan/359/95 is one of representative strain of influenza virus A hominis's (H3N2 hypotype), often is ball-type, diameter 80-120nm.Minus-stranded rna virus, genome total length are 13.6Kb, virus replication in the cycle clear and definite protein product have 10, see " influenza virus and experimental technique thereof ", Guo Yuanji, Cheng Xiaowen work Chinese Sanxia Publishing House), cultivated 18 hours for 34 degrees centigrade; Then with behind the influenza infection the proteic mdck cell of cell surface great expression M2 (Nature Medicine 1999,5:1157-1163), with PBS and use GST, GST-M2e, GST-(M2e) ₄And GST-(M2e) ₁₆After the immune for the third time New Zealand white rabbit 1: 400 extent of dilution antiserum(antisera) of 20 days respectively room temperature bathed altogether 1 hour; Use the goat-anti rabbit Ig-FITC of FITC mark (available from DAKO, Danmark) to resist, (, Pharmingen) detect the identification situation available from BD Biosciences with FACSCalibur as luminous two.The result is shown in Fig. 6 A-Fig. 6 B, show through the fusion rotein inductive antiserum(antisera) (1: 400) that has the M2e epi-position after three immunity and can discern the natural M2 albumen of influenza virus (curve 3,4,5) that wherein the proteic ability of GST-(M2e) 16 inductive antiserum(antisera)s (curve 5) the identification natural M2 of influenza virus obviously is higher than fusion rotein GST-(M2e) ₄, GST-M2e inductive antiserum(antisera) (being respectively curve 4 and 3).Among Fig. 6 A-Fig. 6 B, curve 1 is the proteic recognition result of the natural M2 of PBS and influenza virus, curve 2 is GST reference protein inductive antiserum(antisera) and the proteic recognition result of the natural M2 of influenza virus, and curve 3,4,5 is respectively fusion rotein GST-M2e, the GST-(M2e) that contains the M2e epitope sequences ₄And GST-(M2e) ₁₆The proteic recognition result of the natural M2 of inductive antiserum(antisera) and influenza virus.

Embodiment 4, GST-(M2e) ₁₆Protection mouse that can 100% avoids the attack of the influenza virus of lethal dose

(A/PR/8/34 is one of representative strain of influenza virus A hominis's (H1N1 hypotype) with the deadly type influenza virus (A/PR/8/34) of the mouse of lethal dose (about 10000 live virus particles) to immune for the third time all back 15 days four groups of mouse (BALB/c) among the embodiment 2, normal is ball-type, diameter 80-120nm.Minus-stranded rna virus, genome total length are 13.6Kb, virus replication in the cycle clear and definite protein product have 10.Reassortant virus adaptation of virus in mouse (Balb/c), make mouse invasion death can obtain the mouse lung adapted strain of the deadly type of mouse, see " influenza virus and experimental technique thereof ", Guo Yuanji, Cheng Xiaowen work Chinese Sanxia Publishing House) carry out virus attack.Write down body weight change of all mouse and the number of dead mouse every day in 30 days after attack.The result as shown in Figure 7 and Figure 8, all mouse of fusion rotein GST-M2e immunity of using the GST negative control group and only containing a M2e epi-position are after attacking poison, body weight obviously alleviates, and death fully in attacking back 10 days of poison; The fusion rotein GST-(M2e) that contains lower M2e epi-position density ₄Mice immunized is after the attack of lethal dose, though there is 50% survival rate weight loss obvious; And use GST-(M2e) ₁₆Mice immunized not only can 100% ground be resisted the attack of lethal dose lethality influenza virus (A/PR/8/34), and the body weight of mouse does not have obvious must the reduction after carrying out virus attack.Mouse is attacked the poison experiment and is GST-(M2e) ₁₆Validity the most direct evidence is provided, all above experimental results show that the new type influenza virus amalgamation protein vaccine that the present invention proposes has excellent application value, will play an important role in preventing and controlling influenza.

Sequence table

<160>5

<210>1

<211>645

<212>PRT

＜213〉Influenza Virus human influenza virus (Orthomyxoviridae)

<400>1

Met?Ser?Pro?Ile?Leu?Gly?Tyr?Trp?Lys?Ile?Lys?Gly?Leu?Val?Gln?Pro

1 5 10 15

Thr?Arg?Leu?Leu?Leu?Glu?Tyr?Leu?Glu?Glu?Lys?Tyr?Glu?Glu?His?Leu

20 25 30

Tyr?Glu?Arg?Asp?Glu?Gly?Asp?Lys?Trp?Arg?Asn?Lys?Lys?Phe?Glu?Leu

35 40 45

Gly?Leu?Glu?Phe?Pro?Asn?Leu?Pro?Tyr?Tyr?Ile?Asp?Gly?Asp?Val?Lys

50 55 60

Leu?Thr?Gln?Ser?Met?Ala?Ile?Ile?Arg?Tyr?Ile?Ala?Asp?Lys?His?Asn

65 70 75 80

Met?Leu?Gly?Gly?Cys?Pro?Lys?Glu?Arg?Ala?Glu?Ile?Ser?Met?Leu?Glu

85 90 95

Gly?Ala?Val?Leu?Asp?Ile?Arg?Tyr?Gly?Val?Ser?Arg?Ile?Ala?Tyr?Ser

100 105 110

Lys?Asp?Phe?Glu?Thr?Leu?Lys?Val?Asp?Phe?Leu?Ser?Lys?Leu?Pro?Glu

115 120 125

Met?Leu?Lys?Met?Phe?Glu?Asp?Arg?Leu?Cys?His?Lys?Thr?Tyr?Leu?Asn

130 135 140

Gly?Asp?His?Val?Thr?His?Pro?Asp?Phe?Met?Leu?Tyr?Asp?Ala?Leu?Asp

145 150 155 160

Val?Val?Leu?Tyr?Met?Asp?Pro?Met?Cys?Leu?Asp?Ala?Phe?Pro?Lys?Leu

165 170 175

Val?Cys?Phe?Lys?Lys?Arg?Ile?Glu?Ala?Ile?Pro?Gln?Ile?Asp?Lys?Tyr

180 185 190

Leu?Lys?Ser?Ser?Lys?Tyr?Ile?Ala?Trp?Pro?Leu?Gln?Gly?Trp?Gln?Ala

195 200 205

Thr?Phe?Gly?Gly?Gly?Asp?His?Pro?Pro?Lys?Ser?Asp?Leu?Val?Pro?Arg

210 215 220

Gly?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu

225 230 235 240

Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu

245 250 255

Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn

260 265 270

Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro

275 280 285

Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser

290 295 300

Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly

305 310 315 320

Cys?Arg?Cys?Ash?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu

325 330 335

Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser

340 345 350

Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg

355 360 365

Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser

370 375 380

Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg

385 390 395 400

Cys?Ash?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu

405 410 415

Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp

420 425 430

Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu

435 440 445

Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu

450 455 460

Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn

465 470 475 480

Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro

485 490 495

Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser

500 505 510

Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly

515 520 525

Cys?Arg?Cys?Ash?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu

530 535 540

Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser

545 550 555 560

Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg

565 570 575

Asn?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser

580 585 590

Leu?Leu?Thr?Glu?Val?Glu?Thr?Pro?Ile?Arg?Asn?Glu?Trp?Gly?Cys?Arg

595 600 605

Cys?Asn?Asp?Ser?Ser?Asp?Arg?Ser?Met?Ser?Leu?Leu?Thr?Glu?Val?Glu

610 615 620

Thr?Pro?Ile?Arg?Ash?Glu?Trp?Gly?Cys?Arg?Cys?Asn?Asp?Ser?Ser?Asp

625 630 635 640

Arg?Ser?Ile?Leu?Leu

645

<210>2

<211>1938

<212>DNA

＜213〉Influenza Virus human influenza virus (Orthomyxoviridae)

<400>2

atgtccccta?tactaggtta?ttggaaaatt?aagggccttg?tgcaacccac?tcgacttctt 60

ttggaatatc?ttgaagaaaa?atatgaagag?catttgtatg?agcgcgatga?aggtgataaa 120

tggcgaaaca?aaaagtttga?attgggtttg?gagtttccca?atcttcctta?ttatattgat 180

ggtgatgtta?aattaacaca?gtctatggcc?atcatacgtt?atatagctga?caagcacaac 240

atgttgggtg?gttgtccaaa?agagcgtgca?gagatttcaa?tgcttgaagg?agcggttttg 300

gatattagat?acggtgtttc?gagaattgca?tatagtaaag?actttgaaac?tctcaaagtt 360

gattttctta?gcaagctacc?tgaaatgctg?aaaatgttcg?aagatcgttt?atgtcataaa 420

acatatttaa?atggtgatca?tgtaacccat?cctgacttca?tgttgtatGa?cgctcttgat 480

gttgttttat?acatggaccc?aatgtgcctg?gatgcgttcc?caaaattagt?ttgttttaaa 540

aaacgtattg?aagctatccc?acaaattgat?aagtacttga?aatccagcaa?gtatatagca 600

tggcctttgc?agggctggca?agccacgttt?ggtggtggcg?accatcctcc?aaaatcggat 660

ctggttccgc?gtggatccat?gtccctgctg?actgaagttg?aaactccgat?ccgtaacgaa 720

tggggttgcc?gttgcaacga?ctcctccgac?agatccatgt?ccctgctgac?tgaagttgaa 780

actccgatcc?gtaacgaatg?gggttgccgt?tgcaacgact?cctccgacag?atccatgtcc 840

ctgctgactg?aagttgaaac?tccgatccgt?aacgaatggg?gttgccgttg?caacgactcc 900

tccgacagat?ccatgtccct?gctgactgaa?gttgaaactc?cgatccgtaa?cgaatggggt 960

tgccgttgca?acgactcctc?cgacagatcc?atgtccctgc?tgactgaagt?tgaaactccg 1020

atccgtaacg?aatggggttg?ccgttgcaac?gactcctccg?acagatccat?gtccctgctg 1080

actgaagttg?aaactccgat?ccgtaacgaa?tggggttgcc?gttgcaacga?ctcctccgac 1140

agatccatgt?ccctgctgac?tgaagttgaa?actccgatcc?gtaacgaatg?gggttgccgt 1200

tgcaacgact?cctccgacag?atccatgtcc?ctgctgactg?aagttgaaac?tccgatccgt 1260

aacgaatggg?gttgccgttg?caacgactcc?tccgacagat?ccatgtccct?gctgactgaa 1320

gttgaaactc?cgatccgtaa?cgaatggggt?tgccgttgca?acgactcctc?cgacagatcc 1380

atgtccctgc?tgactgaagt?tgaaactccg?atccgtaacg?aatggggttg?ccgttgcaac 1440

gactcctccg?acagatccat?gtccctgctg?actgaagttg?aaactccgat?ccgtaacgaa 1500

tggggttgcc?gttgcaacga?ctcctccgac?agatccatgt?ccctgctgac?tgaagttgaa 1560

actccgatcc?gtaacgaatg?gggttgccgt?tgcaacgact?cctccgacag?atccatgtcc 1620

ctgctgactg?aagttgaaac?tccgatccgt?aacgaatggg?gttgccgttg?caacgactcc 1680

tccgacagat?ccatgtccct?gctgactgaa?gttgaaactc?cgatccgtaa?cgaatggggt 1740

tgccgttgca?acgactcctc?cgacagatcc?atgtccctgc?tgactgaagt?tgaaactccg 1800

atccgtaacg?aatggggttg?ccgttgcaac?gactcctccg?acagatccat?gtccctgctg 1860

actgaagttg?aaactccgat?ccgtaacgaa?tggggttgcc?gttgcaacga?ctcctccgac 1920

agatctattc?tactgtaa 1938

<210>3

<211>96

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

ggatccatgt?ccctgctgac?tgaagttgaa?actccgatcc?gtaacgaatg?gggttgccgt 60

tgcaacgact?cctccgacag?atcttgataa?ctcgag 96

<210>4

<211>768

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>

atgtccccta?tactaggtta?ttggaaaatt?aagggccttg?tgcaacccac?tcgacttctt 60

ttggaatatc?ttgaagaaaa?atatgaagag?catttgtatg?agcgcgatga?aggtgataaa 120

tggcgaaaca?aaaagtttga?attgggtttg?gagtttccca?atcttcctta?ttatattgat 180

ggtgatgtta?aattaacaca?gtctatggcc?atcatacgtt?atatagctga?caagcacaac 240

atgttgggtg?gttgtccaaa?agagcgtgca?gagatttcaa?tgcttgaagg?agcggttttg 300

gatattagat?acggtgtttc?gagaattgca?tatagtaaag?actttgaaac?tctcaaagtt 360

gattttctta?gcaagctacc?tgaaatgctg?aaaatgttcg?aagatcgttt?atgtcataaa 420

acatatttaa?atggtgatca?tgtaacccat?cctgacttca?tgttgtatga?cgctcttgat 480

gttgttttat?acatggaccc?aatgtgcctg?gatgcgttcc?caaaattagt?ttgttttaaa 540

aaacgtattg?aagctatccc?acaaattgat?aagtacttga?aatccagcaa?gtatatagca 600

tggcctttgc?agggctggca?agccacgttt?ggtggtggcg?accatcctcc?aaaatcggat 660

ctggttccgc?gtggatccat?gtccctgctg?actgaagttg?aaactccgat?ccgtaacgaa 720

tggggttgcc?gttgcaacga?ctcctccgac?agatctattc?tactgtaa 768

<210>5

<211>614

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>5

agatctattc?tactgtaagt?tggggggcaa?ctggacatgt?gtgaaaggtg?aaccagtggt 60

ctacacaggg?gggcaagtaa?aacaatgcaa?atggtgtggc?ttcgacttca?acgagcctga 120

cggactccca?cactacccca?taggtaagtg?cattttggca?aatgagacag?gttacagaat 180

agtagattca?acggactgta?acagagatgg?cgttgtaatc?agcgcagaag?ggagtcatga 240

gtgcttgatc?ggcaacacaa?ctgtcaaggt?gcatgcatca?gatgaaagac?tgggccctat 300

gccatgcaga?cctaaagaga?ttgtctctag?tgcaggacct?gtaaggaaaa?cttcctgtac 360

attcaactac?gcaaaaactt?tgaagaacaa?gtactatgag?cccagggaca?gctacttcca 420

gcaatatatg?ctcaagggcg?agtatcagta?ctggtttgac?ctggacgtga?cagaccgcca 480

ctcagattac?ttcgcagaat?ttgttgtctt?ggtggtggta?gcactgttag?gaggaagata 540

tgtcctgtgg?ctgatagtga?cctacatagt?tctaagaatt?ctgcagatat?ccatcacact 600

ggcggccgct?cgag 614

Claims

1, having the fusion rotein of preventing and treating the influenza effect, is SEQ ID № in the sequence table: 1 amino acid residue sequence.

2, the described encoding gene of claim 1 with fusion rotein of preventing and treating the influenza effect.

3, gene according to claim 2 is characterized in that: described encoding gene with fusion rotein of preventing and treating the influenza effect is SEQ ID № in the sequence table: 2 dna sequence dna.

4, contain claim 2 or 3 described expression vectors with encoding gene of the fusion rotein of preventing and treating the influenza effect.

5, expression vector according to claim 4 is characterized in that: described expression vector is pGEX-4T-M16.

6, contain claim 2 or 3 described clones with encoding gene of the fusion rotein of preventing and treating the influenza effect.

7, contain claim 2 or 3 described engineering bacterias with encoding gene of the fusion rotein of preventing and treating the influenza effect.

8, engineering bacteria according to claim 7 is characterized in that: described engineering bacteria is the e. coli bl21 (DE3) that contains pGEX-4T-M16.

9, arbitrary segmental primer is right in amplification claim 2 or the 3 described encoding genes with fusion rotein of preventing and treating the influenza effect.

10, to be that claim 1 is described have a fusion rotein of preventing and treating the influenza effect for a kind of vaccine of flu-prevention virus, its activeconstituents.