CA2654733C - Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level - Google Patents

Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level Download PDF

Info

Publication number
CA2654733C
CA2654733C CA2654733A CA2654733A CA2654733C CA 2654733 C CA2654733 C CA 2654733C CA 2654733 A CA2654733 A CA 2654733A CA 2654733 A CA2654733 A CA 2654733A CA 2654733 C CA2654733 C CA 2654733C
Authority
CA
Canada
Prior art keywords
pyrimidin
yloxy
phenyl
methanesulfonyl
glp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA2654733A
Other languages
French (fr)
Other versions
CA2654733A1 (en
Inventor
Zhi-Liang Chu
James N. Leonard
Hussein Al-Shamma
Robert M. Jones
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arena Pharmaceuticals Inc
Original Assignee
Arena Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=36570727&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA2654733(C) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Arena Pharmaceuticals Inc filed Critical Arena Pharmaceuticals Inc
Publication of CA2654733A1 publication Critical patent/CA2654733A1/en
Application granted granted Critical
Publication of CA2654733C publication Critical patent/CA2654733C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G01N33/76Human chorionic gonadotropin including luteinising hormone, follicle stimulating hormone, thyroid stimulating hormone or their receptors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/401Proline; Derivatives thereof, e.g. captopril
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4151,2-Diazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41961,2,4-Triazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/14Prodigestives, e.g. acids, enzymes, appetite stimulants, antidyspeptics, tonics, antiflatulents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/08Antiepileptics; Anticonvulsants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/12Ophthalmic agents for cataracts
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/08Vasodilators for multiple indications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/04Endocrine or metabolic disorders
    • G01N2800/042Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2814Dementia; Cognitive disorders
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2835Movement disorders, e.g. Parkinson, Huntington, Tourette
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2857Seizure disorders; Epilepsy
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2871Cerebrovascular disorders, e.g. stroke, cerebral infarct, cerebral haemorrhage, transient ischemic event

Abstract

The present invention provides methods for identification of Glucagon-like Peptide-1 (GLP-1) secretagogues which comprise determining whether a test compound has the activity of a G protein-coupled receptor 119 (GPR119) agonist. Such methods may also comprise determining whether a GPR119 agonist stimulates GLP-1 secretion. Also provided are methods for formulating compositions for stimulating GLP-1 secretion from compounds identified by the methods of this invention.

Description

I

COMBINATION THERAPY FOR THE TREATMENT OF DIABETES AND CONDITIONS
RELATED THERETO AND FOR THE TREATMENT OF CONDITIONS AMELIORATED

FIELD OF THE INVENTION
The present invention relates to compositions and methods for treating or preventing diabetes and conditions related thereto. The present invention further relates to compositions and methods for increasing a blood GLP-1 level in a mammal. The present invention also relates to methods of using a G protein-coupled receptor to screen for GLP-1 secretagogues.

BACKGROUND OF THE INVENTION
The following discussion is intended to facilitate the understanding of the invention, but is not intended nor admitted to be prior art to the invention.
A. Diabetes Type 2 diabetes is one of the most common chronic diseases. Type 2 diabetes is characterized by fasting and postprandial hyperglycemia and by relative insulin insufficiency.
Hyperglycemia may cause long-term microvascular and macrovascular complications, such as nephropathy, neuropathy, retinopathy, and peripheral vascular disease. In addition, Type 2 diabetes is a comorbid disease that frequently compounds hyperlipidemia, atherosclerosis and hypertension.
Hyperlipidemia is a primary risk factor for cardiovascular disease due to atherosclerosis. Obesity is a well known common risk factor for the development of atherosclerosis, stroke, hypertension and Type 2 diabetes. Type 2 diabetes causes significant morbidity and mortality at considerable expense to patients, their families and society. The incidence of Type 2 diabetes in the United States is about 7%
and accounts for as much as 10% of all health care dollars. Furthermore, the incidence of Type 2 diabetes worldwide is increasing such that Type 2 diabetes is now considered to be a worldwide epidemic.
B. Glucagon-Like Peptide-1 (GLP-1) Glucagon-like peptide-1 (GLP-1) is an incretun hormone derived from the posttranslaltional modification of proglucagon and secreted by gut endocrine cells. GLP-1 mediates its actions through a specific G protein-coupled receptor (GPCR), namely GLP-1R. GLP-1 is best characterized as a hormone that regulates glucose homeostasis. GLP-1 has been shown to stimulate glucose-dependent insulin secretion and to increase pancreatic beta cell mass. GLP-1 has also been shown to reduce the rate of gastric emptying and to promote satiety. The efficacy of GLP-1 peptide agonists in controlling blood glucose in Type 2 diabetics has been demonstrated in several clinical studies [see, e.g., Natick et al., Drug News Perspect (2003) 16:413-422], as has its efficacy in reducing body mass [Zander et al., Lancet (2002) 359:824-830].

GLP-1 receptor agonists are additionally useful in protecting against myocardial infarction and against cognitive and neurodegenerative disorders. GLP-1 has been shown to be cardioprotective in a rat model of myocardial infarction [Bose et al., Diabetes (2005) 54:146-151], and GLP- I R has been shown in rodent models to be involved in learning and neuroprotection [During et al., Nat Med (2003) 9:1173-1179; and Greig et al., Ann N Y Acad Sci (2004) 1035:290-315].
Certain disorders such as Type 2 diabetes are characterized by a deficiency in GLP-1 [see, e.g., Nauck et al., Diabetes (2004) 53 Suppl 3:S 190-196].
Current GLP-1 peptide agonists suffer from a lack of oral bioavailability, negatively impacting patient compliance. Efforts to develop orally bioavailable non-peptidergic, small-molecule agonists of GLP-1R have so far been unsuccessful [Mentlein, Expert Opin Investig Drugs (2005) 14:57-64]. An attractive alternative approach is to develop an orally active composition for increasing an endogenous level of GLP-1 in the blood.
C. GPR119 GPR119 G protein-coupled receptor (GPR 119; e.g., human GPR 119, GenBank Accession No.
AAP72125 and alleles thereof; e.g., mouse GPR119, GenBank Accession No.
AY288423 and alleles thereof) is selectively expressed on pancreatic beta cells. GPR119 activation leads to elevation of a level of intracellular cAMP, consistent with GPRI 19 being coupled to Gs. Agonists to GPR119 stimulate glucose-dependent insulin secretion in vitro and lower an elevated blood glucose level in vivo. See, e.g., International Applications WO 04/065380, WO 04/076413, and EP 1338651. In the patent literature, GPR119 has been referred to as RUP3 (see, e.g., International Application WO
00/31258).
D. Dipeptidyl Peptidase IV (DPP-IV) Dipeptidyl peptidase IV (DPP-IV, EC 3.4.14.5) exhibits catalytic activity against a broad range of peptide substrates that includes peptide hormones, neuropeptides, and chemokines. The incretins glucagon-like peptide I (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP), which stimulate glucose-dependent insulin secretion and otherwise promote blood glucose homeostasis, are rapidly cleaved by DPP-IV at the position 2 alanine leading to inactivation of their biological activity.
Both pharmacological and genetic attenuation of DPP-IV activity is associated with enhanced incretin action, increased insulin, and lower blood glucose in vivo. Genetic attenuation of DPP-IV activity has been shown to provide resistance to obesity and to improve insulin sensitivity. A second-generation DPP-N inhibitor, LAF237 (Ahren et al., J Clin Endocrinol Metab (2004) 89:2078-2084; and Villhauer et al., J Med Chem (2003) 46:2774-2789), is currently in phase 3 clinical trials for Type 2 diabetes and additional DPP-IV inhibitors are in clinical development, including MK-0431, BMS-477118, PSN-9301 and SYR-322.
Because the incretin hormones are not the only substrates for DPP-IV, there is concern that inhibition of the cleavage of other endogenous DPP-IV substrates may give rise to undesirable side effects [see, e.g., Chen et at, J Biol Regul Homeost Agents (2004) 18:47-54].
It therefore would be advantageous to identify an activity promoting blood glucose homeostasis which is associated with substantially lower concentrations of DPP-IV inhibitor.
E. G Protein-Coupled Receptors GPCRs share a common structural motif, having seven sequences of between 22 to hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane-I (TM-1), transmembrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively).
The transmembrane helices are also joined by strands of amino acids between transmembrane-1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and IC-3), respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" ("N") terminus of the receptor lies in the extracellular space outside of the cell.
Generally, when an agonist binds to a G protein-coupled receptor (often referred to as "activation" of the receptor), there is a change in the conformation of the receptor that facilitates coupling between the intracellular region and an intracellular "G-protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins may exist, currently, Gq, Gs, Gi, Gz and Go are G proteins that have been identified. Ligand-activated GPCR coupling with the G-protein initiates a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition.
Gs stimulates the enzyme adenylyl cyclase. Gi (and Gz and Go), on the other hand, inhibit adenylyl cyclase . Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, activated GPCRs that couple the Gs protein are associated with increased cellular levels of cAMP.
On the other hand, activated GPCRs that couple Gi (or Gz, Go) protein are associated with decreased cellular levels of cAMP. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3`d Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992).
Thus, assays that detect cAMP can be utilized to determine if a candidate compound is, e.g., an agonist to the receptor (i.e., such a compound would increase the levels of cAMP). Gq and Go are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP2, releasing two intracellular messengers: diacyclglycerol (DAG) and inositol 1,4,5-triphosphate (IP3). Increased accumulation of 1P3 is associated with activation of Gq- and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3rd Ed.) Nichols, .1 G. et al eds. Sinauer Associates, Inc. (1992). Assays that detect IP3 accumulation can be utilized to determine if a candidate compound is, e,g., an agonist to a Gq- or Go-associated receptor (i.e., such a compound would increase the levels of 1P3). Assay that detect the level of intracellular free calcium can also be utilized to determine if a candidate compound is, e.g., an agonist to a Gq or Go-associated receptor (i.e., such a compound would increase the levels of intracellular free calcium) See, e.g., Table A ("N/A": "not applicable").
TABLE A
Effect on cAMP Effect on IP3 Effect on Production upon Accumulation cAMP
Activation of upon Activation Production Effect on IP3 G GPCR (Le., of GPCR (i.e., upon contact Accumulation upon protein constitutive constitutive with an contact with an activation or activation or Inverse Inverse Agonist agonist binding) agonist binding Agonist Gs Increase N/A Decrease N/A
Gi Decrease N/A Increase N/A
Gz Decrease N/A Increase N/A
Go Decrease Increase Increase Decrease Gq N/A Increase N/A Decrease There are also promiscuous G proteins, which appear to couple several classes of GPCRs to the phospholipase C pathway, such as Ga15 or Ga16 [Offermanns & Simon, 7 Biol Chem (1995) 270:15175-80], or chimeric G proteins designed to couple a large number of different GPCRs to the same pathway, e.g. phospholipase C [Milligan & Rees, Trends in Pharmaceutical Sciences (1999) 5 20:118-24].
Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active" state. A
receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response, Changing the receptor conformation to the active state allows 0 linkage to the transduction pathway (via the G-protein) and produces a biological response.
A receptor may be stabilized in an active state by a ligand or a compound such as a drug.
Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor, provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by 5 simulating the effect of a ligand binding to the receptor. Stabilization by such ligand-independent means is termed "constitutive receptor activation." An endogenous receptor exhibiting activity in the absence of ligand is referred to as a constitutively active endogenous receptor.

Various embodiments of this invention pertain to a method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising: (a) contacting a test compound with a host cell or with a membrane of a host cell that expresses a G protein-coupled receptor, wherein the G protein-coupled receptor comprises an amino acid sequence selected from the group 5 consisting of. (i) amino acids 1-335 of SEQ ID NO:2; (ii) amino acids 2-335 of SEQ ID NO:2;
(iii) amino acids 2-335 of SEQ ID NO:2, with the proviso that the G protein-coupled receptor does not comprise the amino acid sequence of SEQ ID NO:2; (iv) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence being the sequence obtained by a process comprising performing polymerase chain reaction (PCR) on a human DNA sample using specific primers having the sequence set forth in SEQ ID NO:3 and SEQ ID NO:4; (v) the amino acid sequence of a G
protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO: 1; and (vi) a fragment of any one of (i) to (v) having a biological activity of G Protein-Coupled Receptorl 19 (GPR119); and (b) determining ability of the test compound to stimulate functionality of the G protein-coupled receptor by:
measurement of a level of a second messenger selected from the group consisting of cyclic AMP
(cAMP), cyclic GMP (cGMP), inositol 1,4,5-triphosphate (IP3), diacylglycerol (DAG), MAP
kinase activity, MAPKIERK kinase kinase-1 (MEKKI) activity, and Ca2+; a Melanophore assay; or measurement of GTP7S binding to a membrane comprising said G protein-coupled receptor; (c) contacting the test compound which stimulates functionality of the G protein-coupled receptor in step (b) with a mammalian enteroendocrine cell in vitro; and (d) determining whether the test compound which stimulates functionality of the G protein-coupled receptor in step (b) stimulates GLP-1 secretion from the mammalian enteroendocrine cell, wherein ability of the test compound to stimulate GLP-l secretion from the mammalian enteroendocrine cell is indicative of the test compound being a GLP-1 secretagogue.

Various embodiments of this invention pertain to a method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising: (a) contacting a test compound with a host cell or with a membrane of a host cell that expresses a G protein-coupled receptor, wherein the G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of. (i) amino acids 1-335 of SEQ ID NO:2; (ii) amino acids 2-335 of SEQ ID NO:2;

5a (iii) amino acids 2-335 of SEQ ID NO:2, with the proviso that the G protein-coupled receptor does not comprise the amino acid sequence of SEQ ID NO:2; (iv) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence being the sequence obtained by a process comprising performing polymerase chain reaction (PCR) on a human DNA sample using specific primers having the sequence set forth in SEQ ID NO:3 and SEQ ID NO:4; (v) the amino acid sequence of a G
protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO: 1; and (vi) a fragment of any one of (i) to (v) having a biological activity of G Protein-Coupled Receptorl19 (GPR119); and (b) determining the ability of the test compound to stimulate functionality of the receptor by: measurement of a level of a second messenger selected from the group consisting of cyclic AMP (cAMP), cyclic GMP
(cGMP), inositol 1,4,5-triphosphate (IP3), diacylglycerol (DAG), MAP kinase activity, MAPK/ERK
kinase kinase-1 (MEKK1) activity, and Ca2+; a Melanophore assay; or measurement of GTPyS
binding to a membrane comprising said G protein-coupled receptor; (c) administering the test compound which stimulates functionality of the G protein- coupled receptor in step (b) to a mammal; and (d) determining whether the test compound which stimulates functionality of the G protein-coupled receptor in step (b) increases a blood GLP-1 level in the mammal, wherein the ability of the test compound to increase a blood GLP-1 level in the mammal is indicative of the test compound being a GLP-1 secretagogue.
Various embodiments of this invention pertain to a method of identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising: (a) contacting a G Protein-Coupled Receptor! 19 (GPR119) agonist with a mammalian enteroendocrine cell in vitro;
and (b) determining whether the GPR119 agonist stimulates GLP-1 secretion from the mammalian enteroendocrine cell; wherein ability of the GPR119 agonist to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the agonist being a GLP- I
secretagogue.
Various embodiments of this invention pertain to a method of identifying a Glucagon-like Peptide-l (GLP-1) secretagogue, comprising: (a) administering a G Protein-Coupled Receptorl 19 (GPR119) agonist to a mammal; and (b) determining a blood GLP-1 level in a biological sample obtained from the mammal, wherein the ability of the GPR119 agonist to 5b increase a blood GLP-1 level in the mammal is indicative of the agonist being a GLP-1 secretagogue.
Various embodiments of this invention pertain to a method of identifying Glucagon-like Peptide-1 (GLP-1) secretagogues comprising: determining a blood GLP-l level in a biological sample obtained from a mammal, said mammal having been administered with a G
Protein-Coupled Receptorl 19 (GPR119) agonist; wherein ability of the GPR119 agonist to increase a blood GLP-1 level in the mammal is indicative of the agonist being a GLP-1 secretagogue.
Various embodiments of this invention pertain to a method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising: (a) contacting a G protein-coupled receptor with a ligand to the G protein-coupled receptor in the presence of a test compound, wherein said G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of. (i) amino acids 1-335 of SEQ ID NO:2; (ii) amino acids 2-335 of SEQ ID NO:2;
(iii) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO:1; and (iv) a fragment of any one of (i) to (iii) having a biological activity of G Protein-Coupled Receptorl 19 (GPR119);
and (b) detecting a complex between the G protein-coupled receptor and the ligand; and (c) determining whether less of said complex is formed in the presence of the test compound than in the absence of the test compound; (d) contacting the test compound in the presence of which less of said complex is formed in step (c) with a mammalian enteroendocrine cell in vitro; and (e) determining whether the test compound in the presence of which less of said complex is formed in step (c) stimulates GLP-l secretion from the mammalian enteroendocrine cell, wherein ability of the test compound to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the test compound being a GLP-1 secretagogue.

Various embodiments of this invention pertain to a method for identifying a Glucagon-like Peptide-l (GLP-1) secretagogue, comprising: (a) contacting a G protein-coupled receptor with a ligand to the G protein-coupled receptor in the presence of a test compound, wherein said G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of. (i) amino acids 1-335 of SEQ ID NO: 2; (ii) amino acids 2-335 of SEQ ID NO:2;
(iii) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent 5c conditions to the complement of the sequence set forth in SEQ ID NO:1; and (iv) a fragment of any one of (i) to (iii) having a biological activity of G Protein-Coupled Receptorl 19 (GPR119);
and (b) detecting a complex between the G protein-coupled receptor and the ligand; and (c) determining whether less of said complex is formed in the presence of the test compound than in the absence of the test compound; (d) determining blood GLP-1 level in a biological sample obtained from a mammal, said mammal having been administered with the test compound in the presence of which less of said complex is formed in step (c), wherein the ability of the test compound to increase blood GLP-1 level in the mammal is indicative of the test compound being a GLP-1 secretagogue.
Various embodiments of this invention pertain to a method of preparing a composition comprising a GPR119 agonist having the effect of a GLP-1 secretagogue, the method comprising: (a) contacting a G Protein-Coupled Receptorl 19 (GPR119) agonist in vitro with a mammalian enteroendocrine cell; and (b) determining whether the GPR119 agonist stimulates GLP-1 secretion from the mammalian enteroendocrine cell wherein the ability of the GPRI 19 agonist to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the agonist being a GLP-1 secretagogue; and (c) formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.

Various embodiments of this invention pertain to a method of preparing a pharmaceutical composition comprising a G Protein-Coupled Receptorl 19 (GPR119) agonist having the effect of a GLP-1 secretagogue, the GPR119 agonist having been contacted in vitro with a mammalian enteroendocrine cell and determined to stimulate GLP-1 secretion from the mammalian enteroendocrine cell, wherein the ability of the GPR119 agonist to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the agonist being a GLP-1 secretagogue, the method comprising formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.

Various embodiments of this invention pertain to a method of preparing a composition comprising a G Protein-Coupled Receptorl 19 (GPRI 19) agonist having the effect of a GLP-1 secretagogue, the method comprising: (a) determining a blood GLP-1 level in a biological sample obtained from a mammal, the mammal having been administered with a agonist; wherein the ability of the GPR119 agonist to increase a blood GLP-1 level in the 5d mammal is indicative of the agonist being a GLP-1 secretagogue; and (b) formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.
Various embodiments of this invention pertain to a method of preparing a pharmaceutical composition comprising a G Protein-Coupled Receptorl 19 (GPR119) agonist having the effect of a GLP-l secretagogue, the GPR119 agonist having been administered to a mammal and determined to increase a blood GLP-1 level in the mammal, wherein the ability of GPRI19 agonist to increase a blood GLP-1 level is indicative of the agonist being a GLP-l secretagogue, the method comprising formulating the GPR1 19 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.
Various embodiments of this invention pertain to a GPR1 19 agonist for use in increasing blood GLP-1 level in a mammal to treat a myocardial infarction or a neurodegenerative disorder in a patient that is not diabetic.
Various embodiments of this invention pertain to a GPR119 agonist for use in increasing blood GLP-1 level in a mammal to treat a condition not associated with diabetes, wherein the condition is: excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, stroke, motor-neuron disease, learning or memory impairment, traumatic brain injury, spinal cord injury, or peripheral neuropathy.

Various embodiments of this invention pertain to a GPRI19 agonist for use in increasing blood GLP-1 level to promote satiety to regulate undesirable weight gain not associated with diabetes.
The present invention concerns combination of an amount of a GPR119 agonist with an amount of a dipeptidyl peptidase IV (DPP-IV) inhibitor such that the combination provides an effect in lowering a blood glucose level in a subject over that provided by the amount of the GPR119 agonist or the amount of the DPP-IV inhibitor alone and the use of such a combination for treating or preventing diabetes and conditions related thereto. The present invention further concerns combination of an amount of a GPR119 agonist with an amount of a dipeptidyl peptidase IV (DPP-IV) inhibitor such that the combination provides an effect in increasing a blood GLP-l level in a subject over that provided by the amount of the GPR119 agonist or the amount of the DPP-IV inhibitor alone and the use of such a combination for treating or preventing a condition ameliorated by increasing a blood GLP-1 level or for increasing a blood 5e GLP-1 level in a subject deficient in GLP-1. The present invention also relates to methods of using GPR119 G protein-coupled receptor to screen for GLP-1 secretagogues.
In a first aspect, the present invention features a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor. In certain embodiments, the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to lower a blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
The present invention additionally features a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor. In certain embodiments, the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to increase a blood GLP-1 level in the subject.
The present invention additionally features a method of increasing a blood GLP-1 level comprising administering to a subject deficient in GLP-1 a therapeutically effective amount of a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV
inhibitor. In certain embodiments, the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to increase a blood GLP-1 level in the subject.
In certain embodiments, diabetes is Type 2 diabetes.
In certain embodiments, the condition related to diabetes is selected from the group consisting of hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity.
In certain embodiments, the condition ameliorated by increasing a blood GLP-1 level is selected from the group consisting of diabetes, a condition related to diabetes, myocardial infarction, learning impairment, memory impairment, and a neurodegenerative disorder.
In certain embodiments, the condition ameliorated by increasing a blood GLP-1 level is a neurodegenerative disorder selected from the group consisting of excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, stroke, motor-neuron disease, learning or memory impairment, traumatic brain injury, spinal cord injury, and peripheral neuropathy.
In certain embodiments, the subject is a human.
in a second aspect, the present invention features a composition comprising or consisting essentially of a GPR119 agonist and a DPP-1V inhibitor. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPRI 19 agonist and the DPP-IV
inhibitor are in amounts sufficient to lower a blood glucose level in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPRI
19 agonist and the DPP-IV inhibitor are in amounts sufficient to increase a blood GLP-l level in a subject.
In certain embodiments, the subject is a human.
In a third aspect aspect, the present invention features a composition comprising or consisting essentially of a GPRI 19 agonist and a DPP-1V inhibitor for use in a method of treatment of the human or animal body by therapy. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower a blood glucose level in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase a blood GLP-i level in a subject.
The present invention additionally features a composition comprising or consisting essentially of a GPRI19 agonist and a DPP-IV inhibitor for use in a method of treatment or prevention of diabetes or a condition related thereto of the human or animal body by therapy. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPR1 19 agonist and the DPP-IV inhibitor are in amounts sufficient to lower a blood glucose level in a subject, In certain embodiments, the blood glucose level is an elevated blood glucose level.
The present invention additionally features a composition comprising or consisting essentially of a GPRI 19 agonist and a DPP-IV inhibitor for use in a method of treatment or prevention of a condition ameliorated by increasing a blood GLP-1 level of the human or animal body by therapy. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase a blood GLP-1 level in a subject.
The present invention additionally features a composition comprising or consisting essentially of a GPRI 19 agonist and a DPP-1V inhibitor for use in a method of treatment or prevention of a deficiency of GLP-1 of the human or animal body by therapy. In certain embodiments, the present invention relates to a dosage form of the composition wherein the GPR119 agonist and the DPP-IV
i inhibitor are in amounts sufficient to increase a blood GLP-1 level in a subject.
In certain embodiments, the subject is a human.
In a fourth aspect, the present invention features a method of preparing a pharmaceutical composition, said method comprising or consisting essentially of admixing a GPRI19 agonist and a DPP-IV inhibitor, together with at least one pharmaceutically acceptable carrier. In certain embodiments, the method further comprises the step of preparing a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower a blood glucose level in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the method further comprises the step of preparing a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-1V
inhibitor are in amounts sufficient to increase a blood GLP-1 level in a subject.
In certain embodiments, the subject is a human.
In a fifth aspect aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV
inhibitor, together with at least one pharmaceutically acceptable carrier. In certain embodiments, the present invention relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to lower a blood glucose level in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the present invention relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase a blood GLP-1 level in a subject.
In certain embodiments, the subject is a human.
In a sixth aspect, the present invention features a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition in accordance with the fifth aspect. In certain embodiments, the GPRI 19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to lower a blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
The present invention additionally features a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition in accordance with the fifth aspect.
In certain embodiments, the GPRI19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to increase a blood GLP-1 level in the subject.
The present invention additionally features a method of increasing a blood GLP-1 level comprising administering to a subject deficient in GLP-l a therapeutically effective amount of a pharmaceutical composition in accordance with the fifth aspect. In certain embodiments, the GPRI 19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to increase a blood GLP-l level in the subject.
In certain embodiments, the subject is a human.
In a seventh aspect, the present invention features use of a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor for the manufacture of a medicament for the treatment or prevention of diabetes or a condition related thereto. In certain embodiments, the present invention relates to a dosage form of the medicament wherein the GPR1 19 agonist and the DPP-IV inhibitor are in amounts sufficient to lower a blood glucose level in a subject.
In certain embodiments, the blood glucose level is an elevated blood glucose level.
The present invention additionally features use of a composition comprising or consisting essentially of a GPR1 19 agonist and a DPP-IV inhibitor for the manufacture of a medicament for the treatment or prevention of a condition ameliorated by increasing a blood GLP-1 level. In certain embodiments, the present invention relates to a dosage form of the medicament wherein the GPRI 19 agonist and the DPP-IV inhibitor are in amounts sufficient to increase a blood GLP-1 level in a subject.
The present invention additionally features use of a composition comprising or consisting essentially of a GPRI 19 agonist and a DPP-IV inhibitor for the manufacture of a medicament for the treatment or prevention of a deficiency of GLP-1. In certain embodiments, the present invention relates to a dosage form of the medicament wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase a blood GLP-1 level in a subject.
In certain embodiments, the subject is a human.
5 In an eighth aspect, the invention features a method for identifying GLP-i secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level, comprising the steps of:
(a) contacting a test compound with a host cell or with membrane of a host cell that expresses a G protein-coupled receptor, wherein the G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of (i) amino acids 1-335 of SEQ ID NO:2;
(ii) amino acids 2-335 of SEQ ID NO:2;
(iii) amino acids 2-335 of SEQ ID NO:2, with the proviso that the receptor does not comprise the amino acid sequence of SEQ ID NO:2;
5 (iv) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence being the sequence obtainable by a process comprising performing polymerase chain reaction (PCR) on a human DNA sample using specific primers SEQ ID NO:3 and SEQ ID NO:4;
(v) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of SEQ ID NO: I;
and (vi) a biologically active fragment of any one of (i) to (v); and (b) determining the ability of the test compound to stimulate functionality of the receptor;
wherein the ability of the test compound to stimulate functionality of the receptor is indicative of the test compound being a GLP-1 secretagogue or a compound useful for preventing or treating a condition ameliorated by increasing a blood GLP-1 level.
The invention additionally features a method for identifying GLP-1 secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-I
level, comprising steps (a) and (b) of this eighth aspect, and further comprising:
(c) contacting a compound which stimulates functionality of the receptor in step (b) in vitro with a mammalian enteroendocrine cell; and (d) determining whether the compound stimulates GLP-1 secretion from the mammalian enteroendocrine cell;
wherein the ability of the test compound to stimulate GLP-1 secretion from the mammalian 0 enteroendocrine cell is indicative of the test compound being a GLP-1 secretagogue or a compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level.
The invention additionally features a method for identifying GLP-1 secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level, comprising steps (a) and (b) of this eighth aspect, and further comprising:
5 (c) administering a compound which stimulates functionality of the receptor in step (b) to a mammal; and (d) determining whether the compound increases a blood GLP-1 level in the mammal;
wherein the ability of the test compound to increase a blood GLP-1 level in the mammal is indicative of the test compound being a GLP-1 secretagogue or a compound useful for treating or preventing a 0 condition ameliorated by increasing a blood GLP-1 level. In certain embodiments, the mammal is a non-human mammal.
In certain embodiments, the identified GLP-1 secretagogue or the identified compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level is an agonist of the receptor. In some embodiments, the agonist is a partial agonist.
5 In certain embodiments, the receptor is coupled to a G protein. In certain embodiments, the G
protein is Gs.
In certain embodiments, the human DNA sample is human genomic DNA.

In certain embodiments, the process is RT-PCR (reverse transcription-polymerase chain reaction). RT-PCR techniques are well known to the skilled artisan.
In certain embodiments, the human DNA sample is human cDNA. In certain embodiments, the cDNA is from a human tissue that expresses GPR1 19. In some embodiments, the human tissue that expresses GPRI19 is pancreas, pancreatic islet, colon, small intestine, or fetal liver. In certain embodiments, the cDNA is from a human cell type that expresses GPRI 19. In some embodiments, the cDNA is from a pancreatic beta cell line or an enteroendocrine cell line.
In certain embodiments, stringent hybridization conditions comprise hybridization at 42 C in a solution comprising 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50mM
sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20gg/ml denatured, sheared salmon sperm DNA, followed by washing at 65 C in a solution comprising 0.IxSSC.
Hybridization techniques are well known to the skilled artisan.
In certain embodiments, the G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to 5 the complement of SEQ ID NO: 1, exhibits a biological activity selected from the group consisting of increasing a level of intracellular cAMP and binding a known ligand of GPR1 19. In certain embodiments, the encoded G protein-coupled receptor increases a level of intracellular cAivIP and binds a known ligand of GPR1 19.
In some embodiments, the G protein-coupled receptor is part of a fusion protein comprising a 3 G protein. Techniques for making a GPCR:G fusion construct are well known to the skilled artisan (see, e.g., International Application WO 02/42461).
In some embodiments, the G protein-coupled receptor is recombinant.
In certain embodiments, the host cell comprises an expression vector, said expression vector comprising a polynucleotide encoding the G protein-coupled receptor. In some embodiments, the 5 expression vector is pCMV. This vector was deposited with the American Type Culture Collection (ATCC) on October 13, 1998 (10801 University Blvd., Manassas, VA 20110-2209 USA) under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. The DNA was tested by the ATCC and determined to be viable.
The ATCC has assigned the following deposit number to pCMV: ATCC #203351.
Other suitable D expression vectors will be readily apparent to those of ordinary skill in the art, and a wide variety of expression vectors are commercially available (e.g., from Clontech, Palo Alto, CA; Stratagene, La Jolla, CA; and Invitrogen, Carlsbad, CA).
In some embodiments, the host cell is mammalian. In some embodiments, the mammalian host cell is selected from the group consisting of 293, 293T, CHO, MCB390I, and COS-7. In some 5 embodiments, the host cell is melanophore. In some embodiments, the host cell is an enteroendocrine cell. In some embodiments, the enteroendocrine cell is GLUTag-Fro cell line.
Other suitable host cells will be readily apparent to those of ordinary skill in the art, and a wide variety of cell lines are available from the American Type Culture Collection, 10801 University Boulevard, Manassas, VA
20110-2209.
In certain embodiments, said determining is consistent with the G protein-coupled receptor being a Gs-coupled receptor.
In some embodiments, said determining is consistent with the G protein-coupled receptor being coupled through a promiscuous G protein, such as Gu15 or Ga16, to the phopholipase C
pathway. Promiscuous G proteins are well known to the skilled artisan [see, e.g., Offermanns et al., J
Biol Chem (1995) 270:15175-15180]. In some embodiments, said determining is consistent with the G protein-coupled receptor being coupled through a chimeric G protein, e.g. to the phospholipase C
pathway. Chimeric G proteins are well known to the skilled artisan [see, e.g., Milligan et al., Trends in Pharmaceutical Sciences (1999) 20:118-124; and WO 02/42461].
In some embodiments, said determining is through the measurement of a level of a second messenger selected from the group consisting of cyclic AMP (cAMP), cyclic GMP
(cGMP), inositol 1,4,5-triphosphate (1P3), diacylglycerol (DAG), MAP kinase activity, MAPK/ERK
kinase kinase-1 i (MEKKl) activity, and Ca2+. In some preferred embodiments, the second messenger is cAMP. In certain preferred embodiments, a level of intracellular cAMP is elevated.
In certain embodiments, said determining is carried out with membrane comprising the G
protein-coupled receptor.
In certain embodiments, said determining is through the use of a melanophore assay. In some preferred embodiments, a level of pigment dispersion is elevated.
In some embodiments, said determining is through the measurement of an activity mediated by elevation of a level of intracellular cAMP. In some embodiments, said activity is stimulation of GLP-1 secretion.
In some embodiments, said determining is through CRE-Luc reporter assay. In some preferred embodiments, a level of luciferaseactivity is elevated.
Li some embodiments, said determining is through the measurement of GTPyS
binding to membrane comprising the G protein-coupled receptor. In some preferred embodiments, said GTPyS
is labeled with [35S]. In some preferred embodiments, said GTPyS binding to membrane comprising the GPCR is elevated.
In some embodiments, the test compound is a small molecule. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not a polypeptide. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not an antibody or an antigen-binding fragment thereof. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not a lipid. In some embodiments, the test 5 compound is a small molecule, with the proviso that the small molecule is not a polypeptide or a lipid.
In some embodiments, the test compound is a polypeptide. In some embodiments, the test compound is a polypeptide, with the proviso that the polypeptide is not an antibody or an antigen-binding fragment thereof. In some embodiments, the test compound is a lipid. In some embodiments, the test compound is not an antibody or an antigens-binding fragment thereof. In some embodiments, the test compound is an antibody or an antigen-binding fragment thereof.
In some embodiments, the method further comprises synthesizing the GLP-1 secretagogue or i the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level.
In some embodiments, the method further comprises: optionally, determining the structure of the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level; and providing the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level or providing the name or structure of the GLP-l secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level.
In some embodiments, said method further comprises: optionally, determining the structure of the GLP-l secretagogue or the compound useful for treating or preventing a condition ameliorated i by increasing a blood GLP-l level; optionally, providing the name or structure of the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level; and producing or synthesizing the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level.
In some embodiments, said method further comprises the step of formulating the secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level into a pharmaceutical composition.
In a ninth aspect, the invention features a method for identifying GLP-l secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level, comprising the steps of:
i (a) contacting a G protein-coupled receptor with an optionally labeled known ligand to the receptor in the presence or absence of a test compound, wherein the G
protein-coupled receptor comprises an amino acid sequence selected from the group consisting of:
(i) amino acids 1-335 of SEQ ID NO:2;
(ii) amino acids 2-335 of SEQ ID NO2;
(iii) amino acids 2-335 of SEQ ID NO:2, with the proviso that the receptor does not comprise the amino acid sequence of SEQ ID NO:2;
(iv) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence > being the sequence obtainable by a process comprising performing polymerase chain reaction (PCR) on a human DNA sample using specific primers SEQ ID NO:3 and SEQ ID NO:4;

(v) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of SEQ ID NO:l;
and (vi) a biologically active fragment of any one of (i) to (v); and (b) detecting the complex between said known ligand and said receptor; and (c) determining whether less of said complex is formed in the presence of the test compound than in the absence of the test compound;
wherein said determination is indicative of the test compound being a GLP-1 secretagogue or a compound useful for preventing or treating a condition ameliorated by increasing a blood GLP-1 level.
In certain embodiments, the optionally labeled known ligand is a labeled known ligand. In certain embodiments, the labeled known ligand is a radiolabeled known ligand.
Techniques for radiolabeling a compound, such as for labeling a known ligand of a G protein-coupled receptor of the invention, are well known to the skilled artisan. See, e.g., International Application WO 04/065380.
Techniques for detecting the complex between a G protein-coupled receptor and a compound known to be a ligand of the G protein-coupled receptor are well known to the skilled artisan. See, e.g., International Application WO 04/065380.
The invention additionally features a method for identifying GLP-1 secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level, comprising steps (a) to (c) of this ninth aspect, and further comprising:
(d) contacting a compound in the presence of which less of said complex is formed in step (c) in vitro with a mammalian enteroendocrine cell; and (e) determining whether the compound stimulates GLP-1 secretion from the mammalian enteroendocrine cell;
wherein the ability of the test compound to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the test compound being a GLP-1 secretagogue or a compound useful for treating or preventing a condition ameliorated by increasing a blood,GLP-I
level.
The invention additionally features a method for identifying GLP-1 secretagogues or compounds useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level, comprising steps (a) to (c) of this ninth aspect, and further comprising:
(d) administering a compound in the presence of which less of said complex is formed in step (c) to a mammal; and (e) determining whether the compound increases a blood GLP-1 level in the mammal;

wherein the ability of the test compound to increase a blood GLP-1 level in the mammal is indicative of the test compound being a GLP-1 secretagogue or a compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level. In certain embodiments, the mammal is a non-human mammal.
In certain embodiments, the receptor is recombinant.
In some embodiments, the test compound is a small molecule. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not a polypeptide. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not an antibody or an antigen-binding fragment thereof. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not a lipid. In some embodiments, the test compound is a small molecule, with the proviso that the small molecule is not a polypeptide or a lipid, In some embodiments, the test compound is a polypeptide. In some embodiments, the test compound is a polypeptide, with the proviso that the polypeptide is not an antibody or an antigen-binding fragment thereof. In some embodiments, the test compound is a lipid. In some embodiments, the test i compound is not an antibody or an antigen-binding fragment thereof. In some embodiments, the test compound is an antibody or an antigen-binding fragment thereof.
In some embodiments, the method further comprises synthesizing the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level.
In some embodiments, the method further comprises: optionally, determining the structure of the GLP-l secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-l level; and providing the GLP-l secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level or providing the name or structure of the GLP-1 secretagogue or the compound useful for treating or preventing a 5 condition ameliorated by increasing a blood GLP-1 level.
In some embodiments, said method further comprises: optionally, determining the structure of the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level; optionally, providing the name or structure of the GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level; and producing or synthesizing the GLP-l secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level.
In some embodiments, said method further comprises the step of formulating the. GLP-1 secretagogue or the compound useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level into a pharmaceutical composition.

This application is related to the United States patent application published as US2006/0154866, which contains information related to this invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is illustrated in connection with the figures appended hereto in which: FIG'S.
5 1A-1D are graphs showing a synergistic effect of GPR119 agonist and DPP-IV
inhibitor in lowering an elevated blood glucose level in oral glucose tolerance test (oGTT) in mice.
See Example 1.
FIG. 2 shows a synergistic effect of GPRI 19 agonist and DPP-IV inhibitor in increasing a blood GLP-1 level after glucose challenge in mice. See Example 3.
FIG. 3 shows expression of GPR119 in gut. See Example 10.
10 FIG. 4 shows expression of GPR119 in GLUTag enteroendocrine cell line. See Example 11.
FIG. 5 shows elevation of the level of intracellular cAMP in GLUTag enteroendocrine cells by GPRI 19 agonist. See Example 12.
FIG. 6 shows stimulation of GLP-l secretion in GLUTag enterendocrine cells by agonist. See Example 13.
15 FIG'S. 7A & 7B are graphs showing an effect of GPR119 agonist AR244061 and DPP-IV
inhibitor MK-0431 in lowering blood glucose level in oral glucose tolerance test (oGTT) in mice. See Example 14.
FIG'S. 8A & 8B are graphs showing an effect of GPR1 19 agonist AR244061 and DPP-IV
inhibitor LAF237 in lowering blood glucose level in oral glucose tolerance test (oGTT) in mice. See Example 14.
FIG'S. 9A & 9B are graphs showing an effect of GPRI 19 agonist AR244061 and DPP-IV
inhibitor FE107542 in lowering blood glucose level in oral glucose tolerance test (oGTT) in mice. See Example 14.
DETAILED DESCRIPTION OF THE INVENTION
This invention is concerned with the combination of certain compounds, or pharmaceutically acceptable salts thereof, for the treatment or prevention of diabetes and conditions related thereto. This invention is further concerned with the combination of certain compounds, or pharmaceutically acceptable salts thereof, for the treatment or prevention of a condition ameliorated by increasing a blood GLP-1 level. Applicant has found that an amount of a GPR119 agonist in combination with an amount of a DPP-IV inhibitor can provide an unexpected synergistic effect in lowering a blood glucose level in a subject over that provided by the amount of the GPRI 19 agonist alone or by the amount of the DPP-IV inhibitor alone. Applicant has additionally found that an amount of a GPR119 agonist in combination with an amount of a DPP-IV inhibitor can provide an unexpected synergistic effect in increasing a blood GLP-1 level in a subject over that provided by the amount of the GPR119 agonist alone or by the amount of the DPP-IV inhibitor alone. Applicant has additionally discovered that GPR119 is a GLP-l secretagogue receptor.
By the use of a combination of a GPRI 19 agonist and a DPP-IV inhibitor in accordance with the present invention, it is possible to treat or prevent diabetes and conditions related thereto with a dose of a DPP-IV inhibitor substantially lower than that currently contemplated for use in therapy for diabetes and conditions related thereto, thereby reducing the likelihood of unwanted side-effects associated with inhibition of DPP-IV activity. By the use of a combination of a GPRI 19 agonist and a DPP-N inhibitor in accordance with the present invention, it is possible to treat or prevent a condition ameliorated by increasing a blood GLP-1 level with a dose of a DPP-IV inhibitor 0 substantially lower than that currently contemplated for use in therapy for said condition, thereby reducing the likelihood of unwanted side-effects associated with inhibition of DPP-IV activity.
Furthermore, by the use of a combination of a GPR119 agonist and a DPP-IV
inhibitor in accordance with the present invention, it is possible to treat or prevent diabetes and conditions related thereto with a dose of a GPR1 19 agonist substantially lower than that currently contemplated for use in therapy for 5 diabetes and conditions related thereto, thereby reducing the likelihood of unwanted side-effects should any be found to be associated with activation of GPR119 receptor. The present invention provides a new, unexpected and advantageous approach to lowering a blood glucose level in a subject.
The present invention additionally provides a new, unexpected and advantageous approach to increasing a blood GLP-1 level in a subject.
0 The term "ligand", as used herein, shall mean a molecule that specifically binds to a GPCR.
A ligand may be, for example, a polypeptide, a lipid, a small molecule, an antibody. An endogenous ligand is a ligand that is an endogenous, natural ligand for a native GPCR. A
ligand may be a GPCR
"antagonist", "agonist", "partial agonist", or "inverse agonist", or the like.
The term "agonist", as used herein, shall mean an agent (e.g., ligand, candidate compound) 5 that by virtue of binding to a GPCR activates the GPCR so as to elicit an intracellular response mediated by the GPCR.
The term "partial agonist", as used herein, shall mean an agent (e.g., ligand, candidate compound) that by virtue of binding to a GPCR activates the GPCR so as to elicit an intracellular response mediated by the GPCR, albeit to a lesser exent or degree than does a full agonist.
0 The term "antagonist" shall mean an agent (e.g., ligand, candidate compound) that binds, and preferably binds competitively, to a GPCR at about the same site as an agonist or partial agonist but which does not activate an intracellular response initiated by the active form of the GPCR, and can thereby inhibit the intracellular response by agonist or partial agonist. An anatagonist typically does not diminish the baseline intracellular response in the absence of an agonist or partial agonist.
5 The term "inverse agonist" shall mean an agent (e.g., ligand, candidate compound) which binds to a GPCR and which inhibits the baseline intracellular response initiated by the active form of the receptor below the normal base level activity which is observed in the absence of an agonist or partial agonist.
The term "GPR119 agonist," as used herein, refers to a compound that binds to receptor and acts as an agonist.
The term "selective GPR119 agonist," as used herein, refers to a GPR119 agonist having selectivity for GPR119 receptor over one or more closely related receptors, such as corticotrophin-releasing factor-1 (CRF-1) receptor.
The term "DPP-IV inhibitor," as used herein, refers to a compound that binds to DPP-IV and inhibits DPP-IV dipeptidyl peptidase activity.
The term "selective DPP-IV inhibitor," as used herein, refers to a DPP-IV
inhibitor having selectivity for DPP-IV over closely related peptidases, such as one or more of post-proline-cleaving enzyme (PPCE), dipeptidyl peptidase II (DPP-II), dipeptidyl peptidase 8 (DPP-8), and dipeptidyl peptidase 9 (DPP-9).
The term "blood glucose level" or "blood GLP-1 level" shall mean blood glucose concentration or blood GLP-1 concentration, respectively. In certain embodiments, blood GLP-1 level is a level in blood of biologically active GLP-1, wherein GLP-1 having agonist activity at GLP-1R is biologically active. In certain embodiments, a blood glucose level or blood GLP-1 level is a plasma glucose level or a plasma GLP-l level.
The term "elevated blood glucose level" shall mean an elevated blood glucose level such as 3 that found in a subject demonstrating clinically inappropriate basal and postprandial hyperglycemia or such as that found in a subject in oral glucose tolerance test (oGTT).
The term "subject," as used herein, shall refer to a mammal, including but not limited to a mouse, a rat, a rabbit, a pig, a dog, a cat, a non-human primate and a human, more preferably to a mouse or rat, most preferably to a human.
5 The term "in need of prevention or treatment" as used herein refers to a judgement made by a caregiver (e.g. physician, nurse, nurse practitioner in the case of humans;
veterinarian in the case of non-human mammals) that a subject requires or will benefit from treatment.
The term "therapeutically effective amount" or "therapeutically effective dose" is intended to mean that amount of drug that will elicit the desired biological or medical response. In certain 0 embodiments, a therapeutically effective amount is that amount of drug which will create an ATJC
inhibition above 30% in mouse oGTT assay.
The term "therapeutically ineffective amount" or "therapeutically ineffective dose" is intended to mean an amount of drug less than the therapeutically effective amount of the drug. In certain embodiments, a therapeutically ineffective amount is an amount of drug which will create an 5 AUC inhibition less than or equal to 30% in mouse oGTT assay.
The term "amount that is effective to prevent" refers to that amount of drug that will prevent or reduce the risk of occurrence of the biological or medical event that is sought to be prevented. In many instances, the amount that is effective to prevent is the same as the therapeutically effective amount.
The term "composition" shall mean a material comprising at least one component.
The term "active ingredient" shall mean any component that provides pharmacological activity or other direct effect in the diagnosis, cure, mitigation, treatment, or prevention of disease.
The term "pharmaceutical composition" shall mean a composition comprising at least one active ingredient, whereby the composition is amenable to investigation and treatment in a mammal.
The term "dosage form" shall mean the physical form in which a drug is produced and dispensed, such as a tablet, capsule, or an injectable.
As used herein, the term "diabetes" encompasses both insulin-dependent diabetes mellitus (also known as Type 1 diabetes) and non-insulin-dependent diabetes mellitus (also known as Type 2 diabetes).
The term "condition related to diabetes" is intended to include but not be limited to hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity, where it is understood that conditions related to diabetes can be included in embodiments individually or in any combination.
The term "condition ameliorated by increasing a blood GLP-1 level" is intended to include but not be limited to diabetes, a condition related to diabetes, myocardial infarction, learning impairment, memory impairment, and a neurodegenerative disorder, where it is understood that conditions ameliorated by increasing a blood GL-P-1 level can be included in embodiments individually or in any combination.
i The term "atherosclerosis" as used lrsrein refers to a form of vascular disease characterized by the deposition of atheromatous plaques containing cholesterol and lipids on the innermost layer of the walls of large and medium-sized arteries.
The term "metabolic syndrome" as defined herein, and according to the Adult Treatment Panel III (ATP III; National Institutes of Health: Third Report of the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III), Executive Summary; Bethesda, Md., National Institutes of Health, National Heart, Lung and Blood Institute, 2001 (NIH pub. No 01-3670), occurs when a person meets three or more of five criteria related to obesity, hypertriglyceridemia, low HDL cholesterol, high blood pressure, and high fasting glucose.
The term "neurodegenerative disorder" is intended to include but not be limited to excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, stroke, motor-neuron disease, learning or memory impairment, traumatic brain injury, spinal cord injury, and peripheral neuropathy.
The term "obesity," as used herein, is defined as a body mass index (BMI) of 30.0 or greater, in accordance with the WHO classifications of weight [Kopelman, Nature (2000) 404:635-643].
The term "C1.5 acyl" denotes a C1_5 alkyl radical attached to a carbonyl wherein the definition of alkyl has the same definition as described herein; some examples include but not limited to, acetyl, propionyl, n-butanoyl, iso-butanoyl, sec-butanoyl, t-butanoyl (i.e., pivaloyl), pentanoyl and the like.
The term "C1.5 acyloxy" denotes an acyl radical attached to an oxygen atom wherein acyl has the same definition has described herein; some examples include but not limited to acetyloxy, propionyloxy, butanoyloxy, iso-butanoyloxy, sec-butanoyloxy, t-butanoyloxy and the like.
The term "C1.6 acylsulfonamide" refers to a C1.6 acyl attached directly to the nitrogen of the sulfonamide, wherein the definitions for C1.6 acyl and sulfonamide have the same meaning as described herein, and a C1_6 acylsulfonamide can be represented by the following formula:
OSO O
I
H C1-6 alkyl Some embodiments of the present invention are when acylsulfonamide is a C1_5 acylsulfonamide, some embodiments are C14 acylsulfonamide, some embodiments are C1_3 acylsulfonamide, and some embodiments are C1_2 acylsulfonamide. Examples of an acylsulfonamide include, but not limited to, acetylsulfamoyl [-S(=O)2NHC(=O)Me], propionylsulfamoyl [-S(=O)2NHC(=O)Et], isobutyrylsulfamoyl, butyrylsulfamoyl, 2-methyl-butyrylsulfamoyl, 3-methyl-butyrylsulfamoyl, 2,2-dimethyl-propionylsulfamoyl, pentanoylsulfamoyl, 2-methyl-pentanoylsulfamoyl, 3-methyl-pentanoylsulfamoyl, 4-methyl-pentanoylsulfamoyl, and the like.
The term "C2.6 alkenyl" denotes a radical containing 2 to 6 carbons wherein at least one carbon-carbon double bond is present, some embodiments are 2 to 4 carbons, some embodiments are 2 to 3 carbons, and some embodiments have 2 carbons. Both E and Z isomers are embraced by the term "alkenyl." Furthermore, the term "alkenyl" includes di- and tri-alkenyls.
Accordingly, if more than one double bond is present then the bonds may be all E or Z or a mixtures of E and Z. Examples of an alkenyl include vinyl, allyl, 2-butenyl, 3-butenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexanyl, 2,4-hexadienyl and the like.
The term "C14 alkoxy" as used herein denotes a radical alkyl, as defined herein, attached directly to an oxygen atom. Examples include methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, t-butoxy, iso-butoxy, sec-butoxy and the like.
The term "C1.8 alkyl" denotes a straight or branched carbon radical containing 1 to 8 carbons, some embodiments are 1 to 6 carbons, some embodiments are 1 to 3 carbons, and some embodiments are 1 or 2 carbons. Examples of an alkyl include, but not limited to, methyl, ethyl, n-propyl, iso-oropyl, n-butyl, sec-butyl, iso-butyl, t-butyl, pentyl, iso-pentyl, t-pentyl, neo-pentyl, 1-methylbutyI
[i.e., -CH(CH3)CH2CI-IZCH3], 2-methylbutyl [i.e., -CH2CH(CH3)CH2CH3], n-hexyl and the like.
The term "CI-4 alkylcarboxamido" or "CI.4 alkylcarboxamide" denotes a single C
alkyl group attached to the nitrogen of an amide group, wherein alkyl has the same definition as found 5 herein. The C1.5 alkylcarboxamido may be represented by the following:
O O
C1-a alkyl H \ H C1_4 alkyl Examples include, but not limited to, N-methylcarboxamide, N-ethylcarboxamide, N-n-propylcarboxamide, N-iso-propylcarboxamide, N-n-butylcarboxamide, N-sec-butylcarboxamide, N-iso-butylcarboxamide, N-t-butylcarboxamide and the like.
The term "CI-3 alkylene" refers to a C1.3 divalent straight carbon group. In some embodiments C1.3 alkylene refers to, for example, -CH2-, -CH2CH2-, -CH2CH2CH2-, and the like. In some embodiments, CI-3 alkylene refers to -CH-, - CHCH2-, -CHCH2CH2-, and the like wherein these examples relate generally to "A".
The term "C1_4 alkylsulfinyl" denotes a C1.4 alkyl radical attached to a sulfoxide radical of the 5 formula: -S(O)- wherein the alkyl radical has the same definition as described herein. Examples include, but not limited to, methylsulfinyl, ethylsulfinyl, n-propylsulfinyl, iso-propylsulfinyl, n-butylsulfinyl, sec-butylsulfinyl, iso-butylsulfinyl, t-butyl, and the like.
The term "C1_4 alkylsulfonamide" refers to the groups /S\N/C1_4 alkyl SkNSC1 4 alkyl H H
wherein CI-4 alkyl has the same definition as described herein.
The term "C1.4 alkvlsulfonyl" denotes a C1.4 alkyl radical attached to a sulfone radical of the formula: -S(0)2- wherein the alkyl radical has the same definiti+on as described herein. Examples include, but not limited to, methylsulfonyl, ethylsulfonyl, n-propylsulfonyl, iso-propylsulfonyl, n-butylsulfonyl, sec-butylsulfonyl, iso-butylsulfonyl, t-butyl, and the like.
5 The term "C1.4 alkylthio" denotes a C1.4 alkyl radical attached to a sulfide of the formula: -S-wherein the alkyl radical has the same definition as described herein.
Examples include, but not limited to, methylsulfanyl (i.e., CH3S-), ethylsulfanyl, n-propylsulfanyl, iso-propylsulfanyl, n-butylsulfanyl, sec-butylsulfanyl, iso-butylsulfanyl, t-butyl, and the like.
The term "C1 alkylthiocarboxamide" denotes a thioamide of the following formulae:
S S
) N C1-a alkyl Ik HC1_4 alkyl wherein C1_4 alkyl has the same definition as described herein.

The term "C1.4 alkylthioureyl" denotes the group of the formula:
NC(S)N- wherein one are both of the nitrogen are substituted with the same or different C1.4 alkyl groups and alkyl has the same definition as described herein. Examples of an alkylthioureyl include, but not limited to, CH3NHC(S)NH-, NH2C(S)NCH3-, (CH3)2N(S)NH-, (CH3)2N(S)NH-, (CH3)2N(S)NCH3-, CH3CH2NHC(S)NH-, CH3CH2NHC(S)NCH3-, and the like.
The term "C14 alkylureyl" denotes the group of the formula: -NC(O)N- wherein one are both of the nitrogens are substituted with the same or different C1.4 alkyl group wherein alkyl has the same definition as described herein. Examples of an alkylureyl include, but not limited to, CH3NHC(O)NH-, NH2C(O)NCH3-, (CH3)2N-(O)NH-, (CH3)2N(O)NH-, (CH3)2N(O)NCH3-, CH3CH2NHC(O)NH-, CH3CH2NHC(O)NCH3-, and the like.
The term "C2-6 alkynyl" denotes a radical containing 2 to 6 carbons and at least one carbon-carbon triple bond, some embodiments are 2 to 4 carbons, some embodiments are 2 to 3 carbons, and some embodiments have 2 carbons. Examples of an alkynyl include, but not limited to, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl and the like.
The term "alkynyl"
includes di- and tri-ynes.
The term "amino" denotes the group -NH2.
The term "C1.4 alkylamino" denotes one alkyl radical attached to an amino radical wherein the alkyl radical has the same meaning as described herein. Some examples include, but not limited to, methylamino, etylamino, n-propylamino, iso-propylamino, n-butylamino, sec-butylamino, iso-butylamino, t-butylamino, and the like. Some embodiments are "C1 alkylamino."
The term "aryl" denotes an aromatic ring radical containing 6 to 10 ring carbons. Examples include phenyl and naphthyl.
The term "arylalkyl" defines a C1-C4 alkylene, such as -CH2-, -CH2CH2- and the like, which is further substituted with an aryl group. Examples of an "arylalkyP' include benzyl, phenethylene and the like.
The term "arylcarboxamido" denotes a single aryl group attached to the nitrogen of an amide group, wherein aryl has the same definition as found herein. The example is N-phenylcarboxamide.
The term "arylureyl" denotes the group -NC(O)N- where one of the nitrogens are substituted with an aryl.
The term "benzyl" denotes the group -CH2C6H5.
The term "carbo-Cl.6-alkoxy" refers to a C1.6 alkyl ester of a carboxylic acid, wherein the alkyl group is as defined herein. In some embodiments, the carbo-C16-alkoxy group is bonded to a nitrogen atom and together form a carbamate group (e.g., N-COO-C1.6-alkyl). In some embodiments, the carbo-C1.6-alkoxy group is an ester (e.g., -COO-C1.6-alkyl). Examples include, but not limited to, carbomethoxy, carboethoxy, carbopropoxy, carboisopropoxy, carbobutoxy, carbo-see-butoxy, carbo-iso-butoxy, carbo-t-butoxy, carbo-n-pentoxy, carbo-iso-pentoxy, carbo-t-pentoxy, carbo-neo-pentoxy, carbo-n-hexyloxy, and the like.
The term "carboxamide" refers to the group -CONH2.
The term "carboxy" or "carboxyl" denotes the group -CO2H; also referred to as a carboxylic acid group.
The term "cyano" denotes the group -CN.
The term "C3_7 cycloalkenyl" denotes a non-aromatic ring radical containing 3 to 6 ring carbons and at least one double bond; some embodiments contain 3 to 5 carbons;
some embodiments contain 3 to 4 carbons. Examples include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentenyl, cyclohexenyl, and the like.
The term "C3.7 cycloalkyl" denotes a saturated ring radical containing 3 to 6 carbons; some embodiments contain 3 to 5 carbons; some embodiments contain 3 to 4 carbons.
Examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclopenyl, cyclohexyl, cycloheptyl and the like.
The term "C4.8 diacylamino" denotes an amino group bonded with two acyl groups defined herein wherein the acyl groups may be the same or different, such as:
O
C1-4 alkyl ~--C1_ alkyl O
Examples of C4.8 diacylamino groups include, but limited to, diacetylamino, dipropionylamino, acetylpropionylamino and the like.
The term "C2.6 dialkylamino" denotes an amino substituted with two of the same or different 0 alkyl radicals wherein alkyl radical has the same definition as described herein. Some examples include, but not limited to, dimethylamino, methylethylamino, diethylamino, methylpropylamino, methylisopropylamino, ethylpropylamino, ethylisopropylamino, dipropylamino, propylisopropylamino and the like. Some embodiments are "C2.4 dialkylamino."
The term "CIA diallylcarboxarnido" or "Cl-4 dialkylearboxamide"denotes two alkyl 5 radicals, that are the same or different, attached to an amide group, wherein alkyl has the same definition as described herein. A CI-4 dialkylcarboxamido may be represented by the following groups:

'C1_4 alkyl NC1 a alkyl N
C1-4 alkyl C1_4 alkyl wherein C14 has the same definition as described herein. Examples of a diallcylcarboxamide include, but 0 not limited to, N,N-dimethylcarboxamide,N-methyl-N-ethylcarboxamide, N,N-diethylcarboxamide, N-methyl-N-isopropylcarboxamide, and the like.
The term "C2.6 dialkylsulfonamide" refers to one of the following groups shown below:

WO 2006/076231 PCT[US2006/000510 h jS, C1-3 alky 5 .S" '2 N N C;_3 alkyl C1_3 alkyl 01.3 alkyl wherein C1_3 has the same definition as described herein, for example but not limited to, methyl, ethyl, n-propyl, isopropyl, and the like.
The term "CZ_6 diallcylthiocarboxamido" or "C2-6 dialkylthiocarboxamide"denotes two alkyl radicals, that are the same or different, attached to a thioamide group, wherein alkyl has the same definition as described herein. A C1.4 dialkylthiocarboxamido may be represented by the following groups:

S ICI-4 alkyl `?SAN I C14 alkyl C1.4 alkyl C1.4 alkyl Examples of a dialkylthiocarboxatnide include, but not limited to, N,N-dimethylthiocarboxamide, N-methyl-N-ethylthiocarboxamide and the like.
The term "Q_6 dialkylsulfonylamino" refers to an amino group bonded with two C1.3 alkylsulfonyl groups as defined herein.
The term "ethynylene" refers to the carbon-carbon triple bond group as represented below:
The term "formyl" refers to the group -CHO.
The term "C1_4 haloalkoxy" denotes a haloalkyl, as defined herein, which is directly attached to an oxygen atom. Examples include, but not limited to, difluoromethoxy, trifluoromethoxy, 2,2,2-trifluoroethoxy, pentafluoroethoxy and the like.
The term "C1.4 haloalkyl" denotes an C14 alkyl group, defined herein, wherein the alkyl is substituted with one halogen up to fully substituted and a fully substituted Cl-4 haloalkyl can be represented by the formula CL2n+1 wherein L is a halogen and "n" is 1, 2, 3 or 4; when more than one halogen is present then they may be the same or different and selected from the group consisting of F, Cl, Br and I, preferably F. Examples of C1.4 haloalkyl groups include, but not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, chlorodifluoromethyl, 2,2,2-trifluoroethyl, pentafluoroethyl and the like.
The term "C1.4 haloalkylcarboxamide" denotes an alkylcarboxamide group, defined herein, wherein the alkyl is substituted with one halogen up to fully substituted represented by the formula CõL2õ+1 wherein L is a halogen and "n" is 1, 2, 3 or 4. When more than one halogen is present they may be the same or different and selected from the group consisting of F, Cl, Br and I, preferably F.
The term "C1.4 haloallylsulfinyl" denotes a haloalkyl radical attached to a sulfoxide group of the formula: -S(O)- wherein the haloalkyl radical has the same definition as described herein.

Examples include, but not limited to, trifluoromethylsulfinyl, 2,2,2-trifluoroethylsulfinyl, 2,2-difluoroethylsulfinyl and the like.
The term "Cl-4 haloalkylsulfonyl" denotes a haloalkyl radical attached to a sulfone group of the formula: -S(O)2- wherein haloalkyl has the same definition as described herein. Examples i include, but not limited to, trifluoromethylsulfonyl, 2,2,2-tifluoroethylsulfonyl, 2,2-difluoroethylsulfonyl and the like.
The term "C14 haloallcylthio" denotes a haloalkyl radicaol directly attached to a sulfur wherein the haloalkyl has the same meaning as described herein. Examples include, but not limited to, trifluoromethylthio (i.e., CF3S-), 1,1-difluoroethylthio, 2,2,2-trifluoroethylthio and the like.
The term "halogen" or "halo" denotes to a fluoro, chloro, bromo or iodo group.
The term "C1.2 heteroalkylene" refers to a C1.2 alkylene bonded to a heteroatom selected from 0, S, S(O), S(O)2 and NH. Some represented examples include, but not limited to, the groups of the following formulae:

H
`7 H
and the like.
The term "heteroaryl" denotes an aromatic ring system that may be a single ring, two fused rings or three fused rings wherein at least one ring carbon is replaced with a heteroatom selected from, but not limited to, the group consisting of 0, S and N wherein the N can be optionally substituted with H, Cl-4 acyl or CI-4 alkyl. Examples of heteroaryl groups include, but not limited to, pyridyl, 0 benzofuranyl, pyrazinyl, pyridazinyl, pyrimidinyl, triazinyl, quinoline, benzoxazole, benzothiazole, 1H benzimidazole, isoquinoline, quinazoline, quinoxaline and the like. In some embodiments, the heteroaryl atom is 0, S, NH, examples include, but not limited to, pyrrole, indole, and the like.
The term "heterocyclic" denotes a non-aromatic carbon ring (i.e., cycloalkyl or cycloalkenyl as defined herein) wherein one, two or three ring carbons are replaced by a heteroatom selected from, 5 but not limited to, the group consisting of 0, S, N, wherein the N can be optionally substituted with H, C1.4 acvl or C1.4 alkyl, and ring carbon atoms optionally substituted with oxo or a thiooxo thus forming a carbonyl or thiocarbonyl group. The heterocyclic group is a 3-, 4-, 5-, 6- or 7-membered containing ring. Examples of a heterocyclic group include but not limited to aziridin-1-yl, aziridin-2-yl, azetidin-l-yl, azetidin-2-yl, azetidin-3-yl, piperidin-l-yl, piperidin-4-yl, morpholin-4-yl, piperzin-0 1-yl, piperzin-4-yl, pyrrolidin-l-yl, pyrrolidin-3-yl, [1,3]-dioxolan-2-yl and the like.
The term "heterocyclic-carbonyl" denotes a heterocyclic group, as defined herein, directly bonded to the carbon of a carbonyl group (i.e., C=0). In some embodiments, a ring nitrogen of the heterocyclic group is bonded to the carbonyl group forming an amide. Examples include, but not limited to, N" N N

and the lake.
In some embodiments, a ring carbon is bonded to the carbonyl group forming a ketone group.
Examples include, but not limited to, OS SS SS N
O S S S
HN C
N
H

HN ; S ; and the like.
The term "heterocyclic-oxy" refers to a heterocyclic group, as defined herein, that is directly bonded to an oxygen atom. Examples include the following:

0 0.Z~'S 0\.SS 0\~SS 0 O HN
N
H C'~O O HN , S , and the like.

The term "heterocycliccarboxamido" denotes a heterocyclic group, as defined herein, with a ring nitrogen where the ring nitrogen is bonded directly to the carbonyl forming an amide. Examples include, but not limited to, N~ N N
~'0 and the like.
The term "heteroeyclicsulfonyl" denotes a heterocyclic group, as defined herein, with a ring nitrogen where the ring nitrogen is bonded directly to an SO2 group forming an sulfonamide.
Examples include, but not limited to, vS`00, VS'NO VS`NO
and the like.
The term "hydroxyl" refers to the group -OH.
The term "hydroxylamino" refers to the group -NHOH.

The term "nitro" refers to the group -NO2.
The term "C4-7 oxo-cycloalkyl" refers to a C4.7 cycloalkyl, as defined herein, wherein one of the ring carbons is replaced with a carbonyl. Examples of C4-7 oxo-cycloal yl include, but are not limited to, 2-oxo-cyclobutyl, 3-oxo-cyclobutyl, 3-oxo-cyclopentyl, 4-oxo-cyclohexyl, and the like and represented by the following structures respectively:
s,r J,s rr O

~?o O O O O
, 3 and The term "perfluoroalkyl" denotes the group of the formula -CF2i+1; stated differently, a perfluoroalkyl is an alkyl as defined herein wherein the alkyl is fully substituted with fluorine atoms and is therefore considered a subset of haloalkyl, Examples of perfluoroalkyls include CF3, CF2CF3, CF2CF2CF3i CF(CF3)2i CF2CF2CF2CF3, CF2CF(CF3)2, CF(CF3)CF2CF3 and the like.
The term "plienoxy" refers to the group C6H50-.
The term "phenyl" refers to the group C6H5-.
The term "phosphonooxy" refers to a group with the following chemical structure:
O
II

OH
The term "sulfonamide" refers to the group -SO2NH2.
The term "sulfonic acid" refers to the group -SO3H.
The term "tetrazolyl" refers to the five membered heteroaryl of the following formulae:

2N_N N N=N
NI
aN

In some embodiments, the tetrazolyl group is further substituted at either the I or 5 position resepectively with a group selected from the group consisting of C1.3 alkyl, C1_3 haloalkyl and CI-3 alkoxy.
The term "thiol" denotes the group -SH.
The term "GLP-1 secretagogue" shall mean an agent (e.g., a compound) that promotes GLP-1 secretion from a cell, e.g. an enteroendocrine cell.
The term "endogenous" shall mean a material that a mammal naturally produces.
The term "biologically active fragment of a G protein-coupled receptor" shall mean a fragment of the GPCR having structural and biochemical functions of a naturally occurring GPCR. In certain embodiments, the biologically active fragment couples to a G protein.
In certain embodiments, the biologically active fragment binds to a known ligand of the GPCR

The term "primer" is used Herein to denote a specific oligonucleotide sequence which is complementary to a target nucleotide sequence and used to hybridize to the target nucleotide sequence. A primer serves as an initiation point for nucleotide polymerization catalyzed by DNA
polymerase, RNA polymerase, or reverse transcriptase.
The term "expression vector" shall mean a DNA sequence that is required for the transcription of cloned DNA and translation of the transcribed mRNA in an appropriate host cell recombinant for the expression vector. An appropriately constructed expression vector should contain an origin of replication for autonomous replication in host cells, selectable markers, a limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters. The cloned DNA to be transcribed is operably linked to a constitutively or conditionally active promoter within the expression vector.
The term "candidate compound" or "test compound" shall mean a compound (for example and not limitation, a chemical compound) that is amenable to screening.
The term "contact" or "contacting" shall mean bringing at least two moieties together.
The terms "modulate" or "modify" shall be taken to refer to an increase or decrease in the amount, quality, or effect of a particular activity, function or molecule. By way of illustration and not limitation, agonists, partial agonists, inverse agonists, and antagonists of a G protein-coupled receptor are modulators of the receptor.
The term "small molecule" shall be taken to mean a compound having a molecular weight of less than about 10,000 grams per mole, including a peptide, peptidomimetic, amino acid, amino acid analogue, polynucleotide, polynucleotide analogue, nucleotide, nucleotide analogue, organic compound or inorganic compound (i.e. including a heterorganic compound or organometallic compound), and salts, esters and other pharmaceutically acceptable forms thereof. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less i than about 5,000 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having molecular weight of less than about 1,000 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 800 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 600 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 500 grams per mole.
The term "polymucleotide" shall refer to RNA, DNA, or RNA/DNA hybrid sequence of more than one nucleotide in either single chain or duplex form. The polynucleotides of the invention may be prepared by any known method, including synthetic, recombinant, ex vivo generation, or a combination thereof, as well as utilizing any purification methods known in the art.
The term "polypeptide" shall refer to a polymer of amino acids without regard to the length of the polymer. Thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not specify or exclude post-expression modifications of polypeptides. For example, polypeptides that include the covalent attachment of glycosyl groups, acetyl groups, phosphate groups, lipid groups and the like are expressly encompassed by the term polypeptide.
The term "antibody" is intended herein to encompass monoclonal antibody and polyclonal antibody.
The term "second messenger" shall mean an intracellular response produced as a result of receptor activation. A second messenger can include, for example, inositol 1,4,5-triphosphate (1P3), diacylglycerol (DAG), cyclic AMP (cAMP), cyclic GMP (cGMP), MAP kinase acitivity, MAPK/ERK kinase kinase-l (MEKK1) activity, and Ca2+. Second messenger response can be measured for a determination of receptor activation.
The term "receptor functionality" shall refer to the normal operation of a receptor to receive a stimulus and moderate an effect in the cell, including, but not limited to regulating gene transcription, regulating the influx or efflux of ions, effecting a catalytic reaction, and/or modulating activity through G-proteins, such as eliciting a second messenger response.
The term "stimulate" or "stimulating," in relationship to the term "response"
or "functionality of the receptor" shall mean that a response or a functionality of the receptor is increased in the presence of a compound as opposed to in the absence of the compound.
The term "inhibit" or "inhibiting," in relationship to the term "response" or "functionality of the receptor" shall mean that a response a functionality of the receptor is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.

Where a range of values is provided, it is understood that each intervening value, to the tenth of the lower limit unless the context clearly indicates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

GPR119 Agonists Preferably, GPR119 is mammalian GPR119. More preferably, GPRI 19 is rodent or primate GPRI 19. Most preferably, GPR119 is human GPR119.
The class of GPRI 19 agonists useful in the novel therapeutic combinations of the present 5 invention include compounds which exhibit an acceptably high affinity for GPR119 receptor. The GPR119 agonist or pharmaceutically acceptable salt may be any agonist, more preferably a selective GPR119 agonist.

Examples of GPRI 19 agonists are described in International Application No.
PCT/US2004/001267 (published as WO 04/065380). Disclosed in International Application No.
PCT/US2004/001267 as a GPR119 agonist is a compound of Formula (I):
Ri X~IY
Ar1(V.W NSA -Ik~ ` %
Z BAD
(I) , wherein:
A and B are independently C1_3 alkylene optionally substituted with 1 to 4 methyl groups;
D is 0, S, S(O), S(0)2, CR2R3 or N-R2;
V is selected from the group consisting of C1_3 alkylene, ethynylene and C1_2 heteroalkylene wherein each are optionally substituted with 1 to 4 substituents selected from the group consisting of C1_3 alkyl, C1.4 alkoxy, carboxy, cyano, C1_3 haloalkyl and halogen;
or V is absent;
W is NR4, 0, S, S(O) or S(0)2; or W is absent;
X is N or CR5;
Y is N or CR6;
Z is selected from the group consisting of C1_5 acyl, C1_5 acyloxy, C,_4 alkoxy, C1_8 alkyl, C1.4 alkylcarboxamide, C14 alkylthiocarboxamide, C1.4 alkylsulfonamide, C1_4 alkylsulfinyl, C1_4 alkylsulfonyl, C1-4 alkylthio, C14 alkylthioureyl, C1.4 alkylureyl, amino, C1.2 alkylamino, C2.4 dialkylamino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C4.8 diacylamino, CV_6 dialkylcarboxamide, C1_4 dialkylthiocarboxamide, C2_6 dialkylsulfonamide, C1_4 dialkylsulfonylamino, formyl, C1.4 haloalkoxy, C1.4 haloalkyl, C1.4 haloalkylcarboxamide, Cl-0 haloalkylsulfinyl, CI-4 haloalkylsulfonyl, C1_4 haloalkylthio, halogen, aryl, heterocyclic, heteroaryl, hydroxyl, hydroxylamino, nitro and tetrazolyl, wherein C1_8 alkyl and C1_5 acyl are each optionally substituted with 1, 2, 3 or 4 groups selected from the group consisting of C1.5 acyl, C1.5 acyloxy, C1.4 alkoxy, C,_4 alkylcarboxamide, C1_4 alkylsulfonamide, Cl-4 alkylsulfinyl, CI -4 alkylsulfonyl, C1_4 alkylthio, C1_4 alkylureyl, amino, C1.2 alkylamino, C2-4 dialkylamino, carbo-C1_6-alkoxy, carboxamide, carboxy, cyano, formyl, C1.4 haloalkoxy, C1.4 haloalkylsulfinyl, C1.4 haloalkylsulfonyl, C1-4 haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro; or Z is a group of Formula (IA):

H H
NyN.R7 NLq R8 (IA) wherein:
R7 is H, CI-8 alkyl or C3.6 cycloalkyl; and R8 is H, nitro or nitrile;
Arl is aryl or heteroaryl wherein each are optionally substituted with R9-R13;

R1 is selected from the group consisting of H, CI-5 acyloxy, C2.6 alkenyl, Cl-4 alkoxy, C).s alkyl, C1-4 alkylcarboxamide, C2.6 alkynyl, C14 alkylsulfonamide, C1.4 alkylsulfmyl, C1.4 alkylsulfonyl, C1.4 alkylthio, C14 alkylureyl, amino, C1 4 alkylamino, C2_8 dialkylamino, carboxamide, cyano, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, C2.6 dialkylsulfonamide, halogen, Cl.4 haloalkoxy, C1.4 haloalkyl, C14 haloalkylsulfinyl, C14 haloalkylsulfonyl, C1-4 haloalkylthio and hydroxyl;

R2 is selected from the group consisting of H, C1_5 acyl, C1_5 acyloxy, C1-4 alkoxy, C1.8 1 alkyl, C1-4 alkylcarboxamide, C1_4 alkylthiocarboxamide, C14 alkylsulfmyl, C14 alkylsulfonyl, C1-4 alkylthio, amino, carbo-C1-6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloalkyl, C2.4 dialkylcarboxamide, C1-4 haloalkoxy, C1.4 haloalkyl, halogen, heteroaryl, hydroxyl and phenyl;
and wherein C1_8 alkyl, heteroaryl and phenyl are each optionally substituted with 1 to 5 substituents selected from the group consisting of C1.5 acyl, C1.5 acyloxy, C1.4 alkoxy, C1.8 alkyl, C1.4 alkylamino, C1.4 alkylcarboxamide, C14 alkylthiocarboxamide, C1.4 alkylsulfonamide, C1.4 alkylsulfonyl, 01.4 alkylsulfonyl, C1.4 alkylthio, C1.4 alkylthioureyl, C1.4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3_6-cycloalk yl, C3.6-cycloalkyl-C1.3-alkylene, C3_6-cycloallyl-C1_3-heteroalkylene, C2_$ dialkylamino, C2.6 dialkylcarboxamide, C1.4 dialkylthiocarboxamide, C2.4 dialkylsulfonamide, C1.4 alkylthioureyl, C1-4 haloalkoxy, C1.4 haloalkyl, C1-4 haloalkylsulfmyl, C1.4 haloalkylsulfonyl, C14 haloalkyl, C1.4 haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro; or R2 is -Ar2-Ar3 wherein Are and Ara are independently aryl or heteroaryl each optionally substituted with 1 to 5 substituents selected from the group consisting of H, C1.5 acyl, C1.5 acyloxy, C14 alkoxy, C1_s alkyl, O1-4 allylcarboxamide, C14 alkylthiocarboxamide, C1.4 alkylsulfonyl, C1-4 alkylsulfonyl, C1_4 alkylthio, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3_6-cycloalkyl, C2.6 dialkylcarboxamide, C1-4 haloalkoxy, C14 haloalkyl, halogen, hydroxyl and nitro; or R, is a group of Formula (IB):

c., I

(IB) wherein:
R14 is C1.8 alkyl or C3.6 cycloalkyl; and R15 is F, Cl, Br or CN; or R2 is a group of Formula (IC):
G.Ar4 (IC) wherein:
G is C=O, CR16R17, 0, S, S(O), S(0)2; where R16 and R17 are independently H or CI-8 alkyl; and Ar4.is phenyl or heteroaryl optionally substituted with I to 5 substituents selected from the group consisting of C1.5 acyl, Cl_5 acyloxy, C1.4 alkoxy, Cl.e alkyl, C1.4 alkylcarboxamide, Cl-4 alkylthioearboxamide, C1.4 alkylsulfonamide, C1.4 alkylsulfinyl, C1.4 alkylsulfonyl, Cl.a alkylthio, Cl-4 allcylthioureyl, C1.4 alkylureyl, amino, carbo-Cl.6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloalkyl, C2.6 dialkylcarboxamide, C1.4 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C1_4 alkylthioureyl, C1.4 haloalkoxy, C1.4 haloalkyl, C1.4 haloalkylsulfmyl, C1.4 haloalkylsulfonyl, C1_4 haloalkyl, CI-4 haloalkylthio, halogen, heteroaryl, hydroxyl; hydroxylamino and nitro;

R3 is H, C1.8 alkyl, C1.4 alkoxy, halogen or hydroxyl;
R4 is H or C1.8 alkyl;
R.5 and R6 are independently I-I, C,.B alkyl or hair n;
R9 is selected from the group consisting of Cl_; acyl, CI-5 acyloxy, C2.6 alkenyl, C1.4 alkoxy, C1_8 alkyl, C1.4 alkylamino, C1.4 alkylcarboxamide, C2.5 alkynyl, C1-4 allylsulfonamide, C1.4 allrylsulfnnyl, C1-4 alkylsulfonyl, Cl-4 alkylthio, C14 allcyhu'eyl, amino, arylsulfonyl, carbo-C1.
6-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C'_6 dialkylamino, C2_6 dialkylcarboxamide, C2_6 diallcylsulfonamide, halogen, Cl-4 haloalkoxy, C1.4 haloalkyl, C,_1 haloallrylsulfmyl, C1_4 haloalkylsulfonyl, C1.4 haloalkylthio, heterocyclic, heterocyclicsulfonyl, heteroaryl, hydroxyl, nitro, C4.7 ox.o-cycloalkyl, phenoxy, phenyl, sulfonamide and sulfonic acid, and wherein C1.5 acyl, C1.4 alkoxy, C1.8 alkyl, C1_4 alkylsulfonamide, allcylsulfonyl, arylsulfonyl, heteroaryl, phenoxy and phenyl are each optionally substituted with I to 5 substituents selected independently from the group consisting of CI-5 acyl, C1.5 acyloxy, C2_6 alkenyl, C1.4 alkoxy, C1.8 alkyl, Cl-4 alkylcarboxamide, C2_6 alkynyl, C1.4 alkylsulfonamide, Cl-4 alkylsulfinyl, C1.4 alkylsulfonyl, C1-4 alkylthio, C1 4 alkylureyl, carbo-Cl.4-alkoxy, carboxamide, carboxy, cyano, C3_ 6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, C1.4 haloalkoxy, C1.4 haloalkyl, C1-4 haloalkylsuffmyl, 014 haloallrylsulfonyl, C1.4 haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro and phenyl; or R9 is a group of Formula (ID):

p R1a O
(ID) wherein:
"p" and "r" are independently 0, 1, 2 or 3; and R15 is H, C1.5 acyl, C7_6 alkenyl, C1.8 alkyl, C1.4 alkylcarboxamide, C2.6 alkynyl, C1.4 alkylsulfonamide, carbo-Cl_6-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2_6 dialkylcarboxamide, halogen, heteroaryl or phenyl, and wherein the heteroaryl and phenyl are each optionally substituted with Ito substituents selected independently from the group consisting of C1.4 alkoxy, amino, C1.4 allcylamino, C2.6 alkynyl, C2.3 dialkylamino, halogen, C1.4 haloallcoxy, C1.4 haloalkyl and hydroxyl; and R10-R13 are independently selected form the group consisting of C1_5 acyl, C1.5 acyloxy, 02.6 alkenyl, CI-4 alkoxy, C1.8 alkyl, CI-4 alkylcarboxamide, C2.6 allynyl, Cl-a alkylsulfonamide, C1.4 allcylsulfmyl, Cla alkylsulfonyl, C1.4 alkylthio, C1.
allylureyl, carbo-C1 6-alkoxy, carboxamide, carboxy, cyan, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, C1-1 haloalkoxy, C1.4 haloalkyl, C1-1 haloalkylsulfmyl, C1.4 haloalkylsulfonyl, C_4 haloalkylthio, hydroxyl and nitro; or two adjacent Rio-R11 groups together with Art form a 5, 6 or 7 membered cycloalkyl, cycloalkenyl or heterocyclic group wherein the 5, 6 or 7 membered group is optionally substituted with halogen.
The present invention also encompasses diastereomers as well as optical isomers, e.g.
mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and diastereomers, which arise as a consequence of structural asymmetry in certain compounds of the invention. Separation of the individual isomers or selective synthesis of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.
Specific examples of GPR119 agonists disclosed in International Application No.
PCTIUS2004/001267 include the following compounds according to Formula (I) (referred to herein as Group Al): [6-(4-Benzenesulfonyl-piperidin-l-yl)-5-nitro-pyrimidin-4-yl]-(4-methanesulfonyl-phenyl)-amine; {4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperazin-l-yl}-acetic acid ethyl ester; (2-Fluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl} -amine; 1-[6-(4-Imidazol-l-yl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-i carboxylic acid ethyl ester; 1-[SNitro-6-(4-[1,2,4]triazol-1-yl-phenoxy)-pyrimidin-4-ylj-piperidine-4-carboxylic acid ethyl ester; {6-[4-(4-Fluoro-phenoxy)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; {6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; {6-[4-(3-Cyclopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; (4-Methanesulfonyl-> phenyl)-(5-nitro-6-{4-[3-(3-trifluoromethyl-phenyl)-[l,2,4]oxadiazol-5-yl]-piperidin-l-yl}-pyrimidin-4-yl)-amine; {6-[4-(3-Etliyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-(2-fluoro-phenyl)-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-5-nitro-pyrimidin-4-yl}-amine; {6-[4-(3-Ethyl-[l,2,4]oxadiazol-5-yl)-piperidin-l-yi]-5-nitro-pyrimidin-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(3-propyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; {6-[4-(3-Cyclopropylmethyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-4-yloxy)-piperidin-l -yl]-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyrimidin-2-yloxy)-piperidin-1-yl]-pyrimidin-4-yl}-amine; 1-[6-(4-Carbamoylmethyl-phenoxy)-5-nitro-pyrimidin-i 4-yl]-piperidin-4-carboxylic acid ethyl ester; 1-{6-[4-(1,3-Dioxo-l,3-dihydro-isoindol-2-yl)-phenoxy]-5-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester; 4'-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-3'-nitro-3,4,5,6 tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; {6-[4-(2-Ivlethoxy-phenylsulfanyl)-piperidin-l -yl]-5-nitro-pyrimidin-4-yl} -(4-[
1,2,4]triazol-l -yl-phenyl)-amine; 4'-(2-Amino-4-ethanesulfonyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[
1,2']bipyridinyl-4-carboxylic acid ethyl ester; 4'-(4-Imidazol-1-yl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; (4-Methoxy-2-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piper idin-l-yl]-pyrimidin-4-yloxy}-phenyl)-phenyl-methanone; 4-{4-[6-(4-Cyclopropvlmetho,cymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yloxyl-phenyl}-butan 2-one; 4-(4-[5-Nitro-6-(4-propoxymethyl-piperidin-1-yl)-pyrimidin-4-yloxy]-phenyl}-butan-2-one; 4-{4-[6-(4-Butoxymethyl-piperidin--yl)-5-nitro-pyrimidin-4-yloxy]-phenyl}-butan -one; 4-{4-[6-(4-Isobutoxymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yloxy]-phenyl}-butan 2-one; {1-[6-(Benzo[ 1,3] dioxol-5-ylain ino)-5-nitro-pyrimidin-4-yl]-piperidin-4-yl} -(4-fluoro-phenyl)-methanone;
(2,3-Difluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l -yl]-pyrimidin-4-yl)-amine;
(2,4-Difluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl}-amine; 1-~ {2-Nitro-3-[4-(3-oxo-butyl)-phenoxy]-phenyl}-piperidine-4-carboxylic acid ethyl ester; 1-[6-(4-Acetyl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 3'-Nitro-2'-[4-(3-oxo-butyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,4']bipyridinyl-4-carboxylic acid ethyl ester; 4-(4-{5-Nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yloxy}-phenyl)-butan-2-one; 4-(4-{5-Nitro-6-[4-(2-trifluoromethyl-phenoxy)-piperidin-1-yl]-pyrimidin-4-yloxy}-phenyl)-butan-2-one; 4-5 (4-(6-[4-(3-Methyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-5-uitro-pyrimidin-4-yloxy}-phenyl)-butan-2-one; 4-(2,4-Difluoro-phenoxy)-5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimidine; 4-(4-{6-[4-(4-Fluoro-benzoyl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yloxy}-phenyl)-butan-2-one; 4-(4-Methanesulfonyl-phenoxy)-5-nitro-6-[4-(pyridin-2-ylsulfanyl)-cyclohexyll-pyrimidine; 4-(4-Methanesulfonyl-phenoxy)-5-nitro-6-[4-(pyridin-4-ylsulfanyl)-cyclohexyll-pyrimidine; 4-(4-Methanesulfonyl-phenoxy)-5-nitro-6-(4-phenylsulfanyl-cyclohexyl)-pyrimidin; 1-{6-[(Benzo[1,3]dioxol-5-ylmethyl)-amino]-5-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl > ester; l-{6-[4-(1,l-Dioxo-1 X6-thiomorpholin-4-ylmethyl)-phenylamino]-5-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester; 1-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[6-(4-Dimethylsulfamoyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[6-(3-Methoxy-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[6-(2-Methoxy-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[6-(4-Methanesulfonyl-phenoxy)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; l-{6-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-5-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester; 1-[6-(2-Amino-4-ethanesulfonyl-phenoxy)-5-nitro-pyrimidin-4-yllpiperidine-4-carboxylic acid ethyl ester; 1-[6-(2,5-Dimethoxy-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; (4-{5-Nitro-6-[4-(pyridin-2 ylsulfanyl)-piperidin-1-yl]-pyrimidin-4-ylamino}-phenyl)-phenyl-methanone;
1-[6-(4-Cyclohexyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[5-Nitro-6-(4-[1,2,4]triazol-1-yl-phenylamino)-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[5-Nitro-6-(4-trifluoromethanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[5-Nitro-6-(4-[1,2,3]thiadiazol-4-yl-phenylamino)-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; [6-(4-Ethoxymethyl-piperidin-1-yl)-5-nitro-pyrimidin-4-yl]-(4-methanesulfonyl-phenyl)-amine; [5-Nitro-6-(4-propyl-piperidin-1-yl)-pyrimidin-4-yl]-(4-[1,2,4]triazoI-1-yl-phenyl)-amine; {5-Nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl}-(4-[l,2,4]triazol-l-yl-phenyl)-amine; (2-Fluoro-phenyl)-{6-[4-(3-methyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-{6-[4-(3-methyl-[1,2,4]oxadiazol-5-yi)-piperidin-1-yi]-5-nitro-pyrimidin-4-yl}-amine; {6-[4-(3-vTathyl-[1,2,4]oxadiazol-5 yl)-piperidin-1-yl]-S-ritro-pyrimidin-4-yl}-(4-[1,2,4]triazol-1-yl-phenyl)-amine;
(4-Methanesulfonyl-phenyl)- {5-nitro-6-[4-(pyridin-2-vlsulfanyl)-piperidin-l -yl]-pyrimidin-4-yl}-amine; (3-Methoxy-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl}-amine; 1-[6-(Benzo[1,3]dioxol-5-ylamuio)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl 0 ester; 1-[6-(2-Fluoro-phenylamino)-5-nitro-pyrimidin-4-yll-piperidine-4-carboxylic acid ethyl ester;
1-[6-(3-Fluoro-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[6-(3,4-Dihydro-2H-benzo[b] [ 1,4]dioxepin-7-ylamino)-5-nitro-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-{6-[4-(Morpholine-4-sulfonyl)-phenylamino]-5-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester; Benzo[1,3]dioxol-5-yl-[5-nitro-6-(4-propyl-piperidin-1-yl)-pyrimidin-4-5 yl]-amine; (4-Fluoro-phenyl)-{1-[5-nitro-6-(4-[l,2,4]triazol-l-yl-phenylamino)-pyrimidin-4-yl)-piperidin-4-yl}-methanone; [5-Nitro-6-(4-phenylsulfanyl-piperidin-1 yl)-pyrimidin-4-yl]-(4-[I,2,4]triazol-1-yl-phenyl)-amine; (4-Fluoro-phenyl)-{1-[6-(2-fluoro-phenylamino)-5-nitro-WO 2006/076231 PCT[US2006/00010 pyrimidin-4-yl]-piperidin-4-yl}-methanone; (4-Methanesulfonyl-phenyl)-[5-nitro-6-(4-phenylsulfanyl-piperidin-l-yl)-pyrimidin-4-yl]-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-2-yloxy)-piperidin-l-yl]-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[4-(pyridin-4-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-{6-[4-(4-methoxy-phenylsulfanyl)-piperidin-l-yl]-5-nitro-pyrimidin-4-yl}-amine; 2-Methoxy-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-(5-nitro-6-{4-[3-(3-trifluorometlryl-phenyl)-[ 1,2,4]oxadiazol-5-yl]-piperidin-1-yl}-pyrimidin-4-yl)-amine; { 6-[4-(3-Ethyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-5-nitro-pyrimidin-4-yl} -(4-methanesulfonyl-phenyl)-amine; (6-{4-[5-(4 Fluoro-phenyl)-[1,3,4]oxadiazol-2-yl]-piperidin-1-yl}-5-nitro-pyrimidin-4-yl)-(4-methanesulfonyl-phenyl)-amine; (4-Methanesulfonyl-phenyl)-[5-nitro-6-(4-pyridin-2-ylmethyl-piperidin-1-yl)-pyrimidin-4-yl]-amine; 1-(6-[4-(2,5-Dioxo-imidazolidin-4-yl)-phenoxy]-5-nitro-pyrimidin-4-yl)-piperidine-4-carboxylic acid ethyl ester; 1-[5-Nitro-6-(4-propionyl-phenoxy)-pyrimidin-4-yl]-piperidin-4-carboxylic acid ethyl ester; 1-[5-Nitro-6-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-pyrimidin-4-yl]-piperidin-4-carboxylic acid ethyl ester; 1-[6-[4-(3-Oxo-butyl)-> phenoxy]-5-(2,2,2-trifluoro-acetylamino)-pyrimidin-4-yl]-piperidine-4-carboxylic acid ethyl ester; 1-[6-(2-Benzoyl-5-methoxy-phenoxy)-5-nitro-pyrimidin-4-yl]-piperiduie-4-carboxylic acid ethyl ester;
3'-Nitro-4'-[4-(3-oxo-butyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyridiny1-4-carboxylic acid ethyl ester; 1-[6-(4-Dimethyl sulfamoyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidin-4-carboxylic acid ethyl ester; 1-{6-[4-(4,5-Dichloro-imidazol-1-yl)-phenylamino]-S-nitro-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester; Benzo[1,3]dioxol-5-yl-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl}-amine; (4-rluoro-phenyl)-{1-[6-(2-fluoro-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidin-4-yl}-methanone; (2,5-Difluoro-phenyl)-{5-nitro-6-[4-(pyridin-2-ylsulfanyl)-piperidin-l-yl]-pyrimidin-4-yl}-amine; 1-{5Nitro-6-[4-(3-oxo-butyl)-phenoxy]-pyrimidin-4-yl}-piperidine-4-carboxylic acid ethyl ester; 4-[4-(3 -Isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-6-(4-> n'iethanesuifonyl-phenoxy)-pyrimidin-5-carbonitriie; 5-[1,3]Dioxolan-2-yl-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yi)-piperidin-1-yl]-6-(4-methanesulfonyl-phenoxy)-pyrimidine; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulfonyl-phenoxy)-pyrimidine-5-carbaldehyde; 5-[ 1,3]Dioxolan-2-yl-4-[4-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[ 1,2,3]thiadiazol-4-yl-phenoxy)-pyrimidine; 4-[4-(3-Isopropyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-pyrimidin-5-carbaldehyde; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-l -yl]-6-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-pyrimidine-5-carboxylic acid; [4-[4-(3-Isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-[ l ,2,3]thiadiazol-4-yl-phenoxy)-pyrimidin-5-yI]-methanol; [4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-6-(4-[1,2,3]thiadiazoI-4-yl-phenoxy)-pyrimidin-5-ylmethyl]-dimethyl-amine; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-5 1-yl]-6-(4-methylsulfanyl-phenylamino)-pyrimidine-5-carbonitrile; 4-[4-(3-Isopropyl-[1 , 2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-methanesulfinyl-phenylamino)-pyrimidine-5-carbonitrile;
(4-Methanesulfonyl-phenyl)- { 5-nitro-6-[4-(4-trifluoromethoxy-phenoxy)-piperidin-l-yl]-pyrimidin-4-yl}-amine; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-6-(4-methanesulfonyl-phenylamino)-pyrimidine-5-carbonitrile; 1- { 1-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidin-4-yl}-hexan-I-one; 1-{ 1-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yl]-piperidin-4-yl }-hexan-l-one; {6-[4-(3-tert-Butyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-5-nitro-pyrimidin-4-yl } -(2-fluoro-4-methanesulfonyl-phenyl)-amine; { 6-[4-(3-tert-Butyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-5-nitro-pyrimidin-4-yl }-(4-methanesulfonyl-phenyl)-amine; [6-(4-Benzofuran-2-yl-piperidin-l-yl)-5-nitro-pyrimidin-4-yl]-(4-methanesulfonyl-phenyl)-amine and 5-Nitro-4-(5-phenyl-[ 1,3,4]oxadiazol-2-ylsulfanyl)-6-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-pyrimidine.
Examples of GPRI19 agonists are described in International Application No.
PCT/US2004/005555 (published as WO 04/076413). Disclosed in International Application No.
PCT/US2004/005555 as a GPRI 19 agonist is a compound of Formula (II):
X,Y Z
A
Art V~W~U N' ~
ID
B
(II) wherein:
A and B are independently C1_3 alkylene optionally substituted with I to 4 methyl groups;
U is N or CRI;
D is 0, S, S(O), S(O)2, CR2R3 or NR2;
V is selected from the group consisting of C1.3 alkylene, ethynylene and C1_2 heteroalkylene optionally substituted with 1 to 4 substituents selected from the group consisting of C1_3 alkyl, C14 alkoxy, carboxy, cyano, C1_3 haloalkyl and halogen; or V is absent;
W is -S(0)2NR4-, -NR4-, -0-, -S-, -S(O)-, -S(0)2-; or W is absent;
X is N or CR5;
Y is N or CR6;
Z is selected from the group consisting of H, C1_5 acyl, C1.5 acyloxy, C1_4 alkoxy, C1_ 6 alkyl, C1_4 alkylcarboxamide, C1.4 alkylthiocarboxamide, C1-4 alkylsulfonamide, C1_4 alkylsulfinyl, C1-4 alkylsulfonyl, C1-4 alkylthio, C1. alkyithioureyl, C1_4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C4..& diacylamino, C1.
dialkylcarboxamide, C1.4 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C1.4 dialkylsulfonylamino, formyl, C1.
4 haloalkoxy, C1-4 haloalkyl, C1_4 haloalkylcarboxamide, C1.4 haloalkylsulfinyl, C1_4 haloalkylsulfonyl, C1.4 haloalkylthio, halogen, aryl, heteroaryl, hydroxyl, hydroxylamino, nitro and tetrazolyl; or Z is a group of Formula (IIA):

WO 2006/076231 PCT[US2006/000510 H H
I:NUN,R7 INS
RB
(IIA) wherein:
R7 is H, C1.6 alkyl or C3.6 cycloalkyl; and R3 is H, nitro or cyano;
Ar1 is aryl or heteroaryl optionally substituted with R9, Rio, R11, R12 and R13;
R1, R5 and R6 are independently selected from the group consisting of H, C1.5 acyloxy, C2_6 alkenyl, C1.4 allcoxy, C1.8 alkyl, CI-4 allcylcarboxamide, C2_6 alkynyl, Cl.a alkylsulfonamide, C1.4 alkylsuffonyl, C1.4 alkylsulfonyl, C1.4 alkylthio, C1.4 alkylureyl, amino, C14 alkylamino, C2.8 dialkylamino, carboxamide, cyan, C3.6 cycloalkyl, C2_6 dialkylcarboxamide, C2.6 0 diallcylsulfonamide, halogen, C1.4 haloalkoxy, C1-4 haloalkyl, C1.4 haloalkylsulfmyl, C14 haloalkylsulfonyl, C1_4 haloalkylthio, hydroxyl and nitro;

R2 is selected from the group consisting of H, C1_5 acyl, C1.5 acyloxy, C1.4 alkoxy, C1.8 allcyl, CI-4 alkylcarboxamide, Cl_4 alkylthiocarboxamide, C14 alkylsulfnyl, C1.4 alkylsulfonyl, C1-5 4 alkylthio, amino, carbo-C1_6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloallyl, C2-6 dialkylcarboxamide, C1.4 haloalkoxy, C14 haloalkyl, halogen, heteroaryl, hydroxyl and phenyl;
and wherein C1.8 alkyl, heteroaryl and phenyl are optionally substituted with 1 to 5 substituents selected from the group consisting of C1.5 acyl, C1.5 acyloxy, C1.4 alkoxy, C1_8 alkyl, CI-4 alkylamino, CI -4 alkylcarboxamide, C14 alkylthiocarboxamide, C14 allylsulfonamide, C1_4 0 alkylsulfmyl, C1.4 alkylsulfonyl, C-4 allcylthio, C14 alkylthioureyl, C1-4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3_6-cycloalkyl, C3.6-cycloalkyl-C1.3-heteroalkylene, C,,_8 diaikylamino, C2.6 dialkyicarboxamide, C1.4 dialky lthiocarboxanlide, C2.5 dialkylsulfonamide, C1_4 alkylthioureyl, C111 haloalkoxy, C1.4 haloalkyl, C1.4 haloalkylsulfuryl, C1-4 haloalkylsulfonyl, C1.4 haloalkyl, C1_4 haloalkylthio, halogen, heterocyclic, hydroxyl, 5 hydroxylalnino and nitro; or R2 is -Are-Ar3 wherein Are and Ara are independently aryl or heteroaryl optionally substituted with 1 to 5 substituents selected from the group consisting of H, C1.5 acyl, C1.5 acyloxy, C1-4 alkoxy, C1_8 alkyl, C1.4 alkylcarboxamide, C1.4 alkyithiocarboxamide, C1-0 alkylsulfinyl, C1-4 alkylsulfonyl, C14 alkylthio, amino, carbo-Cl.6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloalkyl, C2.6 diallcylcarboxamide, C1.1 haloalkoxy, C1_4 haloalkyl, halogen, hydroxyl and nitro; or R2 is a group of Formula (JIB):

N S,.O R14 (IIB) wherein:
R14 is Cl-s alkyl or C3.6 cycloalkyl; and R15 is F, Cl, Br or CN; or R2 is a group of Formula (ITC):

C7. 'Ar4 (IIC) wherein:
G is C=O, CR16R17, 0, S, S(O), S(0)2; Where R16 and R17 are independently H or Cl-s alkyl; and Ar4 is phenyl or heteroaryl optionally substituted with 1 to 5 substituents selected from the group consisting of C1.5 acyl, C1.5 acyloxy, C1-alkoxy, C1.s alkyl, C1.4 allcylcarboxamide, Cl-4 alkylthiocarboxamide, C1.4 alkylsulfonamide, C1.4 alkylsulfmyl, C1.4 allcylsulfonyl, Cl-4 alkylthio, C1.4 alkylthioureyl, C1.4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3-6-cycloalkyl, C2.6 dialkylcarboxamide, C14 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C14 alkylthioureyl, C1-4 haloalkoxy, C1.4 haloalkyl, C:4 haloalkylsulflnyl, C1.4 haloalkylsulfonyl, C14 haloalkyl, Cl-a haloalkylthio, halogen, heteroaryl, hydroxyl, hydroxylamino and nitro;

R3 is H, C1.8 alkyl, C1.4 alkoxy or hydroxyl;
0 R4 isHorC1_salkyl;
R9 is selected from the group consisting of C1 acyl, CI-s acyloxy, C2.6 alkenyl, C1.4 alkoxy, C1.s alkyl, C14 alkylcarboxamide, C2.6 alkynyl, C1.4 alkylsulfonamide, C14 alkylsulfinyl, C1-4 alkylsulfonyl, C14 alkylthio, C14 alkylureyl, amino, alylsulfonyl, carbo-Cl.-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2. dialkylcarboxamide, halogen, C1-4 haloalkoxy, 5 C14 haloalkyl, C-4 haloalkylsulfonyl, C1-4 haloalkylsulfonyl, Cl-4 haloalicylthio, hoterocyclic, heterocyclicsulfonyl, heteroaryl, hydroxyl, nitro, C4.7 oxo-cycloalkyl, phenoxy, phenyl, sulfonamide and sulfonic acid, and wherein C1.5 acyl, C14 alkoxy, C1.8 alkyl, Cl-4 alkylsulfonamide, alkylsulfonyl, arylsulfonyl, heteroaryl, phenoxy and phenyl are optionally substituted with 1 to 5 substituents selected independently from the group consisting of C1.s aryl, 0 CI-5 acyloxy, G-6 alkenyl, Cl-4 alkoxy, C1-s alkyl, Cl-4 alkylcarboxamide, C2.6 alkynyl, C4 alkylsulfonamide, C1-4 alkylsulfinyl, C14 alkyisulfonyl, C1.4 alkylthio, C14 alkylureyl, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3-6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, C1.4 haloalkoxy, C1-4 haloalkyl, C1.4 haloallcylsulfmyl, C14 haloalkylsulfonyl, C1-4 haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro and phenyl; or R9 is a group of Formula (DD):

I. P rR1a (ID) wherein:
"p" and "r" are independently 0, 1, 2 or 3; and Ria is H, C1.5 acyl, C2.6 alkenyl, C1-s alkyl, C14 alkylcarboxarnide, C2-6 alkynyl, Cl-a alkylsulfonamide, carbo-C16-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.6 diallylcarboxamide, halogen, heteroaryl or phenyl, and wherein the heteroaryl or phenyl optionally. substituted with 1 to 5 substituents selected independently from the group consisting of C1.a alkoxy, C1.
g alkyl, amino, C1-4 alkylamino, C2.6 alkenyl, C2.s dialkylamino, halogen, C14 haloalkoxy, C1.. haloalkyl and hydroxyl; and R10-R13 are independently selected form the group consisting of C1.5 acyl, Cl-s acyloxy, C2.6 alkenyl, CI-4 alkoxy, C1.3 alkyl, Cr-l alkylcarboxamide, C2.6 alkynyl, C1.4 alkylsulfonamide, C1.4 alkylsulfinyl, C1.4 alkylsulfonyl, Cl. alkylthio, C1.4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, C3 4 haloalkoxy, C1.4 haloalkyl, C14 haloalkylsulfmyl, C1.4 haloalkylsulfonyl, C14 haloalkylthio, hydroxyl and nitro; or 0 two adjacent Rio-R11 groups form a 5, 6 or 7 membered cycloalkyl, cycloalkenyl or heterocyclic group with Art wherein the 5, 6 or 7 membered group is optionally substituted with halogen.
The pre;scnt invention also encompasses diastereomers as well as optical isomers, e.g.
mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and 5 diastereomers, which arise as a consequence of structural asymmetry in certain compounds of the invention. Separation of the individual isomers or selective synthesis of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/005555 include the following compounds according to Formula (II) (referred to herein 0 as Group B1): 6'-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 1-[4-(4-Acetyl-3'-nitro-3,4,5,6-tetrahydro-2H-[l,2']bipyridinyl-6'-yloxy)-phenyl]-ethanone; 6'-[4-(4-Hydroxy-benzenesulfonyl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(4-Imidazol-1-yi-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
6'-(4-Benzoyl-phenoxy)-3'-5 nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
6'-[4-(2-Methoxy-ethyl)-phenoxy]-3'-nitro-3,4,5,6-tetralydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(4-Cyclopentyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester;
6'-(4'-Cyano-bipheny[-4-yloxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 3'-Nitro-6'-(4-sulfo-phenoxy)-3,4,5,6-tetrahydro-2H-[
1,2']bipyridinyl-4-carboxylic acid i ethyl ester; 3'-Nitro-6'-(4-pyrrol-1-yl-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2]bipyridinyl-4-carboxylic acid ethyl ester; 6'-(4-Carbamoyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[
1,2']bipyridinyl-4-carboxylic acid ethyl ester; 3'-Nitro-6'-(4-[1,2,4]triazol-1-yl-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(2-Amino-4-ethanesulfonyl-phenoxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 3'-Nitro-6'-[4-(4-oxo-cyclohexyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(4'-Methoxy-biphenyl-4-yloxy)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 3'-Nitro-6'-(4-[1,2,3]thiadiazol-4-yl-phenoxy)-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-[4-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-[l,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-[4-(2,5 Dioxo-imidazolidin-4-yl)-i phenoxy]-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 3'-Nitro-6'-[4-(3-oxo-butyl)-phenoxy]-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 3-[4-(3'-Nitro-4-propyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6'-yloxy)-phenyl]-3-oxo-propionic acid methyl ester; 4-[4-(3'-Nitro-4-propyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6'-yloxy)-phenyl]-butan-2-one;
4- { 4-[3'-Nitro-4-(pyri din-2-yls ulfaayl)-3,4,5, 6-tetrahydro-2H-[
1,2']bipyridinyl-6'-yl oxy] -phenyl} -butan-2-one; and 3'-Nitro-4-(pyridin-2-ylsulfanyl)-6'-(4-[1,2,4]triazol-1-yl-phenoxy)-3,4,5,6-tetrahydro-2H-{ 1,2'] bipyridinyl.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/005555 include the following compounds according to Formula (II) (referred to herein as Group B2): 1-[5-(4-Benzoyl-phenoxy)-2-nitro-phenyl]-piperidine-4-carboxylic acid ethyl ester; 1-{5-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-2-nitro-phenyl}-piperidine-4-carboxylic acid ethyl ester;
1-[5-(2-Amino-4-ethanesulfonyl-phenoxy)--2-nitro-phenyl]-piperidine-4-carboxylic acid ethyl ester; 1-{2-Nitro-5-[4-(3-oxo-butyl)-phenoxy]-phenyl}-piperidine-4-carboxylic acid ethyl ester; 4-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-butan-2-one; 1-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-ethanone; 3-{4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl)-3-oxo-propionic acid methyl ester; 5-Ethanesulonyl-2-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenylamine; {4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-phenyl-methanone; 1-{4-Nitro-3-[4-(3-oxo-butyl)-phenoxy]-phenyl}-piperidine-4-carboxylic acid ethyl ester;
4-{4-[2-Nitro-5-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-butan-2-one; 1-[3-(4-Benzoyl-phenoxy)-4-nitro-phenyl]-piperidine-4-carboxylic acid ethyl ester; {4-[2-Nitro-5-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-phenyl-methanone; 1-{5-[4-(2-Carboxy-ethyl)-phenoxy]-2-nitro-phenyl}-piperidine-4-carboxylic acid ethyl ester; 1-(5-[4-(2-Carboxy-2-oxo-ethyl)-phenoxy]-2-vitro-phenyl}-piperidine-4-carboxylic acid ethyl ester; 1-[2-Nitro-5-(4-vinyl-phenoxy)-phenyl]-piperidine-4-carboxylic acid ethyl ester; 3-{4-[4Nitro-3-(4-propyl-piperidin-1-y1)-phenoxy]-phenyl}-propionic acid; 3-{4-[4-Nitro-3-(4-propyl-piperidin-1-y1)-phenoxy]-phenyl}-2-oxo-propionic acid; 1-[2-Nitro-5-(4-vinyl-phenoxy)-phenyl]-4-propyl-piperidine; 1-{4-[4Nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-butan-l-one; 1-{4-[4Nitro-3-(4-propyl-piperidin-l-yl)-phenoxy]-phenyl}-pentan-l-one; 1-{4-[4-Nitro-3-(4-propyl-piperidin-l-yl)-phenoxy]-phenyl}-hexan-1-one; 4-{4-[3-(4-Methoxymethyl-piperidin-1-yl)-4-nitro-phenoxy]-phenyl}-butan-2-one; 1-{4-[3-(4-Methoxymethyl-piperidin-1-yl)-4-nitro-phenoxy]-phenyl} -ethanone; {4-[3-(4-Methoxymethyl-piperidin-1 yl)-4-nitro-phenoxy]-phenyl}-phenyl-methanone; 2-(3-Methyl-[1,2,4]oxadiazol-5-yl)-1-{4-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-phenyl}-ethanone; 4-(4-{3-[4-(3-Methyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-4-nitro-phenoxy}-phenyl)-butan-2-one; 4-(4-{4-Nitro-3-[4-(pyridin-2-ylsulfanyl)-piperidin-1-yl]-phenoxy}-phenyl)-butan-2-one; 2-{1-[2-Nitro-5-(4-[1,2,4]triazol-1-yl-phenoxy)-phenyl]-piperidin-4-ylsulfanyl}-pyridine; 2-Methyl-5-{4-[4-nitro-3-(4-propyl-piperidin-l-yl)-phenoxy]-phenyl}-2H-pyrazol-3-ol; 2-[4-Nitro-3-(4-propyl-piperidin-l-yl)-phenoxy]-5-trifluoromethyl-pyridine; 5-Bromo-2-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenoxy]-pyridine; 1-(4-{4Nitro-3-[4-(pyridin-2-ylsulfanyl)-5 piperidin-1-yl]-phenoxy}-phenyl)-ethanone; 2-{ 1-[5-(4-Methanesulfonyl-phenoxy)-2-nitro-phenyl]-piperidin-4-ylsulfanyl)-pyridine; 1-{5-[4-(5-Methyl-[1,3,4]oxadiazol-2-yl)-phenoxy]-2-nitro-phenyl}-4-propyl-piperidine; 1-{5-[3-(3-Methyl-[1,2,4]oxadiazol-5-yl)-phenoxy]-2-nitro-phenyl)-4-propyl-piperidine.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/005555 include the following compound according to Formula (II) (referred to herein as Group B3): 5-Bromo-l-[4-nitro-3-(4-propyl-piperidin-1-yl)-phenyl]-1H-pyridin-2-one.
Specific examples of GPRI19 agonists disclosed in International Application No.
PCT/US2004/005555 include the following compounds according to Formula (II) (referred to herein as Group B4): 6'-Benzenesulfonylamino-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(Benzenesulfonyl-methyl-amino)-3'-nitro-3,4,5,6-tetrahydro 2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(Benzenesulfonyl-but),l-amino)-3'-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(5-Ethanesulfonyl-2-hydroxy-phenylamino)-3'-nitro-3,4,5,6-tetrahydro-2H-[ 1,2']bipyridinyl-4-carboxylic acid ethyl ester; 6'-(2-Bromo-4-trifluoromethyl-benzenesulfonylamino)-3'-nitro-3,4,5,6-tetrahydro-2H-[l,2']bipyridinyl-4-carboxylic acid ethyl ester;
{4-[3'-Nitro-4-(pyridin-2-ylsulfanyl)-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6' ylamino]-phenyl}-phenyl-methanone and [3'-Nitro-4-(pyridin-2-ylsulfanyl)-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-6'-yl]-(4-[ 1,2,4]triazo l-1-yl-phenyl)-amine.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/005555 include the following compounds according to Formula (II) (referred to herein > as Group 135): 1-[5-(4-Benzoyl-phenylamino)-2-nitro-phenyl]-piperidine-4-carboxylic acid ethyl ester and {4-[4-Nitro-3-(4-propyl-piperidin-1-yl)-phenylamino]-phenyl}-phenyl-methanone.

Examples of GPR 119 agonists are described in International Application No.
PCTIUS2004/022327 (published as WO 05/007647). Disclosed in International Application No.
PCTIUS2004/022327 as a GPRI 19 agonist is a compound of Formula (III):
D\
/~. A\E/B

Ar1'Vi`W Q.-V2 Z
(III) wherein:
A and B are each independently C1_3 alkylene optionally substituted with 1 to substituents selected from the group consisting of C1_3 alkyl, C1_4 alkoxy, carboxy, cyano, C1_3 haloalkyl and halogen;
D is 0, S, S(O), S(O)2, CR2R3 or N-R2;
E is N, C or CR4;
- - is a single bond when E is N or CR4, or a double bond when E is C;
VI is selected from the group consisting of C1.3 alkylene, ethynylene and C1_2 heteroalkylene optionally substituted with 1 to 4 substituents selected from the group consisting of C1.3 alkyl, C1-4 alkoxy, carboxy, cyano, C1.3 haloalkyl and halogen; or V 1 is a bond;
V2 is C3.6 cycloalkylene or C1.3 alkylene wherein each are optionally substituted with 1 to 4 substituents selected from the group consisting of C1_3 alkyl, C1.4 alkoxy, carboxy, cyano, C1.3 haloalkyl and halogen; or V2 is a bond;
W is NR5, 0, S, S(O) or S(O)2; or W is absent;
Q is NR6, 0, S, S(O) or S(0)2;
X is N or CR7;
Y is N or CR8;
Z is selected from the group consisting of C1.5 acyl, C1_5 acyloxy, C2.6 alkenyl, C1_4 alkoxy, C1_8 alkyl, C1_4 alkylcarboxamide, C2_6 alkynyl, C1_4 alkylthiocarboxamide, C1.4 alkylsulfonamide, CI-4 alkylsulfinyl, Ci_4 alkylsulfonyl, C1_4 alkylthio, C1_4 alkylthioureyl, C,.4 alkylureyl, amino, C1.2 alkylamino, C24 dialkylamino, carbamimidoyl, carbo-C1_6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C4.8 diacylamino, C2_6 dialkylcarboxamide, C2.6 dialkylthiocarboxamide, C7_6 dialkylsulfonamide, C2_6 dialkylsulfonylamino, formyl, Cl_4 haloalkoxy, C1.4 haloalkyl, C1_4 haloalkylcarboxamide, C1.4 haloalkylsulfinyl, C14 haloalkylsulfonyl, C1_4 haloalkylthio, halogen, aryl, heterocyclic, heteroaryl, hydroxyl, hydroxycarbamimidoyl, hydroxylamino, nitro and tetrazolyl, wherein C1_8 alkyl, C3_7 cycloalkyl, and heterocyclic are each optionally substituted with 1, 2, 3 or 4 groups selected from the group consisting of C1_5 acyl, C!_5 acyloxy, C1_4 alkoxy, C1.7 alkyl, C1.4 alkylcarboxamide, C1.4 allrylsulfonalnide, C1.4 allylsulfinyl, C1.4 alkylsulfonyl, C1-4 alkylthio, C1-4 alkylureyl, amino, C1.2 alkylamino, C24 dialkylamino, carbo-C14-alkoxy, carboxamide, carboxy, cyano, formyl, C1.4 haloalkoxy, C14 haloalkylsulfmyl, C1.4 haloalkylsulfonyl, C1.4 haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro, and wherein said C1.7 alkyl is optionally substituted with amino; or Z is a group of Formula (ILIA):
H H
l~NYN.R9 NLl Rio (IIIA) wherein:
R9 is H, Cl-8 alkyl or C3.7 cycloalkyl; and R10 is H, nitro or nitrile;
Arl is aryl or heteroaryl each optionally substituted with R11, R12, R13, R14, and R15;
wherein R11 is selected from the group consisting of C1.5 acyl, C1.6 acylsulfonamide, C1.5 acyloxy, C2.6 alkenyl, C14 alkoxy, Cl.s allcyl, C14 alkylamino, C1.6 alkylcarboxamide, C1.4 alkylthiocarboxamide, C2.6 alkynyl, C1.4 alkylsulfonamide, C1-4 alkylsulfinyl, C1.4 alkylsulfonyl, C14 alkylthio, C14 alkylthioureyl, C1.4 alkylureyl, amino, arylsulfonyl, carbamimidoyl, carbo-Cl_ 6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C3_7 cycloalkyloxy, C2.6 dialkylamino, C24 dialkylcarboxamide, C2.6 diallcylthiocarboxamide, guanidinyl, halogen, Cl-4 haloalkoxy, C14 haloalkyl, C1.4 haloalkylsulfonyl, C1.4 haloalkylsulfonyl, C1_4 haloalkylthio, heterocyclic, heterocyclic-oxy, heterocyclicsulfonyl, heterocyclic-carbonyl, heteroaryl, heteroarylcarbonyl, hydroxyl, nitro, C4.7 oxo-cycloalkyl, phenoxy, phenyl, sulfonamide, sulfonic acid, and thiol, and wherein C1.5 acyl, C1.6 acylsulfonamide, C14 alkoxy, CI-8 alkyl, C14 alkylamino, Cl.6 alkylsulfonamide, C14 allrylsulfonyl, C1.4 alkylthio, arylsulfonyl, carbamimidoyl, C2.6 dialkylamino, heterocyclic, heterocyclic-carbonyl, heteroaryl, phenoxy and phenyl are optionally substituted with 1 to 5 substituents selected independently from the group consisting of C1.5 acyl, C1.5 acyloxy, C2.6 alkenyl, C1-4 alkoxy, C1.7 alkyl, C1.4 alkylamino, C1.4 alkylcarboxamide, C2.6 allynyl, C1.4 alkylsulfonamide, C14 alkylsulfinyl, C14 alkylsulfonyl, C1.4 alkylthio, C14 alkylureyl, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C3.7 cycloalkyloxy, C2_6 dialkylamino, C2.6 dialkylcarboxamide, halogen, C14 haloalkoxy, C1.4 haloalkyl, C1.4 haloalkylsulfmyl, C14 haloalkylsulfonyl, C1_4 haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro, phenyl, and phosphonooxy, wherein said C1.7 alkyl and Cl-4 alkylcarboxamide are each optionally substituted with 1 to 5 substituents selected from the group consisting of C14 alkoxy and hydroxy; or R11 is a group of Formula (IIIB):

P 'R16 O
(IIIB) wherein:
"p" and "r" are each independently 0, 1, 2 or 3; and Rn6 is H, C1.5 acyl, C2.6 alkenyl, CI-8 alkyl, C1-4 allcylcarboxamide, C2-6 alkynyl, C.4 alkylsulfonamide, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloaikyl, C2.6 diallcylcarboxamide, halogen, heteroaryl or phenyl, and wherein the heteroaryl or phenyl optionally substituted with 1 to 5 substituents selected independently from the group consisting of C1.4 alkoxy, amino, CI-4 alkylamino, C2-6 alkynyl, C2.8 diallcylamino, halogen, CI-1 haloalkoxy, CI-4 haloalkyl and hydroxyl; and R12, R13, R14, and R15 are each independently selected form the group consisting of CI-5 acyl, CI-5 acyloxy, C2.6 alkenyl, C-4 alkoxy, C1.g alkyl, C1.4 alkylcarboxamide, C2.6 alkynyl, CI -4 allcylsulfonamide, C14 alkylsulfinyl, C1.4 alkylsulfonyl, CI-4 alkylthio, C1.4 alkylureyl, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C2.6 dialkylcarboxamide, halogen, C1.4 haloalkoxy, CI-4 haloalkyl, C1.4 haloalkylsulfonyl, C1.4 haloalkylsulfonyl, C1.4 haloalkylthio, hydroxyl and nitro; or two adjacent groups selected from the group consisting of R12, R13, R14 and R15 together with the atoms to which they are attached form a 5-, 6- or 7-membered cycloalkyl, cycloalkenyl or heterocyclic group fused with Art, wherein the 5-, 6- or 7-membered group is optionally substituted with halogen;
RI, R7 and R8 are each independently selected from the group consisting of H, C1.5 acyloxy, C2_6 alkenyl, C1.4 alkoxy, C14 alkyl, C14 alkylcarboxamide, C2.6 alkynyl, C1.4 allylsulfonamide, CI-4 allcylsulfinyl, C1.4 alkylsulfonyl, C1.4 alkylthio, C1_4 alkylureyl, amino, C1.4 alkylamino, C2.8 dialkylamino, carboxamide, cyano, C3.7 cycloalkyl, C2.6 dialkylcarboxamide, C2.
6 dialkylsulfonamide, halogen, C1.4 haloalkoxy, C14 haloalkyl, C1.4 haloalkylsuffnyl, CI-4 haloalkylsulfonyl, C1_4 haloalkylthio and hydroxyl;
R2 is selected from the group consisting of C1.8 alkyl, amino, aryl, earboxamide, carboxy, cyano, C3.6-cycloalkyl, C14 haloalkoxy, CI.4 haloalkyl, halogen, heteroaryl and hydroxyl; and wherein C1.8 alkyl, aryl or heteroaryl optionally substituted with 1 to 5 substituents selected from the group consisting of C1.5 acyl, CI-5 acyloxy, CI-4 alkoxy, CI.B alkyl, C1.4 alkylamino, C1.4 alkylcarboxamide, CM alkylthiocarboxamide, CM alkylsulfonamide, C1.4 alkylsufhnyl, C14 alkylsulfonyl, CI -4 alkylthio, C1.4 alkylthioureyl, CI-4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloalkyl, C3.6-cycloalkyl-C1.3-heteroalkylene, C2.8 dialkylamino, C2-6 dialkylcarboxamide, C2.6 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C.
4 alkylthioureyl, C14 haloalkoxy, C1.4 haloalkyl, CI-4 haloalkylsulfonyl, C1_4 haloalkylsulfonyl, C1.
4 haloalkryl, C14 haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro; or R2 is -Are-Ar3 wherein Are and Ara are each independently aryl or heteroaryl optionally substituted with Ito 5 substituents selected from the group consisting of H, C1_5 aryl, C1_3 acyloxy, C1.4 alkoxy, Cl.s alkyl, C14 alkylcarboxamide, C14 alkylthiocarboxamide, C1.4 al ylsulfinyl, C14 alkylsulfonyl, C1.4 allcylthio, amino, C14 alkylamino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloalkyl, C2.3 dialkylamino, C2_6 dialkylcarboxamide, C1.4 haloalkoxy, C1_4 haloalkyl, halogen, hydroxyl and nitro; or R2 is a group of Formula (IIIC):

`LAR1a (IIIC) wherein:
R17 is H, Cl_s alkyl, C3.7 cycloalkyl, aryl, heteroaryl or OR39; and R13 is F, Cl, Br, CN or NR25R21; where R19 is H, C1.8 alkyl or C3.7 cycloalkyl, and R2o and R21 are each independently H, Cl-8 alkyl, C3.7 cycloallcyl, aryl or heteroaryl; or R2 is a group of Formula (IIID):

(2~1 0 R 2 2 (IIID) wherein:
G is:
i) -C(O)-, -C(O)NR23-, -C(O)O-, -OC(O)NR23-, -NR23C(O)O-, -OC(O) -, -C(S)-, -C(S)NR23-, -C(S)O-, -OC(S)-, -CR23R24-, -0-, -S-, -S(O)- or -S(O)2- when D is CR2R3, or ii) -CR23R24C(O)-, -C(0)-, -CR23R24C(0)NR25-, -C(O)NR23-, -C(O)O-, C(S) , -C(S)NR23-, -C(S)O-, -CR23R24-, -S(O)2-, or a bond when D is NR2, wherein R23, RV4 and R25 are each independently H or CI-3 alkyl; and R22 is H, C1.3 alkyl, C7_6 alkynyl, C3.7 cycloalkyl, phenyl, heteroaryl, or heterocyclic each optionally substituted with i to 5 substituents selected from the group consisting of C1_5 acyl, C1_5 acyloxy, C2.6 alkenyl, C1.4 allcoxy, C1_7 alkyl, C1_4 alkylamino, C1.4 alkylcarboxamide, C14 alkylthiocarboxamide, C1.4 alkylsulfonamide, C1-4 alkylsulfinyl, C14 alkyylsulfonyi, C1-4 alkylthio, CI-4 alkylthioureyl, C1-4 alkylureyl, amino, carbo-C1_6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C2.3 dialkylamino, C2.6 dialkylcarboxamide, C2.6 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C1-4 alkylthioureyl, C1.4 haloalkoxy, C14 haloalkyl, C1.4 haloalkylsulfinyl, C1_4 haloalkylsulfonyl, Cl_ 4 haloalkyl, C14 haloalkylthio, halogen, heteroaryl, heterocyclic, hydroxyl, hydroxylamino, nitro, phenyl, phenoxy, and sulfonic acid, wherein said C1.7 alkyl, heteroaryl, phenyl and phenoxy are each optionally substituted with 1 to 5 substituents selected from the group consisting of C1.5 acyl, C1.5 acyloxy, C1.4 alkoxy, C1_8 alkyl, C14 alkylamino, C1.4 alkylcarboxamide, C1.

alkylthiocarboxamide, C14 alkylsulfonamide, C1.4 alkylsulfinyl, C1-4 alkylsulfonyl, C14 alkylthio, C1.4 alkylthioureyl, Cia alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3_7 cyoloaIkyI, C2.8 diallylamino, C2-6 dialkylcarboxamide, C2_6 diallylthiocarboxamide, C2_6 dialkylsulfonamide, C1.4 alkylthioureyl, C14 haloalkoxy, C14 haloalkyl, C1-4 haloalkylsulfinyl, C1-4 haloalkylsulfonyl, C1.4 haloalkyl, Cl-4 haloallrylthio, halogen, heterocyclic, hydroxyl, hydroxylamino, and nitro;
R3 is H, C1_$ allyl, C1.4 alkoxy orhydroxyl; and R4, R5 and R6 are each independently H, Cl.$ alkyl or C3.7 cycloalkyl, wherein said Cl-8 alkyl is optionally substituted with C1.4 alkoxy, C3a cycloalkyl, or heteroaryl.
The present invention also encompasses diastereomers as well as optical isomers, e.g.
mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and diastereomers, which arise as a consequence of structural asymmetry in certain compounds of the invention. Separation of the individual isomers or selective synthesis of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.
Specific examples of GPRI19 agonists disclosed in International Application No.
PCT/US2004/022327 include the following compounds according to Formula (III) (referred to herein as Group Cl): 3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxymethyl]-pyrrolidine-l-carboxylic acid tert-butyl ester; 4-[S-Cyano-6-(6-methylsulfanyl-pyridin-3-ylamino)-0 pyrimidin-4-yloxy]-piperiduie-l-carboxylic acid tert-butyl ester; 4-[5-Cyano-6-(6-methanesulfonyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; [6-(1-Hexyl-piperidin-4-yloxy)-5-nitro-pyrimidin-4-yl]-(4-methanesulfonyl-phenyl)-amine;
[6-(1-Cyclopropylmethyl-piperidin-4-yloxy)-5-nitro-pyrimidin-4-yl]-(4-methanesulfonyl-phenyl)-amine; 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid 5 isopropyl ester; 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid 2-isopropyl-5-methyl-cyciohexyl ester; {4-[6-(4-Methanesulfonyl-phenylamino)-S-nitro-pyrimidin-4-yloxy]-piperidin-l-yl}-pyridin-3-yl-methanone; (2-Chloro-pyridin-3-yl)-{4-[6-(4-methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; {4-[6-(4-Methanesulfonyl-phenylamino)-5 -nitro-pyrimidin-4-y loxy]-piperidin-1-yl} -pyridin-2-yl-methanone;
.0 (4-Methanesulfonyl-phenyl)-[6-(1-methanesulfonyl-piperidin-4-yloxy)-5-nitro-pyrimidin-4-yl]-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[1-(propane-l-sulfonyl)-piperidin-4-yloxy]-pyrimidin-4-yl } -amine; { 6-[ 1-(Butane-l -sulfonyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl} -(4-methanesulfonyl-phenyl)-amine; (4-Methanesulfonyl-phenyl)-{5-nitro-6-[1-(thiophene-2-sulfonyl)-piperidin-4-yloxy]-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-{6-[l-(1-methyl-lH-:5 imidazole-4-sulfonyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl) -amine; {6-[1-(2,4-Dimethyl-thiazole-5 -sulfonyl)-piperidin-4-yloxy]-5 -nitro-pyrimidin-4-yl} -(4-methanesulfonyl-phenyl)-amine;
4-[5-Cyano-6-(3-Fuoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-y loxy]-piperidine-l -carboxylic acid tert-butyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(6-Methanesulfonyl-pyridin-3-ylatnino)-5-nitro-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[5-Acetyl-6-(6-methanesulfonyl-pyridin-3-ylatnino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester;
i 4-[5-Amino-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidnie-l-carboxylic acid ethyl ester; 4-[5-Cyano-6-(4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isobutyl ester; 4-(4-Methanesulfonyl-phenylamino)-6-[1-(tetrahydro-furan-2-carbonyl)-piperidin-4-yloxy]-pyrimidine-5-carbonitrile; 4-[1-(3,3 -Dimethyl-2-oxo-butyl)-p iperidin-4-yloxy]-6-(4-methanesulfonyl-phenylamino)-pyrimidine-5-carbonitrile; 4-(4-Methanesulfonyl-phenylamino)-6-[I -(pyridine-3 -carbonyl)-piperidin-4-yloxy] -pyrimidine-5-carbonitrile; 4-(1-Formyl-piperidin-4-yloxy)-6-(4-methanesulfonyl-phenylamino)-pyrimidine-5-carbonitrile and 4-(4-Methanesulfonyl-phenylamino)-6-[I -(pyridine-2-carbonyl)-piperidin-4-yloxy]-pyrimidine-5-carbonitrile.
Specific examples of GPRI 19 agonists disclosed in International Application No.
PCTIUS2004/022327 include the following compounds according to Formula (III) (referred to herein as Group C2): 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; (4-Methanesulfonyl-phenyl)-[5-nitro-6-(piperidin-4-yloxy)-pyrimidin-4-yl]-amine; 1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-1-yl}-3,3-dimethyl-butan-1-one; (4-Methanesulfonyl-phenyl)-[5-nitro-6-(1-pyridin-2-ylmethyl-piperidin-4-yloxy)-pyrimidin-4-yl]-amine; (4-Methanesulfonyl-phenyl)-[5-nitro-6-(1-pyridin-3-ylmethyl-piperidin-4-yloxy)-pyrimidin-4-yl]-amine; {6-[1-(3,3-Dimethyl-butyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; (4-Methanesulfonyl-phenyl)-{6-[1-(3-methyl-butyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl}-amine; (4-Methanesulfonyl-phenyl)-[5-nitro-6-(3,4,5,6-tetrahydro-2H-[ 1,2']bipyridinyl-4-yloxy)-pyrimidin-4-yl]-amine; 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid ethyl ester; 1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-piperidin-l-yl } -3,3-dimethyl-butan-2-one; {6-[1-(2-Ethoxy-ethyl)-piperidin-4-yloxy]-5-nitro-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxymethyl]-piperidine-l-carboxylic acid tort-butyl ester; 4-{2-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-ethyl}-piperidine-l-carboxylic acid tort-butyl ester; 3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxy]-pyrroliduie-1-carboxylic acid tert-butyl ester and 3-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-yloxymethyl]-pyrrolidine-l-carboxylic acid tert-butyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCTIUS2004/022327 include the following compounds according to Formula (III) (referred to herein as Group C3): 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-ylamino]-piperidine-l-carboxylic acid tert-butyl ester; N-(4--IVlethanesulfonyl-phenyl)-5-nitro-N'-piperidin-4-yl-pyrimidine-4,6-diamine; 1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-ylamino]-piperidin-1-yl}-ethanone and 1-{4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro-pyrimidin-4-ylamino]-piperidin-I-yl}-2,2-dimethyl-propan-l-one.
i Specific examples of GPRI19 agonists disclosed in International Application No.
PCT/US2004/022327 include the following compounds according to Formula (III) (referred to herein as Group C4): 4-[6-(4-Cyano-2-fluoro-phenylamino)-5-ethynyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-l-yl-phenylamino)-pyriinidui-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Ethynyl-6-[l-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrimidin-4-ylamino}-3-fluoro-benzonitrile; {5-Ethynyl-6-[ 1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrimidin-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine; 4-{6-[2,5-Difluoro-4-(2-methanesulfonyl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-sulfamoyl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(6-[6-(2-Fluoro-ethyl)-2-methyl-pyridin-3-ylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester; 4-{2-[4-Fiuoro-6-(2-isopropoxy-ethyl)-pyridin-3-ylamino]-3-methyl-pyridin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-[1,2,4]triazol-l-yl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Ethynyl-6-[2-fluoro-4-(4-methoxy-pyridin-2-yl)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-propionylsulfamoyl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy } -piperidine- l-carboxylic acid isopropyl ester; and 4-{6-[2,3-Difluoro-4-(2-methanesulfonyl-ethyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester.
5 Specific examples of GPRI 19 agonists disclosed in international Application No.
PCT/US2004/022327 include the following compounds according to Formula (III) (referred to herein as Group C5): 4-[5 :? cetyl-6-(6-methanesulfonyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isobutyl ester; 1-[4-(1-Benzyl-azetidin-3-yloxy)-6-(6-methanesulfonyl-pyridin-3-ylamino)-pyrimidin-5-yl]-ethanone; 4-[5-Cyano-6-(6-propylamino-pyridin-3-ylamino)-pyrimidin-4-0 yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Cyano-6-(2-fluoro-4-isopropylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-propylainino-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-propoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Cyano-6-(6-propyl-pyridui-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-5 carboxylic acid isopropyl ester; 4-{5-Cyano-6-[4-(2-dimethylamino-ethylsulfanyl)-2-fluoro-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester;
4-{5-Cyano-6-[4-(2-dimethylamino-ethanesulfonyl)-2-fluoro-phenylamino] -3 -oxy-pyrimidin-4-yloxy } -piperidine- l -WO 2006/076231 PCT[US2006/000510 carboxylic acid isopropyl ester; 4-{5-Cyano-6-[2-fluoro-4-(4-methyl-piperdzin-1-yl)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Cyano-6-[2-fluoro-4-(3-methyl-butylamino)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester;
4-[5-Cyano-6-(2-fluoro-4-morpholin-4-yl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l -carboxylic i acid isopropyl ester; 4-{5-Cyano-6-[4-(2-dimethylamino-ethylamino)-2-fiuoro-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Cyano-6-(4-dimethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Cyano-6-[2-fluoro-4-(2-pyrrolidin-1-yl-ethylamino)-phenylamino]-pyrimidin-4-yloxy} -piperidine-l -carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Cyano-6-[2-fluoro-4-(2-morpholin-4-yl-ethylamuno)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-iodo-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Cyano-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-morpholin-4-yl-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-propoxy-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-propylamino-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2Fluoro-4-(2-methoxy-ethylamino)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[(tetrahydro-furan-2-ylmethyl)-amino]-phenylamino}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethylamino)-phenylamino]-5-methyl-pyrimidin-4-yloxy } -piperidine-l -carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[(2-methanesulfonyl-ethyl)-methyl-amino]-phenylamino}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Bromo-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid > isopropyl ester; 4-[6-(4-Cyano-2-fluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Cyano-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-morpholin-4-yl-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Chloro-2-methyl-pyridin-3-ylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Methyl-6-(2-methyl-6-morpholin-4-yl-pyridin-3-ylamino)-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester; 4-[5-(4,5-Dihydro-lH-imidazol-2-yl)-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[ I -(3-isopropyl-[1,2,4] oxadiazol-5-yl)-piperidin-4-yloxy]-5-methyl-pyrimidin-4-yl}-amine; 4-[6-(2-Fluoro-4-propoxy-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-methanesulfonyl-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-methoxy-ethoxy)-phenyl amino] -5-methyl-pyrimidin-4-yloxy} -piperidine- 1 -carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-isopropoxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Chloro-4-methyl-pyridin-3-ylamino)-5-methyI-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-(N-hydroxycarbamimidoyl)-pyrimidin-4-yloxy]-piperidine-l -i carboxylic acid isopropyl ester; 4-[5-Carbamimidoyl-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(tetrahydro-furan-2-ylmethoxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Methyl-6-(4-methyl-6-morpholin-4-yl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-{6-[6-(2-Methoxy-ethoxy)-2-methyl-pyridin-3-ylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Methoxy-ethoxy)-4-methyl-pyridin-3-ylamino]-5-methyl-pyrimidin-4-yloxy} -piperidine-l -carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-methoxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-isopropoxy-ethylsulfamoyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-> Difluoro-4-(N-hydroxycarbamimidoyl)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-i-carboxylic acid isopropyl ester; 4-[6-(4-Carbamoyl-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[(2-Fluoro-4-methanesulfonyl-phenyl)-(2-methoxy-ethyl)-amino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Carbamimidoyl-2,5-difluoro-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidine-l -carboxylic acid isopropyl ester; 4-{6-[4-(2-Ethoxy-ethoxy)-2-fluoro-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(tetrahydro-pyran-4-yloxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-hydroxy-ethoxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l -carboxylic acid isopropyl ester; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-metliyl-> pyrimidin-4-yloxy]-piperidin-1-yl}-butan-l-one; I-{4-[6-(2-Fluoro-4-metha, esulfonyl-phenylamino)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl)-pentan-l-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-met yl-pyrimidin-4-yloxy]-piperidin-1-yl}-3-methyl-butan-l-one;
4-{6-[2-Fluoro-4-(pyridin-2-ylmethoxy)-phenylamino]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[2-(2-Fluoro-4-methanesulfonyl-phenylamino)-3-methyl-pyridin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Chloro-4-fluoro-pyridin-3-ylamino)-5-cyano-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; and 4-[5-Amino-6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022327 include the following compound according to Formula (III) (referred to herein 5 as Group C6): 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-yl]-isopropyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester.

Specific examples of GPRI 19 agonists disclosed in International Application No.
PCT/1IS2004/022327 include the following compounds according to Formula (III) (referred to herein as Group C7): 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1-(3-methoxy-propyl)-piperidin-4-yloxy]-5-methyl-pyrimidine; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-3-methoxy-propan-2-ol; 4-{6-[2-Fluoro-4-(5-isopropoxymethyl-[1,2,4]oxadiazol-3-yl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(5-methoxy-pyridin-2-yl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester; 4-{6-[6-(2-Cyclopropoxy-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidin-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-.0 (pyridine-2-carbonyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methanesulfonylamino-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Methoxy-6'-methyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-5'-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
1- { 4-[6-(2-Fluoro-4-m ethanesulfonyl-phenoxy)-5 -methyl-pyrimidin-4-yloxy] -piperidin-l-yl} -2-(4-_5 trifluoromethoxy-phenoxy)-propan-1-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-2-(4-trifluoromethoxy-phenoxy)-ethanone; N-(4-Chloro-phenyl)-2-{ 4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl } -acetamide; N-(3-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-acetamide; N-(3,5-Dichloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-'.0 phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-acetamide; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl } -N-(4-trifluoromethyl-phenyl)-acetamide; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl} N-phenyl-acetamide; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrinnidin-4-yloxy]-piperidin.-1-yl}-N-(4-isopropyl-phenyl)-acetamide; 2-{4-[6-(2-Fluoro-4-methanesulfonyyi-phenexy)-5-methyl-pyrimidui-4-yloxy]-piperidin-1-yi}-N-(4-methoxy-phenyl)-acetamide; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl} -N-(3-trifluoromethyl-phenyl)-acetamide; 4- (6-[2Fluoro-4-(3-methoxy-propane-l -sulfonyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Isopropoxy-ethyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy} -p iperidine- l -carboxylic ;0 acid isopropyl ester; 4-{5-Methyl-6-[2-methyl-6-(2-pyridin-2-yl-ethoxy)-pyridin-3-yloxy]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(thiophene-2-carbonyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{6-[(2-Isopropoxy-ethyl)-methy l-amino] -2-methyl-pyridin-3 -y loxy } -5 -methyl-pyrimidin-4 -yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Isopropoxy-etharesulfonyl)-2-methyl-;5 pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Hydroxy-ethanesulfonyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l -carboxylic acid isopropyl ester; 4-[6-(6-Amino-2-methyl-pyridin-3-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-S-methyl-6-[1-(3-methyl-butyl)-piperidin-4-yloxy]-pyrimidine; 2-{4-[6-(2-Fluoro-4-rnethanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl) -1-morpholin-4-yl-ethanone; 1-(3,4-Dichloro-phenyl)-2- {4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 1-(3-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonylphenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl }-1-thiophen-3-yl-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-1-phenyl-ethanone; 1-(2,4-Dimethoxy-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrirnidin-4-yloxy] piperidin-1-yl}-0 ethanone; 4-(2-Fluoro-4-rethanesulfonyl-phenoxy)-5-methyl-6-[1-(4-methyl-pentyl)-piperidin-4-yloxy]-pyrimidine; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-3-isopropoxy-propan-l-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-rnethyl-pyrimidin-4-yloxy]-piperidin-1-yl}-4-isopropoxy-butan-l-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrirnidin-4-yloxy]-piperidin-l-yl}-3-hydroxy-propan-lone; 2-5 {4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-l-(5-pyridin-2-yl-thiophen-2-yl)-ethanone; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(5-methyl-hexyl)-piperidin-4-yloxy]-pyrimidine; 3-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-rnethyl-pyrirnidin-4-yloxy]-piperidin-1-yl} 3-oxo-propane-l-sulfonic acid; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrirnidin-4-yloxy]-piperidin-1-yl}-1 thiophen-2 yl-ethanone;
0 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-(1-pentyl-piperidin-4-yloxy)-pyrimidin; 4-(1-Butyl-piperidin-4-yloxy)-6-(2-fluoro-4-methanesulfon),l-phenoxy)-5-methylpyrimidine; 4-{4-[6-(2-'Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}
-cyclohexanecarboxylic acid; 1-(4-Diethylamino-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl } -ethanone; 2- { 4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-1-(2-methyl-4-phenyi-furan-3-yl)-ethanone; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-(i-hexyl-piperidin-4-yloxy)-5-methyl-pyri_midine; 4-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-butyric acid; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-pentan-2-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrirnidin-4-0 yloxy]-piperidin-l-yl}-hexan -one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4 yloxy]-piperidin-1-yl}-hexan-2-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl} -4-methyl-pentan-2-one; 1- {4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-5-methyl-hexan-2-one; 1-( 4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl} -6-methyl-5 heptan-2-one; 5-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-4-oxo-pentanoic acid; 5-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yi}-4-oxo-pentanenitrile; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-2-pyridin-2-yl-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-1-pyridin-4-yl-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy] -piperidin-1-ylmethyl)-acrylic acid; 1-[1,4]Dioxan-2-yI-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 1-(2,3-Dihydro-[1,4]dioxin-2-yl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy] piperidin-l-yl}-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-1-p-tolyl-ethanone;
2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-S-methyl-pyrimidin-4-yloxy]-piperidin-1 yl}-1-(4-methoxy-phenyl)-ethanone; 1-(2-Chloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-ethanone; 3-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-acetyl)-benzonitrile; 1-(2,4-Dimethyl-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl)-ethanone; 1-(4-Chloro-3-methyl-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 1-(4-Difluoromethoxy-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
1-(2,3-Dihydro-benzo[1,4]dioxin-6-yl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-1-(5-phenyl-thiophen-2-yl)-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyriridin-4-yloxy]-piperidin-1-yl}-i thiophen-2-yl-ethanone;
{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl)-acetic acid ethyl ester; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-S-methyl-pyrimidin-4-yloxy]-piperidin-l -yl} -3-methoxy-propan-2-ol; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1-(4-methoxy-cyciohexyl)-piperidin-4-yloxy]-5-methyl-pyrimidine; 1-{4-[6{2-F)uoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-hexan-l-one; 4-{6-[2-Fluoro-4-(2-isobutoxy-ethoxy)-phenoxy]-5-methyl-pyrimidin-4-yioxy}-piperidin-i-carboxylic acid isopropyl ester; 4-{6-[4-(2-Cyciopropoxy-ethoxy)-2-fluoro-phenoxy]-5-methyl-pyriridin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[4-(2-Ethoxy-ethoxy)-2-fluoro-phenoxy]-5-methyl-pyrimidin-4-yloxy} -piper idine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(3-methoxy-propoxy)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-pyridin-2-yl-ethoxy)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(tetrahydro-pyran-4-yloxy)-phenoxy]-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[4-(2-tert-Butoxy-ethoxy)-2-fluoro-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-sulfo-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-trifluoromethoxy-phenoxy)-5-ethynyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-trifluoromethoxy-phenoxy)-5-prop-1-ynyl-pyrimidin-4 yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Ethynyl-6-(2-fluoro-4-methoxy-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Ethynyl-6-(6-methoxy-4-methyl-pyridin-3-yloxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Ethynyl-6-[6-(2-isopropoxy-ethyl)-2-methyI-pyridin-3-yloxy]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Cyano-2-fluoro-phenoxy)-5-ethynyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-4-yl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-l-yl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 1-{4-[5-Ethynyl-6-(2-fluoro-4-[I,2,4]triazoI-l-yI-phenoxy)-pyrimidin-4-yloxy]-piperidin-l-yl}-3-pyridin-2-yl-propan-l-one; 4-{5-Ethynyl-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4 yloxy]-pyrimidin-4-yloxy}-3-fluoro-benzonitrile; 5-Ethynyl-4-(2-fluoro-4-rethanesulfonyl-phenoxy)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrimidine; 4-[1-(3-Ethyl-[1,2,4]oxadiazol-5-y1)-piperidin-4-yloxy]-5-ethynyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidine; 4-[1-(3-Ethyl-[1,2,4]oxadiazoI-5-yl)-piperidin-4-yloxy]-6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidine; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[I-(3-metlryl-[1,2,4]oxadiazol-5 y1)-piperidin-4-yloxy]-pyrimidine;
4-[6-(2-Fluoro-4-methanesulfonylamino-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; cis- {4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-cyclohexyl}-carbarnic acid isopropyl ester; trans- {4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-cyclohexyl}-carbamic acid isopropyl ester; N-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-cyclohexyl}-3-methyl-butyramide; N-{4-[6-{ 6-[2, 5-Difluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy }-piperidine-l -carboxylic acid isopropyl ester; 4-{6-[4-Fluoro-6-(2-methanesulfonyl-ethyl)-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Cyclopropyl-6-[2,5-difluoro-4-(2-hydroxy-ethyl)-phenoxy]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(5-Cyclopropy l-6- {2,5-diflaoro-4=[2-(4-methoxy-piperidin-i -yl)-ethyl]-phenoxy}-pyrimidin 4-yloxy)-piperidin:-1-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-morpholin-4-yI-ethyI)-phenoxy]-5-methyl-pyrinzidir,-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[2-(4-methoxy-piperidin-l-yl)-ethyl]-phenoxy} -5-methyl-pyrimidin-4-yloxy)-piperidine-l -carboxylic acid isopropyl ester; 4-{6-[6-(2-Fluoro-ethyl)-2-methyl-pyridin-3-yloxy]-5-methyl-0 pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(1-hydroxy-cyclopropylmethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{2-[2,5-Difluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-3-methyl-pyridin-4 yloxy}-piperidine-l-carboxylic acid isopropyl ester; (R)-4-(6-{2-Fluoro-4-[2-(3-methoxy-piperidin-1-yl)-ethyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; (S)-4-(6-5 {2-Fluoro-4-[2-(3-methoxy-piperidui-1-yl)-ethyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester; (R)-4-(5-Ethynyl-6-{2-fluoro-4-[2-(2-methoxy-piperidin-l-yl)-ethyl]-phenoxy}-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; (S)-4-(2-{2-Fluoro-4-[2-(2-methoxy-piperidin- l -yl)-ethyl]-plienoxy)-3-metliyl-pyridiii-4-yloxy)-piperidiiie-I -carboxylic acid isopropyl ester; 4-{6-[4-Fluoro-6-(2-morpholin-4-y1-ethyl)-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Ethynyl-6-[4-fluoro-6-(2-methanesulfonyl-ethyl)-pyridin-3-yloxy]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl i ester; 4-{2-[2,5-Difluoro-4-(2-isopropoxy-ethyl)-phenoxy]-3-methyl-pyridin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-propionylsulfamoyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-sulfamoyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-sulfamoyl-ethyl)-phenoxy]-5-ethynyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-[1,2,4]triazol-l-yl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,3-Difluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(2-{2-Fluoro-4-[2-(6-methoxy-pyridin-2-yl)-ethyl]-phenoxy} -3-methyl-pyridin-4-yloxy)-piperidine- l-carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[2-(3-methoxy-pyridin-2-yl)-ethyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3-Fluoro-l-oxy-pyridin-4-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5'-Methox.y-6-methyl-[2,2']bipyridinyl-5-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{5-Ethynyl-6-[2-fluoro-4-(4-methoxy-pyridin-2-yl)-phenoxy]-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(3-methoxy-pyridin-2-yl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{2,5-Difluoro-4-[2-(3-methoxy-piperidin-l -yl)-ethyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l -carboxylic acid isopropyl ester; and 4-(6-{2,5-Difluoro-4-[2-(3-methoxy-piperidin-l-yl)-ethyl]-phenoxy}-5-ethynyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/02232 7 include the following compounds according to Formula (I11) (referred to herein as Group CS): 4-[6-(2-Fluoro-4-morpholin-4-yl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; {4-[6-(2-Fluoro-4-methanesulfonyi-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-[6-(2-pyrrolidin-1-yl-ethyl)-pyridin-3-yl]-methanone;
(6-Amino-pyridin-3-yl)-{ 4-[ 6-(2 -fluoro-4-methanesulfonyl-phenoxy)-5-metlryl-pyrimidin-4-yloxy] -piperidin- l -yl } -methanone; 4-[5-Ethyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Isopropoxy-ethyIamino)-2-methyl -pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Hydroxy-ethylsulfanyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrnnidin-4-yloxy} -piperidine-l-carboxylic acid isopropyl ester; 4-[5-Methyl-6-(2-methyl-6-pentyl-pyridin-3-yloxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl} -1-(3-fluoro-phenyl)-ethanone; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-6-[1-(2-pyridin-3-yl-ethyl)-piperidin-4-yloxy)-pyrimidine; 2-{4-[6-(2-Fluoro-4-methan esulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl } -1-(4-trifluoromethoxy-phenyl)-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-1-pyridin-2-yl-ethanone; 4-{6-[6-(2-Methoxy-ethanesulfonyl)-2-methyl-pyridin-3-yloxy]-5amethyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[ 1-(3 -isopropyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-4-yloxy]-5 -methyl-pyrimidine; 4-(6-{2-Fluoro-4-[(2-hydroxy-ethylcarbamoyl)-methyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Iodo-pyridin-2-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[N-(2-isopropoxy-D ethyl)-carbamimidoyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-I-carboxylic acid isopropyl ester; 4-[6-(4-Carboxy-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(4-Bromo-2-fluoro-phenoxy)-6-[1-(3-isopropyl-[
1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-5-methyl-pyrimidine; 4-[6-(5-Methanesulfonyl-pyridin-2-yloxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2 Hydroxy-ethylamino)-2-methyl-pyridin-3-yloxy)-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester, 4-[5-Cyclopropyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(2-Methanesulfonyl-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-4-oxo-butyric acid; 2-{4-[6-0 (2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-1-(3-trifluoromethyl-phenyl)-ethanone; 4-{6-[6-(2-Methoxy-ethylsulfanyl)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 1-(2,5-Dimethoxy-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-5 yl)-1-pyridin-2-yl-ethanone; 4-[6-(6-Chloro-2-methyl-pyridin-3-yloxy)-5-methyl-pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy)-piperidin-1-yl}-1-(4-fluoro-phenyl)-ethanone; 2-{4-[6-(2-Fluoro-4-meth anesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl } -1-(4-trifluoromethyl-phenyl)-ethanone; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-0 piperidin-1-yl}-3,3-dimethyl-butan-2-one; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-l-pyridin-3-yl-ethanone; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-butan-2-one; 4-(6-(2-Fluoro-4-[(2-isopropoxy-ethylcarbamoyl)-methyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l -carboxylic acid isopropyl ester; 2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-;5 piperidin-l-yl}-1-(4-methanesulfonyl-phenyl)-ethanone; 1-(4-Cliloro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone;
4-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin- l -yl) -acetyl)-benzonitrile; 1-(3,4-Difluoro-phenyl)-2-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 4-{6-[2-Fluoro-4-(2-isopropoxy-ethylcarbamoyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-butan-l-one; 1-{4-i [6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-pentan-l-one; 4-[6-(2,4-Difluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl} 31-methyl-butan-l-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-4-methyl-pentan-l-one; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-5-methyl-hexan-l-one; 4-{6-[2-Fluoro-4-(2-methoxy-ethylcarbamoyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy } -piperidine-l -carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(4-Bromo-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(methoxy-methyl-carbamoyl)-> phenoxy]-5-metlryl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy] -p iperidin- l -yl } -3 -methoxy-propan-1-one; 4-[6-(4-Cyano-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-(5-Aminomethyl-4,5-dihydro-oxazol-2-yl)-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-) (2-Methoxy-ethylamino)-2-methyl-pyridin-3-yloxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[6-(3 -,Methanesulfonyl-pyrrolidin-1-yl)-2-methyl-pyridin-3-yloxy]-5-metlryl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Benzylamino-2-methyl-pyridin-3-yloxy)-5-methyl-pyrunidin-4-vloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Carbamoyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-> carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-isopropoxy-ethylamino)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[(tetrahydro-furan-2-ylmethyl)-amino]-phenoxy} -5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{6-[(2-Methanesulfonyl-ethyl)-methyl-amino]-2-methyl-pyridin-3-yloxy} -5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-hydroxycarbamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(6-[2-Fluoro-4-(2-pyrrolidin-1-yl-ethylcarbamoyl)-phenoxy]-5-metlryl-pyrimidin-4-yloxy } -piperidine-l -carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(4-isopropyl-piperazine-l-carbonyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-morpholin-4-yl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-1 Fluoro-4-(2-methanesulfonyl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-hydroxy-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Carboxymethyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Dimethylcarbamoylmethyl-2-fluoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-sulfamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-propionylsulfamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Ethynyl-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-phosphonooxy-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[5-Bromo-6-(2-fluoro-4-methanesulfonyl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(6-{2-Fluoro-4-[2-(2-methanesulfonyl-pyrrolidin-l-yl)-2-oxo-ethyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-CarbamoylmethyI-2-fiuoro-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4- { [(tetrahydro-furan-2-ylmethyl)-carbamoyl]-methyl }-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-3-sulfamoyl-phenoxy)-5-methyl-pyrimidin-4-yloxyl-piperidine-l-carboxylic acid isopropyl ester; C-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin- l -yl } -C-(4-fluoro-phenyl)-methyleneamine; 3-tert-Butoxy-l-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-propan-l-one; 2-Ethoxy-l-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; {4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-(tetrahydro-furan-2-yl)-methanone;
(S)-1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl}-3-methyl-2-methylamino-butan-l-one; 4-(6-{2-Fluoro-4-[2-(3-hydroxy-piperidin 1-yl)-2-oxo-ethyl]-phenoxy}-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-morpholin-4-yl-2-oxo-ethyl)-phenoxy]-5-methyl-pyrimidin-4 yloxy}-piperidine-1-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-imidazol-1-yl-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2-Fluoro-4-(2-[1,2,3]triazol-i-yi-ethyl)-phenoxy]-5-methyl-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; (R)-1-{4-{6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl} -3-methyl-2-m ethylamino-butan-l-one; (S)-1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-i-yi}-3-hydroxy-butan-l-one; (R)-N-(1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carbonyl} methyl-propyl)-acetamide; (S)-N-(l-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l -carbonyl} -2-methyl-propyl)-acetamide; (R)-N-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-l-methyl-2-oxo-ethyl)-acetamide; (S)-N-(2-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-1-yl} -1-methyl-2-oxo-ethyl)-> acetamide; 4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid (S)-tetrahydro-furan-3-yl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid (R)-tetrahydro-furan-3 yl ester; 4-[6-(2-Amino-4-ethanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine- l -carboxylic acid isopropyl ester; 4-[6-(4-Methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; (1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidine-l-carbonyl}-2-methyl-propyl)-carbamic acid tert-butyl ester; 4-{6-[2-Fluoro-4-(6-methoxy-pyridin-3-yl)-phenoxy]-5-methyl-pyrimidin-4-yloxy }-piperidine-l-carboxylic acid isopropyl ester; 3-Amino-l-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl}-4-methyl-pentan-l-one; 2-Amino-l-{4-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yloxy]-piperidin-l-yl }-3-methyl-butan-l-one; 4-{6-[2-Fluoro-4-(2-isopropoxy-ethoxy)-phenoxy]-5-methyl-pyrimidin-4-yloxy } -piperidine-l -carboxylic acid isopropyl ester; and 4-[5-Methyl-6-(4-sulfo-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester.
Specific examples of GPR 119 agonists disclosed in International Application No.
PCT/US2004/022327 include the following compounds according to Formula (III) (referred to herein as Group C9): 4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yl] -amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yl]-amino } -methyl)-piperidine-l-carboxylic acid isopropyl ester; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yl]-isopropyl-amino}-methyl)-piperidine-l-carboxylic acid isopropyl ester;
and 4-({ Cyclopropylmethyl-[6-(2-fluoro-4-methanesulfonyl-phenoxy)-5-methyl-pyrimidin-4-yl]-amino } -methyl)-piperidine-l-carboxylic acid isopropyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCTIUS2004/022327 include the following compound according to Formula (III) (referred to herein as Group C10): 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-5-methyl-pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid isopropyl ester.
Examples of GPRI 19 agonists are described in International Application No.
PCT/US2004/022417 (published as WO 05/007658). Disclosed in International Application No.
PCTIUS2004/022417 as a GPR119 agonist is a compound of Formula (IV):
A,., K 1 DAB ZOI
TU v I
Art (IV) wherein:
A and B are each independently C1.3 alkylene optionally substituted with 1 to substituents selected from the group consisting of C1_3 alkyl, C1.4 alkoxy, carboxy, cyano, C1.3 haloalkyl and halogen;

D is 0, S, S(0), S(0)2, CR1R2 or N-R2, wherein R1 is selected from the group consisting of H, C1.8 alkyl, CIA alkoxy, halogen and hydroxyl;
E is N, C or CR3, wherein R3 is H or C1.s alkyl;
is a single bond when E is N or CR3, or a double bond when E is C;
K is a C3.6 cycloalkylene or CI-3 alkylene wherein each are optionally substituted with I
to 4 substituents selected from the group consisting of C1_3 alkyl, CIA
alkoxy, carboxy, cyano, C1.
3 haloallyl and halogen; or K is a bond;
Q is NRA, 0, S, S(O) or S(0)2, wherein R4 is H or C1.8 alkyl and the Cl_8 allcyl is optionally substituted with C2.8 dialkylamine;
T is N or CR5;
M is N or CR6i JisNorCR7;
UisCorN;
V is N, CR8 or V is a bond;
W is N or C;
Xis 0, S, N, CR9 or NRI1;
Y is 0, S, N, CRto or NR12;
Z is C or N;
R5, R6, R7, R8, R9 and Rio are each independently selected from the group consisting of H, C1.5 acyloxy, C2.6 allcenyl, CIA alkoxy, C1.8 alkyl, CIA alkylcarboxamide, C2_6 alkynyl, CIA
alkylsulfonamide, C1.4 alkylsulfinyl, C1A alkylsulfonyl, C1.4 alkylthio, CI.4 alkylureyl, amino, CIA
alkylamino, C2.8 dialkylamino, carboxamide, cyano, C34 cycloalkyl, C2_6 dialkylcarboxamide, C2.
6 dialkylsulfonamide, halogen, CIA haloalkoxy, CIA haloalkyl, C1-+4 haloalkylsulfunyl, C14 haloallylsulfonyl, C14 haloallcylthio, hydroxyl, hydroxylamino and nitro;
wherein said C2_6 alkenyl, C1.8 alkyl, C2.6 alkynyl and C3.6 cycloalkyl are optionally substituted with 1, 2, 3 or 4 substituents selected from the group consisting of C1.5 acyl, C1.5 acyloxy, C14 alkoxy, C1.4 allcylamino, C1.4 alkylcarboxamide, CIA alkylthiocarboxamide, C14 alkylsulfonamide, CIA
alkylsulfinyl, CIA alkylsulfonyl, CIA alkylthio, CIA alkylthioureyl, CIA
alkylureyl, amino, carbo-C3.6-allcoxy, carboxamide, carboxy, cyano, C2.8 dialkylamino, C2.6 dialkylcarboxamide, CIA
dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C14 alkylthioureyl, CIA
haloalkoxy, CIA
haloalkyl, CIA haloallylsulfinyl, CIA haloalkylsulfonyl, CIA haloalkyl, CIA
haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro;
R11 and R12 are each independently selected from C2.6 alkenyl, C1.8 alkyl, C2.6 alkynyl or C3.6 cycloalkyl each optionally substituted with 1, 2, 3 or 4 substituents selected from the group consisting of C1.5 acyl, CI.5 acyloxy, CIA alkoxy, CIA allcylamino, CIA
alkylcarboxamide, CIA
alkylthiocarboxamide, C14 alkylsulfonamide, C1-4 alkylsulfmyl, CIA
alkylsulfonyl, CIA alkylthio, CIA alkylthioureyl, C14 alkylureyl, amino, carbo-Cl.6-alkoxy, carboxamide, carboxy, cyano, C2_8 dialkylamino, C2.6 dialkylcarboxamide, C1-4 diallylthiocarboxamide, C2.6 dialkylsulfonamide, Cl_ 4 alkylthioureyl, Cl-4 haloalkoxy, CI -4 haloalkyl, C1.4 haloalkylsulfinyl, C1-4 haloalkylsulfonyl, Cl_ 4 haloalkyl, C1.4 haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro;
Arl is aryl or heteroaryl each optionally substituted with R13, R14, R15, R16, and R17;
wherein R13 is selected from the group consisting of C1.5 acyl, C1.6 acylsulfonamide, CI-.5 acyloxy, C2.6 alkenyl, C1.4 alkoxy, Cl.s alkyl, C1.4 allcylalnino, C1.6 alkylcarboxamide, C1.4 alkylthiocarboxamide, C2_6 alkynyl, C14 alkylsulfonamide, C1.4 alkylsulfinyl, C1.4 alkylsulfonyl, C14 alkylthio, C14 alkylthioureyl, C1.4 alkylureyl, amino, arylsuifonyl, carbamhnidoyl, carbo-C1.
6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C3.7 cycloalkyloxy, C2.6 diallylamino, C2-6 dialkylcarboxamide, C2-6 dialkylthiocarboxamide, guanidinyl, halogen, C1.4 haloalkoxy, C14 haloallyl, C1.4 haloalkylsulfinyl, C14 haloallylsulfonyl, C14 haloalkylthio, heterocyclic, heterocyclic-oxy, heterocyclicsulfonyl, heterocyclic-carbonyl, heteroaryl, heteroarylcarbonyl, hydroxyl, nitro, C4-7 oxo-cycloalkyl, phenoxy, phenyl, sulfonamide, sulfonic acid, and thiol, and wherein said C1.5 acyl, C1_6 acylsulfonamide, C14 alkoxy, C1.8 alkyl, C1_4 alkylamino, C1.6 allcylsulfonamide, C1.4 alkylsulfonyl, C1_4 alkylthio, arylsulfonyl, carbaminudoyl, C2.6 dialkylamino, heterocyclic, heterocyclic-carbonyl, heteroaryl, phenoxy and phenyl are optionally substituted with 1 to 5 substituents selected independently from the group consisting of C1.5 acyl, CI-5 acyloxy, C2.6 alkenyl, CI -4 alkoxy, C1.7 alkyl, C1.4 alkylamino, C14 alkylcarboxamide, C2.6 alkynyl, C1 4 alkylsulfonamide, Cl_4 alkylsulfonyl, C1.4 alkylsulfonyl, C14 alkylthio, C1.4 alkylureyl, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C3.7 cycloalkyloxy, C2-6 dialkylamino, C2.6 dialkylcarboxamide, halogen, C1.4 haloalkoxy, C14 haloalkyl, C14 haloalkylsulfinyl, C1.4 haloalkylsulfonyl, C1.4 haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro, phenyl, and phosphonooxy, and wherein said C1.7 alkyl and C1.4 alkylcarboxamide are each optionally substituted with 1 to 5 substituents selected from the group consisting of C1-4 allcoxy and hydroxy; or R13 is a group of Formula (Pv'A):
IAPrR18 O
(TVA) wherein:
"p" and "r" are independently 0, 1, 2 or 3; and R18 is H, C1_5 acyl, 62.6 alkenyl, C1.8 allcyl, C1_4 alkylcarboxamide, C2.6 alkynyl, C14 allylsulfonamide, carbo-Cl.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C2.6 dialkylcarboxamide, halogen, heteroaryl or phenyl, and wherein said heteroaryl or phenyl optionally substituted with 1 to 5 substituents selected independently from the group consisting of C14 alkoxy, amino, C1-4 alkrylamino, C2.6 alkynyl, C7-8 dialkylamino, halogen, C1-4 haloalkoxy, Cl-4 haloalkyl and hydroxyl;
R14, R15, R16, and R17 are each independently selected form the group consisting of H, Cl.
acyl, C1.5 acyloxy, C2-6 alkenyl, C1.4 alkoxy, C1.8 alkyl, C1-4 alkylcarboxamide, C2.6 alkynyl, C14 alkylsulfonamide, C1.4 allcylsulfinyl, C1.4 alkylsulfonyl, C1-4 alkylthio, Cl-4 alkylureyl, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C2-6 dia kylcarboxamide, halogen, C1.4 haioalkoxy, C1.4 haloalkyl, C14 haloalkylsulfinyl, C1-4 haloalkylsulfonyl, C1.4 haloalkylthio, hydroxyl and nitro; or two adjacent R14, R15, R16 and R17 together with the atoms to which they are attached form a 5, 6 or 7 member cycloalkyl, cycloalkenyl or heterocyclic group fused with Art wherein the 5, 6 or 7 member group is optionally substituted with halogen; and R2 is selected from the group consisting of C1.8 allryl, C2-6 alkynyl, amino, aryl, carboxamide, carboxy, cyano, C3-6-cycloallcyl, C1.4 haloalkoxy, CI-4 haloalkyl, halogen, heteroaryl and hydroxyl; and wherein said C1.8 alkyl, aryl and heteroaryl are each optionally substituted with 1 to 5 substituents selected from the group consisting of C1_5 acyl, C1_5 acyloxy, C1.4 alkoxy, Cl-8 alkyl, C14 alkylamino, C1.4 allcylcarboxamide, C1.4 alkylthiocarboxamide, C14 allcylsulfonamide, C14 alkylsulfinyl, C1.4 alkylsulfonyl, C1.4 alkylthio, C1.4 alkylthioureyl, C1.4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.6-cycloalkyl, C3-6-cycloalkyl-C3.3-heteroalkylene, C2-8 dialkylamino, C2-6 diallcylcarboxamide, diakithiocarboxamide, C2-6 dialkylsulfonamide, C1.4 alkylthioureyl, C14 haloalkoxy, C1.4 haloalkyl, C1-4 haloalkylsulfmyl, C14 haloalkylsulfonyl, C1.4 haloalkyl, C1-4 haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro; or R2 is -Are-.Ar3 wherein Are and Ara are each independently aryl or heteroaryl each optionally substituted with i to 5 substituents selected from the group consisting of H, CI-5 aryl, C1.5 acyloxy, C1.4 alkoxy, C1-S alkyl, C14 alkylcarboxarnide, C1-4 alkylthiocarboxamide, C1-4 alkylsulfmyl, C14 alkylsulfonyl, C14 allylthio, amino, C1-4 alkylamino, carbo-Cl-6-alkoxy, carboxamide, carboxy, cyan, C3.6-cycloalkyl, C2.8 dialkylamino, C2.6 dialkylcarboxamide, C14 haloalkoxy, C1 4 haloalkyl, halogen, hydroxyl and nitro; or R2 is a group of Formula (IVB):

`2A R20 (rVB) wherein:
R19 is H, C1.8 alkyl, C3-7 cycloalkyl, aryl, heteroaryl or OR21; and R20 is F, Cl, Br, CN or NR2-,R73; where R21 is H, C1.8 alkyl or C3.7 cycloalkyl, and R_2 and R23 are independently H, C1.8 alkyl, C3.7 cycloalkyl, aryl or heteroaryl;

or R2 is a group of Formula (IVC):

`, G

(IVC) wherein:
G is:
i) -C(O)-, -C(O)NR25-, -NR25C(O)-, NR25-, -NR25C(O)0-, -OC(O)NR25-, -CR25R26NR27C(O)-, -CR25R26C(O)NR27-,-C(O)O-, -OC(O)-, -C(S)-, -C(S)NR25-, -C(S)O-, -OC(S)-, -CR25R26-, -0-, -S-, -S(O)-, -S(O)2- or a bond when D is CR2R3; or ii) -CR25R26C(O)-, -C(O)-, -CR25R26C(O)NR27-, -C(O)NR25-, -C(O)O-, -C(S)-, -C(S)NR25-, -C(S)O-, -CR25R26-, -S(O)2-, or a bond when D is NR2;
wherein R25, R26 and R27 are each independently H or C1.8 alkyl; and R24 is H, C1.8 alkyl, C3.7 cycloalkyl, phenyl, heteroaryl, or heterocyclic each optionally substituted with Ito 5 substituents selected from the group consisting of C1.5 acyl, C2-5 acyloxy, C2_6 alkenyl, C1.4 alkoxy, C1-7 alkyl, C1-1 alkylamino, C14 alkylcarboxamide, C14 allVithiocarboxamide, C14 alkylsulfonamide, C14 alkylsulfinyl, C14 alkylsulfonyl, C1.4 alkylthio, C1-4 alkylthioureyl, Cl-4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C2.3 dialkylamino, C2-6 dialkylcarboxamide, C2.6 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, C1.
4 alkylthioureyl, CI-4 haloalkoxy, C1-4 haloalkyl, Ct-a haloalkylsulfinyl, Cl4 haloalkylsulfonyl, Cl_ 4 haloalkyl, C1.4 haloalkylthio, halogen, heteroaryl, heterocyclic, hydroxyl, hydroxylamino, nitro, phenyl, phenoxy, and sulfonic acid, wherein said C14 alkoxy, C1.7 alkyl, C1-4 alkylamino, heteroaryl, phenyl and phenoxy are each optionally substituted with 1 to , substituents selected from the group consisting of C1.5 acyl, Cl_5 acyloxy, C1.4 alkoxy, Cu-s alkyl, C1_4 alkylamino, C14 alkylcarboxamide, C14 alkylthiocarboxamide, C1-4 alkylsulfonamide, C.,4 alkylsulfmyl, C1-4 alkylsulfonyl, C1_4 alkylthio, Ct-a allcylthioureyl, C1.4 alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, Cgs dialkylamino, C2-6 dialkylcarboxamide, C2.6 dialkylthiocarboxamide, CZ_6 dialkylsulfonamide, C;.4 alkylthioureyl, C1.4 haloalkoxy, C1.4 haloalkyl, C14 haloallylsulfinyl, C14 haloallryisulfonyl, C14 haloalkyl, C1.4 haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino, nitro, and phenyl;
provided that Z and U are not both N.
The present invention also encompasses diastereomers as well as optical isomers, e.g.
mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and diastereomers, which arise as a consequence of structural asymmetry in certain compounds of the invention. Separation of the individual isomers or selective synthesis of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.

Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D1): 4-[1-(4-Metltanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-3-methyl-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-3,6-dimethyl-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isobutyl ester; 4-[1-(4-Metltanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 1-(4-Methanesulfonyl-phenyl)-4-(piperidin-4-yloxy)-1H-J pyrazolo[3,4-d]pyrimidine; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-pyridin-3-yl-methanone; (3-Fluoro-phenyl)-{4-[l-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (1-tert-Butyl-5-methyl-lH-pyrazol-4-yl)-{4-[ 1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; (5-tert-Butyl-2-methyl-2H-pyrazol-3-yl)-{4-[l-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidine-l-carboxylic acid tert-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidine-l-carboxylic acid isopropyl ester; 441 -(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidine-1-carboxylic acid isobutyl ester; Furan-2-yl-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; {4-[I-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-(l-methyl-lH-pyrrol-2-yl)-methanone; 2-{4-[ 1-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin-l -yl} -1-pyridu1-3-yl-ethanone; 2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-l-pyridin-2-yl-ethanone; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-foxy]-piperidin-1-yi}-(5-methyl-pyrid'ut-3-yi)-methanone; {4-[1-(4-:vlethanesulfonyi-phenyl)-iH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(2-methyl-pyridin-3-yl)-methanone; {4-[l-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxv]-p iperidin- l-yl} -(6-methyl-pyridin-3-yl)-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-(5-methyl-isoxazol-3-yi)-methanone; 2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidi*t-1-yl}-1-thiophen-2-yl-ethanone; 4-(1-Benzyi-azetidin-3-yloxy)-I-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidine; 3-[1-(4 ,Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamitto]-piperidine-l-carboxylic acid tert-butyl ester; 1-{4-[1-(4-Methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1 yl}-3,3-dimethyl-butan-2-one; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-pyrazin-2-yl-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(5-methyl-pyrazin-2yl)-methanone; {4-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo [3 ,4-d] pyrimidin-4-yloxy]-piperidin-1-yl} -pyrimidin-5-yl-methanone; {4-[I-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy] piperidin-1-yl}-pyridazin-4-y1-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l -yl)-thiophen-2-yl-methanone; (3,4-Dimethyl-isoxazol-5-yl)-{4-[1-(4-methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 3-tert-Butoxy-l-{4-[1-(4-5 methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4 yloxy]-piperidin-1-yl}-propan-l-one; (3-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl} -3-oxo-propyl)-methyl-carbamic acid tert-butyl ester; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidin-1-yl}-(6-trifluoromethyl-pyridin-3-yl)-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d)pyrimidin-4-ylamino]-cyclohexyl}-carbamic acid tert-butyl ester; N-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-cyclohexane-1,4-diamine; {4-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-(4-methyl-[1,2,3]thiadiazol-5-yl)-methanone; (3,5-Dimethyl-isoxazol-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1 yl}-methanone; (2,5-Dimethyl-2H-pyrazol-3-yl)-{4-[ 1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l -5 yl}-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(3-methyl-isoxazol-5-yl)-methanone; 4-[1-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carbothioie acid pyridin-4-ylamide; N-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexyl}-nicotinamide; 3-tert-Butoxy-N-{4-[l-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexyl}-propionamide; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexyl}-carbamic acid tert-butyl ester; (3,5-Dimethyl-isoxazoI-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; 4-[1-(3,5-Bis-trifluoromethyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-=4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 3-[1-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-azetidine-l-carboxylic acid 5 isopropyl ester; 4-[1-(4-lvlethanesulfonyl-phenyl)-iH-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidilue-1-carboxylic acid butyl ester; 4-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid propyl ester; 4-[l-(3-Fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[1-(2,4-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperiduie-l-carboxylic acid tert-butyl ester; {4-[1-(2,4-Difluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexyl}-carbamic acid tert-butyl ester; {4-[1-(3-Fluoro-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexyl)-carbamic acid tort-butyl ester; N-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-cyclohexane-l,4-diamine; {3-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidin-l-yl}-(6-methyl-pyridin-3-yl)-methanone; {3-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-5 d]pyrimidin-4-ylamino]-piperidin-l-yl}-(2-methyl-pyridin-3-yl)-methanone; {3-[l-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidin-l-yl}-(5-methyl-pyridin-3-yl)-methanone; {3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidin-1-yl}-pyridin-3-yl-methanone; {3-[ 1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidin-1-yl)-(1-inethyl-lH-pyrrol-3-yl)-methanone; {4-[l-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d3pyrimidin-4-yloxy]-cyclohexyl}-carbamic acid tert-butyl ester; N-[1-(2,4-Difluoro-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yl]-cyclohexane-1,4-diamine;
{ 4-[ 1-(4-Methanesulfonyl-ph enyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin- l -yl} -(4-trifluoromethyl-pyridin-3-yl)-methanone; 4-[1-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid cyclohexyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tetrahydro-pyran-4-yl ester; 4-[1-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid cyclopentyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tetrahydro-furan-3-yl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tetrahydro-furan-3-yl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tetrahydro-thiopyran-4-yl ester; 4-[1-(4-Methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid cyclobutyl ester; (6-tert-Butyl-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; (4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-methyl} -cyclohexyl)-carbamic acid tent-butyl ester; N-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexylmethyl}-nicotinamide; N-{4-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-cyclohexylmethyl}-6-methyl-nicotinamide; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-({[1-(4-Methanesulfonyl-phenyl)-1 H-pyrazo lo[3,4-d]pyrimidin-4-yl]-methyl-amino} -methyl)-piperidine-l -carboxylic acid tert-butyl ester; 4-{[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-methyl}-piperidine-l-carboxylic acid tert-butyl ester; 3-{[l-(4-Methanesulfonyl-phenyl)-iH-pyrazolo[3,4-d]pyrimidin-4-ylamino]-methyl}-piperidine-i-carboxylic acid tert-butyl ester; 4-((Ethyl-11-(4-methanesulfon),l-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl3-amino}-methyl)-piperidine-i-carboxylic acid tort-butyl ester; 4-{ 1-[2-(2-Ditnethyiamino-ethoxy)-4-methanesuifonyl-phenyl]-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-l-carboxylic acid tert-butyl ester; 3-fl-(2-Fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-ylamino]-piperidine-l -carboxylic acid tert-butyl ester; 4-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4.yloxy]-piperidine-l-carboxylic acid pyridin-3-ylmethyl esteracid tert-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid 2-pyridin-3-yl-ethyl ester; 4-[l-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid 3-pyridin-3-yl-propyl ester; 4-[l-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidui-4-yloxy]-piperidine-l-carboxylic acid 2-dimethylamino-ethyl ester;
4-{[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-methyl-amino} -piperidine-l -carboxylic acid tert-butyl ester; 4-[1-(2,4-Difluoro-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-({Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid isopropyl ester;
4-({Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-amino} -methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-Dimethylamino-l-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 1-(4-{[1-(4.-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4 yl]-methyl-amino}-piperidin-1-yl)-3,3-dimethyl-butari-2-one;
4- { [1-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yl]-methyl-amino} -piperidine-l-carboxylic acid cyclobutyl ester; and 4-[({1-[4-(2-Methanesulfonyl-ethyl)-phenyl]-1H-pyrazolo[3,4-d]pyrimidin-4-yl}-methyl-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D2): 4-({[1-(2,5-Difluorophenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-1-(4-trifluoromethoxy-phenyl)-ethanone; 2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-1-(3-fluoro-phenyl)-ethanone; 2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidhn-4-yloxy]-piperidin-1-yl}-l-pyridin-2-yl-ethanone; (2,5-Dimethyl-furan-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 4-({(2-Dimethylamino-ethyl)-[ 1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yl]-amino} -methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({(2-Dimethylamino-ethyl)-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yl] -amino } -methyl)-piperidin- l -carboxylic acid tert-butyl ester; 4-[1-(2-Dimethylamino-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperiduie-l-carboxylic acid tort-butyl ester; 4-(2-{Ethyl-[1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yl]-amino} -ethyl)-piperazine-l -carboxylic acid tort-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid tent-butyl ester; 4-{2-[1-(4-Methanesulfonyl-phenyl)-1H-pyrtzolo[3,4-d]pyrimidin-4-yloxy]-ethyl}-piperazine-l-carboxylic acid ethyl ester; 4-{2-[l-(4-Methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-propyl}-piperazine-l-carboxylic acid ethyl ester; 4-[ 1-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d] pyrimidine-4-sulfmyl]-piperidin-l-carboxylic acid tort-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidine-4-sulfonyl]-piperidine-1-carboxylic acid tert-butyl ester; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid butyl ester; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid 2-methoxy-ethyl ester; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid 3,3-dimethyl-butyl ester; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-I H-pyrazolo [3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l -carboxylic acid 4-methyl-pentyl ester; 4-[I-(2-Fluoro-4-methanesulfonyl-phenyI)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid cyclopropylmethyl ester; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid cyclobutylmethyl ester; 4-[I-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid 2-cyclopropyl-ethyl ester; (5-Bromo-furan-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidin-1-yl}-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyJ-piperid'ui-1-yl)-(5-morpholin-4-ylmethyl-furan-2-yl)-methanone; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid penty] ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-I-carboxylic acid 1-ethyl-propyl ester; 4-[l-(4-Methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-1-carboxylic acid 2-ethyl-butyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid cyclopentylmethyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyJ-piperidine-l-carboxylic acid 2-pyrrolidin-1-yl-ethyl ester; 4-[I-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyJ-piperidine-l-carboxylic acid 2-morpholin-4-yl-ethyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid ethyl ester; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyJ-piperidine-l-carboxylic acid 2,2-dimethyl-propyl ester; (5-Butyl-pyridin-2-yl)- {4-[1-(4-methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; Ethyl-[1-(2-fluoro-4-methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yl]-(3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-ylmethyl)-amine; Ethyl-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin--4-yl]-(5'-trifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-ylmethyl)-amine; [1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-(5'-trifluoromethyl-3, 4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-yl)-amine;
4-[1-(2-Fluoro-4-21 5 methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyJ-piperidin-l-carboxylic acid isopropyl ester; 5'-Fluoro-4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-3,4,5,6-tetrahydro-2H-[ 1,2']bipyridinyl; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-5'-methyl-3,4,5,6-tetrahydro-2H-[ 1,2']bipyridinyl; 4-[l-(4-Methanesulfonyl-phenyl)-III-pyr azolo[3,4-d]pyrimidin-4-yloxy]-6'-trifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl; [1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-[1-(3-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-pyrrolidin-3-ylJ-amine; [1-(2-Fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yl]-[ 1-(3-isopropyl-[ 1,2,4]oxadiazol-5-ylmethyl)-pyrrolidin-3-yl]-amine; (4-Ethyl-pyridin-2-yl)-{4-[l-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-pyrrolidin-3-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[ 1-(3 -isopropyl-[ 1,2,4] oxadiazo 1-5-y lmethyl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; (5'-Fluoro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl;-4-y1)-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylj-amine; (5-Bromo-pyridin-3-yl)-{4-[l-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-y1}-methanone; 3-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pyrrolidine-l-carboxylic acid tert-butyl ester; 3-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4- -d]pyrimidin-4-ylamino]-pyrrolidine-l-carboxylic acid tert-butyl ester; 3-[l-(2-Fluoro-4-methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-ylamino]-pyrrolidine-l-carboxylic acid isopropyl ester; (6-Chloro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-y1}-methanone; (5-Chloro-pyridin-3-yl)-(4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-I H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(1-methyl-3-trifluoromethyl-lH-pyrazol-4-yl)-methanone; (2-Chloro-pyridin-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; (4-Hydroxy-3-methoxy-phenyl)-{4-[ 1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (4-Chloro-3-nitro-phenyl)-{4-[1-(4-methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 1-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-y1}-3-methyl-butan-l-one; {4-{1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl} -(6-pyrazol-1-yl-pyridin-3-yl)-methanone; (2-Hydroxy-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-y1}-methanone; (5,6-Dichloro-pyridin-3-yl)-{4-[l-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (5-Bromo-pyridin-3-yl)-{4-[ I -(4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; 5-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyj-piperidine-l-carbonyl)-nicotinic acid; (1H-ImidazoI-4-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 3-[1-(4-Methanesulfonyl-phenyl)-11I-pyrazolo[3,4-d]pyrimidin-4-yloxy]-pyrrolidine-i-carboxylic acid tert-butyl ester; {4-[1-(4-ivlethanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]--piperidin- l -yl} -(6-pyrrolidin-l -yl-pyridin-3-yi)-methanone; (6-Isobutylamuio-pyridin-3-y1)-{4-[1-(4-methanesulfonyl-phenyl)-iH-pyrazolo[3,4-djpyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (6-Ethylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yioxy]-piperidin-1-yl}-methanone; (6-Cyclobutylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenvl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l -yl} -methanone; (6-Isopropylamino-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; [6-(1-Ethyl-propylamino)-pyridin-3 -y1]- {4-[ 1-(4-methanesulfonyl-phenyl)-1H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin-i-yl}-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxyj-piperidin-l-yl}-[6-(I-propyl-butylamino)-pyridin-3-yl]-methanone; 5-Benzyloxy-2-{4-[1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carbonyl}-pyran-4-one;
Benzo[c] isoxazol-3-yl-{4-[ I -(4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]
pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; (4-Chloro-pyridin-2-y1)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; (4-Iodo-pyridin-2-yl)-{4-[I-(4-methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 1-{4-f1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-y1}-butan-2-one; 2-5 (5-Bromo-pyridin-3-yl)-1-{4-[I-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; (6-Fluoro pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (5-Fluoro-pyridin-2-yl)-{4-[I-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1 yl}-methanone; (6-Chloro-pyridin-2-yl)- { 4-[ 1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimi d in-4-yloxy] -10 piperidin-1-yl}-methanone; (2-Chloro-5-fluoro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-[5-(2-methyl-pyrrolidin-l -ylmethyl)-pyridin-3-yl]-methanone; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(6-methyl-pyridin-2-yl)-methanone; 5-{4-[1-(4-Methanesulfonyl-phenyl)-IH-15 pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carbonyl}-nicotinonitrile;
{4-[I-(4-Methanesulfonyl-phenyl)-1H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(4-methoxy-pyridin-2-yl)-methanone;
(2-Fluoro-pyridin-4 y1)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (2-Fluoro-pyridin-3-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (6Fluoro-pyridin-3-yl)-{4-[1-(4-20 methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; {4-[1-(4-Methanes ulfonyl-phenyl)- I H-pyrazolo [3,4-d] pyrimi din-4-yloxy]-piperidin- l -yl} -(4-methoxy-thiophen-3-yl)-methanone; 2-{4-[1-(4-Methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4- -yloxy]-piperidine-l-carbonyl}-pyran-4-one; (5-Ethyl-pyridin-2-yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (4-25 Ethoxy-phenyl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; {4-[I-(4-Methanesulfonyl-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-(5-pyridin-2-yl-thiophen-2-yl)-methanone; (SAmino-pyridin-2-yl)-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; (5-Amino-pyridin-2-yl)-{4-[ 1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-30 yloxy]-piperidin-1-yl}-methanone; {4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-[5-(3-methyl-butylamino)-pyridin-2-yl]-methanone; {4-[1-(2-Flu oro-4-methanesu lfonyl-phenyl)-1 H-pyrazolo [3,4-d] pyrimidin-4-yloxy]-piperidin- l -y l} -(4-trifluoromethoxy-phenyl)-methanone; (5-Butyl-pyridin-2 yl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; (5-Ethylamino-pyridin-2-35 yI)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; {4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl)-(5-isopropoxymethyl-pyridin-2-yl)-methanone; (4-Difluoromethoxy-phenyl)-{4-[1-(2-fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d] pyrimidin-4-y loxy]-piperidin-1-yl } -methanone;
{4-[1 -(2-Fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl} -(5-isopropoxy-pyridin-2-yl)-methanone; 5- {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carbonyl}-pyridine-2-carboxylic acid methyl ester; {4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-acetic acid ethyl ester; {4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-(3-trifluoromethoxy-phenyl)-methanone; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 1-(4-Chloro-phenyl)-2- { 4-[ 1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin- l -yl) -ethanone; 2-{4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-1-(3-trifluoromethyl-phenyl)-ethanone; 4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-5'-isopropoxy-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl; 1-(4-Methanesulfonyl-phenyl)-4-[ 1-(4-trifluoromethoxy-phenyl)-p iperidin-4-yloxy] -1 H-pyrazolo [3,4-d]pyrimidine; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(4-trifluoromethoxy-phenyl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 1-(4-Chloro-3-methyl-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 1-(3,4-Dichloro-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl} -ethanone;
5'-Bromo-4-[ 1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo[3,4-d]pyrimidin-4-yloxy] -3,4,5,6-tetrahydro-2H-[ 1,2'] bipyridinyl; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[ 1-(3-trifluoromethoxy-phenyl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 4-[1-(4-Methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-5'-trifluoromethyl-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl; 1-(2,4-Dimethoxy-phenyl)-2- {4-[ 1-(4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 1-(4-Difluoromethoxy-phenyl)-2-{4-[1-(4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; 1-(4-Diethylamino-phenyl)-2-{4-[1-(4-methaii.esulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-1-yl}-ethanone; (2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-yl}-5-methyl-pyrimidin-4-yl)-dimethyl-amine; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(5-methyl-4-pyrrolidin-1-yl-pyrimidin-2-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 4-[1-(2-Fluoro-4-methanesulfonyi-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanyl]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(2-Methyl-4-propylamino-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Isopropylamino methyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[I-(2-Methyl-4-morpholin-4-yl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{1-[4-(2-Methoxy-ethylamino)-?-methyl-phenyl]-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(1-{4-[(2 Methanesulfonyl ethyl) methyl amino]-2-methyl-phenyl}-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Bromo-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Propylamino-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Isopropylamino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(1-{4-[4-(2-Methanesulfonyl-ethyl)-piperazin-1-y1]-2-methyl-phenyl }-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy)-piperidine- l -carboxylic acid isopropyl ester; 4-(1-{2-Methyl-4-[(tetrahydro-furan-2-ylmethyl)-amino)-phenyl}-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Cyclopropylamino-2-methy.1-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidine-l -carboxylic acid isopropyl ester; 4-{1-[4-(2-Dimethylamino-ethylamino)-2-methyl-phenyl]-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Morpholin-4-yl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-({[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1 H-pyrazolo [3,4-d]pyrimidin-4-y1]-isopropyl-amino}-methyl)-piperidine-I-carboxylic acid tert-butyl ester; 4-[1-(2-Fluoro-4-morpholin-4-yl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[l-(2-Fluoro-4-isopropylamino-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-(1-{4-[(2-Methanesulfonyl-ethyl)-methyl-amino]-phenyl}-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-1-carboxylic acid isopropyl ester; 4-{1-[4-(2-Methoxy-ethylamino)-phenyl]-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-(1-{4-[(Tetrahydro-furan-2-ylmethyl)-amino]-plienyl} -1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-l -carboxylic acid isopropyl ester; 4-(1-{4-[4-(2-Methanesulfonyl-ethyl)-piperazin-l-yl]-phenyl}-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Amino-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-({[1-(2-Fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]-isopropyl-amino} -methyl)-piperidine-l-carboxylic acid isopropyl ester; 4-[l-(5-Ethyl-pyrimidin-2-yl)-piperidin-4-ylsulfanyl]-1-(2-fluoro-4-methanesulfonyl-phenyl)-1H-pyrazolo[3,4-d]pyrimidine; 4-[1-(2-Fluoro-4-sulfamoyl-phenyi)-1H-pyrazolo[3,4-d]pyrimidin-4 yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(2-Fluoro-4-propionylsulfamoyI-phenyl)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy ]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Cyano-2-fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 1-(2,5-Difluoro-4-methoxy-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5yI)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine; 4-[I-(2,5-Difluoro-4-methanesulfonyl-phenyl)-lH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(4-Fluoro-6-methoxy-pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrirnidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[1-(6-Methoxy-2-methyl-pyridin-3-yi)-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(2,5-Difluoro-4-sulfamoyi-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[l-(2-Fluoro-4-hydroxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-I-carboxylic acid isopropyl ester; 3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrazolo[3,4-d)pyrimidin-1-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{4-[1-(3-isopropyl-[i,2,4}oxadiazol-5-yl)-piperidin-4-yloxy]-pyrazolo[3,4-d]pyrimidin-1-yl}-benzonitrile; 3-Fluoro-4-{4-[ 1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxyj-pyrazolo[3,4-d}pyrimidin- l -yl} -benzenesulfonamide; 1-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[ 1-(3 -isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy)-1H-pyrazolo[3,4-d]pyrimidine; 1-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 4-[1-(3 -Isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxyj-l-(6-methoxy-2-methyl-pyridin-3-yl)-1H-pyrazolo[3,4-d]pyrimidine; 2,5-Difluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxyj-pyrazolo[3,4-d]pyrimidin-l-yl}-benzenesulfonamide; 1-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4)oxadiazol-5-yl)-cyclohexyloxy]-1 H-pyrazolo[3,4-d]pyrimidine; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[3,4-d]pyrirnidun-1-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[3,4-d]pyrirnidin-l-yl}-benzonitrile; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxyj-pyrazolo[3,4-d]pyrimidin-1-yl}-benzenesulfonamide; 1-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-1 H-pyrazolo[3,4-d]pyrimidine; 1-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-l H-pyrazolo[3,4-d]pyrimidine; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-l-(6-methoxy-2-methyl-pyridin-3 yl)-1H-pyrazolo[3,4-d]pyrimidine; 2,5 Difluoro-4-{4-[4-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[3,4-d]pyrimidin-1-yl}-benzenesulfonamide; 4-[1-(2-Fluoro-4-methoxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-l-carboxylic acid isopropyl ester; 4-[1-(4-Difluoromethoxy-2-fluoro-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(2-Fluoro-4-trifluoromethoxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[1-(2,5-Difluoro-4-methoxy-phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yloxyj-piperidine-l-carboxylic acid isopropyl ester; 3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yi)-piperidin-4-yloxy]-pyrazolo[3,4-d]pyrimidin-1-yl}-phenol; 1-(-Fluoro-4-methhoxy-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxyj-1H-pyrazolo[3,4-d]pyrimidine; 1-(4-Difluoromethoxy- fluoro-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine; 1-(2-Fluoro-4 tiuoromethoxy-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxyj-IH-pyrazolo[3,4-djpyrimidine; 1-(2,5-Difluoro-4-methoxy-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1H-pyrazolo[3,4-d]pyrimidine;
3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-y1)-cyclohexyloxy]-pyrazolo[3,4-d]pyrirnidin-l-yl}-phenol; 1-(2-Fluoro-4-methoxy-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine; 1-(4-Difluoromethoxy-2-fluoro-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyciohexyloxyj-lH-pyrazolo[3,4-d]pyrimidine; and 1-(2-Fluoro-4-tifluoromethoxy-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1H-pyrazolo[3,4-d]pyrimidine.

Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D3): 4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid isobutyl ester; {4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidin-1-yl}-pyridin-3-yl-methanone; 4-[9-(4-Methanesulfonyl-phenyl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid tert-butyl ester and 4-[9-(2-Fluoro-4-methanesulfonyl-phenyl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid tert-butyl ester.
Specific examples of GPRI19 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D4): 4-[9-(2-Fluoro-4-propionylsulfamoyl-phenyl)-9H-purin-6-yloxy]-piperidine-l-carboxyylic acid isopropyl ester; 4-[9-(4-Cyano-2-fluoro-phenyl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[9-(2-Fluoro-4-sulfamoyl-phenyl)-9H-purin-6-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 9-(2-Fluoro-4-methanesulfonyl-phenyl)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-9H-purine; 3-Fluoro-4-{6-[l-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-purin-9-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-purin-9-yl}-benzonitrile;
3-Fluoro-4-{6-[l-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-purin-9-yl}-benzenesulfonamide; 4-[9-(2,5-Difluoro-4-methanesulfonyl-phenyl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[9-(4-Fluoro-6-methoxy-pyridin-3-yl)-9H-purin-6-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[9-(6-Methoxy-2-methyl-pyridin-3-yl)-9H-purin-6-yloxy]-piperidin-l-carboxylic acid isopropyl ester; 4-[9-(2,5-Difluoro-4-sulfamoyl-phenyl)-9H-purin-6-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 9-(2,5-Difluoro-4-methanesulfonyl-phenyl)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-9H-purine; 9-(4-Fluoro-6-methoxy-pyridin-3-yl)-6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-9H-purine; 6-[1-(3-Isopropyl-[l,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-9-(6-methoxy-2-methyl-pyridin-3-yl)-9H-purine; 2,5-Difluoro-4-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-purin-9-yl}-benzenesu[fonamide; 9-(2-Fluoro-4-methanesulfonyl-phenyl)-6-[4-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-9H-purine; 3-Fluoro-4-{ 6-[4-(3-isopropyl-[1,2,4Joxadiazol-5-yl)-cyclohexyloxy]-purin-9-yl}
-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-purin-9-yl}-benzonitrile; 3-Fluoro-4-{6-[4-(3-isopropyl-[l,2,4]oxadiazol-5-yl)-cyclohexyloxy]-purin-9-yl}-benzenesulfonamide; 9-(2,5-Difluoro-4-methanesulfonyl-phenyl)-6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-9H-purine; 9-(4-Fluoro-6-methoxy-pyridin-3-yl)-6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-9H-purine; 6-[4-(3-Isopropyl-[l,2,4]oxadiazol-5-yl)-cyclohexyloxy]-9-(6-methoxy-2-methyl-pyridin-3-yl)-9H-purine; and 2,5-Difluoro-4-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yi)-cyclohexyloxy]-purin-9-yl} -benzenesulfonamide.

Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compound according to Formula (IV) (referred to herein as Group D5): 4-[3-(4-Methanesulfonyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-1-carboxylic acid tert-butyl ester.
5 Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D6): 3-(2-Fluoro-4-methan(-,sulfonyl-phenyl)-7-[1-(3-isopropyl-[
1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3H-[ 1,2,3]triazolo [4,5-d]pyrimidine; 3-Fluoro-4-{ 7-[1-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-4-yloxy]-[ 1,2,3]triazolo[4, 5-d]pyrimidin-3-yl } -N-propionyl-10 benzenesulfonamide; 3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-[1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzonitrile; 3-Fluoro-4-{7-[1-(3-isopropyl-[ 1,2,4]oxadiazoi-5-yl)-piperidin-4-yloxy]-[1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzenesulfonamide; 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3 H-[1,2,3]triazolo[4,5-d]pyritidine; 3-Fluoro-4-{7-[4-(3-isopropyl-[
1,2,4]oxadiazol-5-yl)-15 cyclohexyloxy]-[1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{ 7-[4-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-[ 1,2,3 ]triazolo [4,5-d]pyrimidin-3-yl} -benzonitrile; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-[ 1,2,3]triazolo[4,5-d]pyrimidin-3-yl) -benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3 -isopropyl-[ 1,2,4] oxadiazol-5-y1)-cyclohexyloxy]-3H-[
I,2,3]triazolo [4,5-20 d]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine; 7-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-methyl-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidine; 2,5-Difluoro-4-{7-[4-(3 -isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-[
1,2,3]triazolo[4,5-d]pyrimidin-3-yl}-benzenesulfonamide; 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-3H-[1,2,3]triazolo[4,5-25 d]pyrimidin-7-yioxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-propionylsuifamoyl-phenyl)-3H-[ 1,2,3] triazolo[4,5-d]pyrimidin- 7 -yloxy]-piperidine-I -carboxylic acid isopropyl ester; 4 [3 (4 Cyano-2 Fluoro-phenyl) 3H [I,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-3H-[i,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-30 Difluoro-4-methanesulfonyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrinxidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-3H-[1,2,3]triazolo[4,5-d]pyrimidin-7-yloxy]-35 piperidine-1-carboxylic acid isopropyl ester; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[ 1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3H-[1,2,3]triazolo[4,5-d]pyrimidine; 7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy-2-methyl-pyridin-3-yl)-3H-[1,2,3]triazolo[4,5-d]pyrimidine; and 2,5-Difluoro-4-{7-[l-(3-isopropyl-[ 1,2,4] oxadiazo i-5-yl)-piperidin-4-yloxy]-[ 1,2,3]triazolo[4,5-d]pyrimidin-3-yl} -benzenesulfonamide.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compound according to Formula (IV) (referred to herein as Group D7): 4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid tert-butyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D8): 4-({Ethyl-[3-(4-methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-ylsulfanyl]-piperidine-l-carboxylic acid tert-butyl ester; and 4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compound according to Formula (IV) (referred to herein as Group D9): 4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-[1,7]naphthyridin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester, Specific examples of GPR119 agonists disclosed in International Application No.
PCTIUS2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D10): 4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Methylsulfanyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Methanesulfonyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Isopropoxy-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Bromo-2-Fuoro-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[8-(2-Fluoro-4-propionylsulfamoyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Cyano-2-fluoro-phenyl)-quinolin-4 ,,,foxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[8-(2-Fluoro-4-sulfamoyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Fluoro-6-methoxy-pyridin-3-yl)-quinolin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[8-(6-Methoxy-2-methyl-pyridin-3-yl)-quinolin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[8-(2,5-Difluoro-4-sulfamoyl-phenyl)-quinolin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 2,5-Difluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-quinolin-8-yl}-benzenesulfonamide; 4-[1-(3-Isopropyl-[1,2,4]oxadiazol-5 yl)-piperidin 4 yloxy] 8-(6-methoxy-2-methyl-pyridin-3-yl)-quinoline; 8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[ 1-(3 -isopropyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-4-yloxy]-quinoline; 8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[
1,2,4] oxadiazol-5-yl)-piperidin-4-yloxy]-quinoline; 3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-quinolin-8-yl}-benzenesulfonamide; 3-Fluoro-4-{4-[l-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-quinolin-8-yl}-benzonitrile; 3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-quinolin-8-yl} N-propionyl-benzenesulfonamide; 8-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yI)-piperidin-4-yloxy]-quinoline;
2,5-Difluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-quinolin-8-yl}-benzenesulfonamide; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-8-(6-methoxy-2-methyl-pyridin-3-yl)-quinoline; 8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[4-(3-isopropyl-[1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-quinoline; 8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]
oxadiazol-5-yl)-cyclohexyloxy]-quinoline; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-quinolin-8-yl}-benzenesulfonamide; 3-Fluoro-4-{4-[4-(3-isopropyl-[ 1,2,4]
oxadiazol-5-yl)-cyclohexyloxy]-quinolin-8-yl}-benzonitrile; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-quinolin-8-yl}-N-propionyl-benzenesulfonamide; and 8-(2-Fluoro-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-quinoline.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to heroin as Group D11): 4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(2-Fluoro-4-propionylsulfamoyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[8-(4-Cyano-2-fluoro-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidin-l-carboxylic acid isopropyl ester; 4-[8-(2-Fluoro-4-sulfamoyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(4-Fluoro-6-methoxy-pyridin-3-yl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[8-(6-Methoxy-2-methyl-pyridin-3-yl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[8-(2,5-Difluoro-4-sulfamoyl-phenyl)-pyrido[3,4-d]pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 8-(2-Fluoro-4-methanesuifonyl-phenyl)-4-[ 1-(3-isopropyl-[ l ,2,4]oxadiazol-5-yl)-piperidin-4-yloxy)-pyrido[3,4-d]pyrimidine; 3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidin-8-yl} N-propionyl-benzenesulfonamide; 3-Fluoro-4-{4-[i-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidin-8-yl}-benzonitrile; 3-Fluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrido [3,4-d]pyrimidin-8-yl} -benzenesulfonamide; 8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4 yloxy]-pyrido[3,4-d]pyrimidine; 8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidine; 4-[1-(3-Isopropyl-[1,2,4]oxadiazol-S-yI)-piperidin-4-yloxy]-8-(6-methoxy-2-methyl-pyridin-3-y1)-pyrido[3,4-d]pyrimidine; 2,5-Difluoro-4-{4-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrido[3,4-d]pyrimidin-S-yl}-benzenesulfonamide; 8-(2-Fluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidine; 3-Fluoro-4-{4-[4-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-pyrido [3,4-d] pyrimidin-8-yl } -N-propionyl-benzenesulfonamide; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidin-8-yl}-benzonitrile; 3-Fluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidin-8-yl}-benzenesulfonamide; 8-(2,5-Difluoro-4-methanesulfonyl-phenyl)-4-[4-(3-isopropyl-[1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidine; 8-(4-Fluoro-6-methoxy-pyridin-3-yl)-4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidine; 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-8-(6-methoxy-2-methyl-pyridin-3-yl)-pyrido[3,4-d]pyrimidine; and 2,5-Difluoro-4-{4-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrido[3,4-d]pyrimidin-8-yl}-benzenesulfonamide.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D12): 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[ 1,5-a]pyrimidine; 3-Fluoro-4-{7-[4-(3-isopropyl-[
1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidin-3-yl} N-propionyl-benzenesulfonamide;
3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidin-3-yl}-benzonitrile; 3-Fluoro-4- {7-[4-(3 -isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo [ 1,5-a] pyrimidin-3-yl} -benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidine; 7-[4-(3-Isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-3 -(6-methoxy-2-methyl-pyridin-3 -yl)-pyrazolo [ 1,5-a]pyrimidin; 2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide; 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-ylo y] piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2 Fluoro-4-propionyisuifamoyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yioxy]-piperidine-i-carboxylic acid isopropyl ester; 4-[3-(4-Cyano 2-fluoro-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(6-Methoxy methyl-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-y':)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidine; 3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidin-3-yl}-benzonitrile; 3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-WO 2006/076231 PCT[US2006/00010 piperidin-4-yioxy]-pyrazolo[1,5-a]pyrirnidin-3-yl}-benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[ 1-(3 -isopropyl-[ 1,2,4] oxadiazo l-5-yl)-piperidin-4-yloxy]-pyrazolo [ 1,5-a]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-y1)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-pyrazolo[1,5-a]pyrimidine; 7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yioxy]-3-(6-methoxy-2-methyl-pyridin-3-yl)-pyrazolo[1,5-a]pyrimidine; 2,5-Difluoro-4-{7-[1-(3-isopropyl-[ 1,2,4] oxadiazol-5 -yl)-piperidin-4-yloxy] -pyrazolo [ 1, 5-a]pyrimidin-3 -yl} -benzenesulfonamide; 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Cyano-2-fluoro-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yioxy]-piperidine-l-carbo,Xcylic acid isopropyl ester; 4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-2-rnethyl-pyrazolo[1,5-a]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 2,5-Difluoro-4- { 7-[1-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-4-yioxy]-2-methyl-pyrazolo [ 1,5-a]pyrimidin-3-yl}-benzenesulfonamide; 7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy] 3-(6-methoxy-2-methyl-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[ 1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine; 3-Fluoro-4-(7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzenesulfonamide;
3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yioxy} 2-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-benzonitrile; 3-Fluoro-4-{ 7-[1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yioxy]-2-methyl-pyrazolo[1,5-a]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide; 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[ 1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-pyrazolo [ 1, 5-a]pyrimidine; 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidin-3-yl} ,r-propionyl-benzenesulfonamide; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy] -methyl-pyrazolo[1,5-a]pyrirnidin-3-yl}-benzonitrile; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidin-3-yl} -benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-y1)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a]pyrimidine; 7-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-methyl-pyridin-3-yl)-2-methyl-pyrazolo[1,5-a]pyrimidine; and 2,5-Difluoro-4-{7-[4-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-pyrazolo[1,5-a] pyrimid i n-3 -yl } -benzenesulfonamide.
Specific examples of GPR119 agonists disclosed in International Application No.
5 PCT/US2004/022417 include include the following compounds according to Formula (IV) (referred to herein as Group D13): 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-1-methyl-lH-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-1-methy]-1 H-pyrazolo [4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Cyano-2-fluoro-phenyl)-1-methyl-lH-pyrazolo[4,3-d]pyrimidin-7-10 yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-1-metliyl-1H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-1-methyl-lH-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-l-methy]-IH-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(6-Methoxy-2-methyl-15 pyridin-3-yl)-1-methyl-IH-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-1-methyl-lH-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3 isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-l-methyl-lH-pyrazolo[4,3-d]pyrimidine; 3-Fluoro-4-{ 7-[ 1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-methyl-1 H-pyrazolo [4,3-20 d]pyrimidin-3-yl} N-propionyl-benzenesulfonamide; 3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-methyl-IH-pyrazolo[4,3-d]pyrimidin-3-yl)-benzonitrile; 3-Fluoro-4-{7-[1-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-pip eridin-4-yloxy]-1-methyl-1 H-pyrazolo [4,3-d]pyrimidin-3 -yl} -benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-methyl-lH-pyrazolo[4,3-d]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-25 yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-y1)-piperidin-4-ylovy]-1-methyl-lii-pyrazolo[4,3-d]pyrimidine; 7-[]-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-3-(6-methoxy-2-methyl-pyridin-3-yl)-1-inethy]-1H-pyrazolo[4,3-d]pyrimidine; 2,5-Difluoro-4-{7-[1-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-1-methyl-1 H-pyrazolo(4,3-d)pyrimidin-3-yl}-benzenesulfonamide; 3-(2-Fluoro 4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[
1,2,4]oxadiazol-5-30 yl)-cyclohexyloxy]-1-methyl-lH-pyrazolo[4,3-d]pyrimidine; 3-Fluoro-4-{7-[4-(3-isopropyl-[ 1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-methyl-1 H-pyrazolo[4,3-d]pyrimidin-3-vl } -N-propionyl-benzenesulfonamide; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-methyl-1H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-methyl-lH-pyrazolo[4,3-d]pyrimidnl-3-yl}-benzenesulfonamide; 3-(2,5-35 Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-methyl-lH-pyrazolo[4,3-d]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-methyl-lH-pyrazolo[4,3-d]pyrimidine; 7-[4-(3-Isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-3 -(6-methoxy-2-methyl-pyridin-3-yl)-1-methyl-1 H-pyrazolo[4,3-d]pyrimidine; and 2,5-Difluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-1-methyl-1H-pyrazolo [4,3-d]pyrimidin-3-yl} -benzenesulfonamide.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/US2004/022417 include the following compounds according to Formula (IV) (referred to herein as Group D14): 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-2-metllyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Cyano-2-fluoro-phenyl)-2-methyl-2H-pyrazolo [4,3-d] pyrimidin-7-yloxy]-piperidine-l -carboxylic acid isopropyl ester; 4-[3-(2-Fluoro-4-sulfamoyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(4-Fluoro-6-methoxy-pyridin-3-yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[3-(6-Methoxy-2-methyl-pyridin-3-yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[3-(2,5-Difluoro-4-sulfamoyl-phenyl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[ 1-(3 -isopropyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine; 3-Fluoro-4-{7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{7-{1-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile; 3-Fluoro-4-{7-[1-(3-isopropyl-[l,2,4]oxadiazol-5-yl)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[1-(3-isopropyl-[l,2,4]oxadiazol-5-yl)-piperidin-4-yloxy] 2-methyl-2H-pyrazolo[4,3-d]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[1-(3-isopropyl-[1,2,4]oxadiazol-5-y',)-piperidin-4-yloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine; 7-[1-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-p iper idin-4-y i oxy] -3 -(6-methoxy-2-methyl-pyridin-3 -yl)-2-methyl-2H-pyrazolo [4,3 -dlpyrimidine; 2,5-Difluoro-4-,7-[1-(3-isopropyl-[l,2,4]oxadiazol-5-yl)-piperidin-4-yloxv]-2-nmethyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzenesulfonamide; 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine; 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl}-N-propionyl-benzenesulfonamide; 3-Fluoro-4-{7-[4-(3-isopropyl-[l,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl 2H-pyrazolo[4,3-d]pyrimidin-3-yl}-benzonitrile;
3-Fluoro-4-{7-[4-(3-isopropyl-[ 1,2,4] oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo [4,3-d]pyrimidin-3-yl} -benzenesulfonamide; 3-(2,5-Difluoro-4-methanesulfonyl-phenyl)-7-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl--?H-pyrazolo[4,3-d]pyrimidine; 3-(4-Fluoro-6-methoxy-pyridin-3-yl)-7-[4-(3-isopropyl-[2,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidine; 7-[4-(3 -Isopropyl-[ 1,2,4] oxadiazo l-5-yl)-cyclohexyloxy]-3-(6-methoxy-2-methyl-pyridin-3 -yl)-2-methyl-2H-pyrazolo[4,3-d]pyrimidine; and 2,5-Difluoro-4-17-[4-(3-isopropyl-[
1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-2-methyl-2H-pyrazolo[4,3-d]pyrimidin-3-yl }-benzenesulfonamide.
Examples of GPRI 19 agonists are described in WO 2005/121121.
Disclosed in WO 2005/121121 as a GPR119 agonist is a compound of Formula (V):
/D

X-Y` Z A1\E/A2 Ar. v.QAWQ2K
(V) or N-oxide thereof;
wherein:
Al and A2 are independently C1_3 alkylene optionally substituted with one or more substituents selected independently from the group consisting of C1_6 alkyl, CI-6 alkoxy, and carboxy;
D is CR1R2 or NR2, wherein R1 is selected from the group consisting of H, C1_6 alkyl, C1_6 alkoxy, halogen and hydroxyl;
E is N, C or CR3, wherein R3 is H or C1.6 alkyl;
is a single bond when E is N or CR3, or a double bond when E is C;
K is absent, C3.6 cycloalkylene, or C1_3 alkylene group optionally substituted with one or more substituents selected independently from the group consisting of C1_6 alkyl, C1_6 alkoxy, carboxy, cyano, and halogen;
Ql is NR4, 0, S, S(O) or S(O)2, wherein R4 is H, C1_6 acyl, C1-6 alkyl, C2_6 alkenyl, C2_6 alkynyl, C3_7 cycloalkyl, or C3_7-cycloalkyl-C1-3-alkylene, wherein said C1_6 alkyl is optionally substituted with one or more substituents selected independently from the group consisting of C1_6 acyl, C1_6 acyloxy, C2_6 alkenyl, C1_6 alkoxy, C1_6 alkyl, C1_6 alkylamino, C1.6 alkylcarboxamide, C2_6 alkynyl, C1_6 alkylsulfonamide, C1_6 alkylsulfinyl, C1.6 alkylsulfonyl, C1.6 alkylthio, C1_6 alkylthiocarboxamide, C1_6 alkylthioureyl, C1_6 alkylureyl, amino, di-C1_6-alkylamino, C1_6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3_6 cycloalkyl, di-C1_6-alkylcarboxamide, di-C1_6-alkylsulfonamide, di-C1_6-alkylthiocarboxamido, C1_6 haloalkoxy, Cl_6 haloalkyl, halogen, C1_6 haloalkylsulfinyl, C1_6 haloalkylsulfonyl, C1.6 haloalkylthio, hydroxyl, hydroxylamino and nitro;
Q2 is absent, NR5, or 0, wherein R5 is H, C1_6 acyl, C1_6 alkyl, C2_6 alkenyl, C2_6 alkynyl, C3_7 cycloalkyl, or C3.7-cycloalkyl-C1_3-alkylene, wherein said C1_6 alkyl is optionally substituted with one or more substituents selected independently from the group consisting of C1_6 acyl, C1_6 acyloxy, C2_6 alkenyl, C1.6 alkoxy, C1_6 alkyl, C1_6 alkylamino, C1_6 alkylcarboxamide, C2_6 alkynyl, C1_6 alkylsulfonamide, C1_6 alkylsulfinyl, C1.6 alkylsulfonyl, C1.6 alkylthio, C1.6 alkylthiocarboxamide, Cl-(, alkylthioureyl, C1_6 alkylureyl. amino, di-C1_6-alkylamino, C1_6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3_6 cycloalkyl, di-C1.6-alkylcarboxamide, di-CI.6-allrylsulfonamide, di-C1_6-alkylthiocarboxamido, CI-6 haloalkoxy, CI-6 haloalkyl, halogen, CI-6 haloallcylsulfinyl, CI-6 haloalkylsulfonyl, CI-6 haloalkylthio, hydroxyl, hydroxylamino and nitro;
W is N or CH;
XisNorCR6;
Yis Nor CR7;
Z is N or CR8;
V is absent, C1.3 heteroalkylene, or C1.3 alkylene wherein each are optionally substituted with one or more substituents selected independently from the group consisting of CI.3 alkyl, C1.6 alkoxy, carboxy, cyano, C1.3 haloalkyl, and halogen;
R6, R7, and R8 are each independently selected from the group consisting of H, C1.6 acyl, C1.6 acyloxy, C2.6 alkenyl, C1.6 alkoxy, C1.6 alkyl, C1.6 alkylamino, C1.6 alkylcarboxamide, C2.6 alkynyl, CI-6 alkylsulfonamide, C1-6 alkylsulfinyl, C1.6 alkylsulfonyl, Cl_6 alkylthio, C1.6 alkylthiocarboxamide, C1.6 alkylthioureyl, C1.6 alkylureyl, amino, di-C1.6-alkylamino, C1.6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C1_6-alkylcarboxamide, di-C1.6-alkylsulfonamide, di-C1.6-alkylthiocarboxamido, C1_6 haloalkoxy, C1.6 haloallcyl, halogen, C1.6 haloalkylsulfmyl, C]_6 haloalkylsulfonyl, C1.6 haloalkylthio, hydroxyl, hydroxylamino and nitro, wherein said C2.6 alkenyl, C1.6 alkyl, C2.6 alkynyl and C3_6 cycloalkyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1_ 6 acyl, C1_6 acyloxy, C2.6 alkenyl, C1.6 alkoxy, C1.6 alkyl, C1_6 alkylamino, C1.6 alkylcarboxamide, C2.6 allcynyl, C1.6 alkylsulfonamide, C1.6 alkylsulfinyl, C1.6 alkylsulfonyl, C1.6 alkylthio, C1.6 alkylthiocarboxamide, C1_6 alkylthioureyl, C1.6 alkylureyl, amino, di-C1_6-alkylamino, C1.6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3_6 cycloalkyl, di-C]_6-alkylcarboxamide, di-C1.6-alkylsulfonamide, di-Cl-6-alkylthiocarboxamido, C1_6 haloalkoxy, C1.6 haloalkyl, halogen, C1.6 aloallylsulfulyl; C1.. haloalkylsulfonyl, C1.6 haloalkylthio, hydroxyl, irydroxylainino and nitro;
Ar is aryl or heteroaryl optionally substituted with R9-R13;
R9 is selected from the group consisting of C1_6 acyl, C1.E acyloxy, C2.6 alkenyl, C1_6 alkoxy, C1.6 alkyl, C1_6 alkylamino, C1_6 alkylcarboxamide, C2_6 alkynyl, C1.6 alkylsulfonamide, C1.6 allylsulfinyl, C;_6 alkylsulfonyl, C1_6 alkylthio, C1-6 alkylthiocarboxamide, C1.6 allcyltbioureyl, C1.6 alkylureyl, amino, aryl, arylcarbonyl, arylsulfonyl, di-C1.6-alkylamino, carbamimidoyl, C1.6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C1.6-alkylcarboxamide, di-C1_6-alkylsulfonamide, di-C1_6-alkylthiocarboxamido, guanidine, C1.6 haloalkoxy, C1.6 lialoalkyl, halogen, C1_6 haloalkylsulfmyl, CI-6 haloalkylsulfonyl, C1_6 haloalkylthio, heterocyclic, heterocyclicsulfonyl, heteroaryl, hydroxyl, hydroxylamino, nitro, C3-6 oxo-cycloalkyl, phenoxy, sulfonamide, sulfonic acid and thiol; and wherein each available R9 is optionally substituted with one or more substituents selected independently from the group consisting of C1.6 acyl, C1.6 acylsulfonamide, CI.6 acyloxy, C2.6 alkenyl, C]_6 alkoxy, C1_6 alkyl, C1.6 alkylamino, CI-6 alkylcarboxamide, C2.6 alkynyl, CI-6 alkylsulfonamide, C1.6 alkylsulfnyl, C1.6 allcylsulfonyl, C1_6 alkylthio, C1.6 alkylthiocarboxamide, C1.6 alt-ylthioureyl, C1.6 alkylureyl, amino, aryl, arylcarbonyl, arylsulfonyl, di-C1_6-alkylamino, C1.6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3_6 cycloalkyl, di-C1.6-alkylearboxamide, di-C3.6-alkylsulfonamide, di-C1.6-allylthiocarboxamido, C1.6 haloalkoxy, C1.6 haloalkyl, halogen, C1.6 haloalkylsulfinyl, C1.6 haloallylsulfonyl, C1.6 haloalkylthio, heteroaryl, heteroarylcarbonyl, heteroarylsulfonyl, heterocyclic, hydroxyl, hydroxylamino, and nitro;
Rlo-R13 are independently selected from the group consisting of C1.6 acyl, CI-6 acyloxy, C2_6 alkenyl, C1.6 alkoxy, CI-6 alkyl, C3.6 alkylamino, C1_6 alkylcarboxamide, C2.6 alkynyl, C1.6 alkylsulfonamide, C1.6 alkylsulfinyl, C34 alkylsulfonyl, C34 alkylthio, C1_6 alkylthiocarboxamide, C1.6 alkylthioureyl, CI-6 alkylureyl, amino, di-C3.6-alkylamino, C1_6 alkoxycarbonyl, carboxamide, carboxy, cyan, C3.6 cycloalkyl, di-C1.6-alkylcarboxamide, di-C1.6-alkylsulfonamide, di-C1.6-allyithiocarboxamido, C3.6 haloalkoxy, C1.6 haloalkyl, halogen, C1.6 haloalkylsulfinyl, C1.6 haloallylsulfonyl, C3.6 haloalkylthio, hydroxyl, hydroxylamino, nitro, and thiol; or two adjacent groups together with the atoms to which they are bonded form a 5, 6 or 7 member cycloalkyl, cycloalkenyl or heterocyclic group wherein the 5, 6 or 7 member group is optionally substituted with halogen or oxo; and R2 is selected from the group consisting of H, C1.6 acyl, C1.6 acyloxy, C2.6 alkenyl, C1.6 alkoxy, C1.6 alkyl, C1.6 alkylamino, C1.6 alkylcarboxamide, C2.6 alkynyl, C1.6 alkylsulfonamide, C1.6 alkylsulfinyl, C1.6 alkylsulfonyl, C1.6 alkylthio, C14 alkylthiocarboxamide, CI.6 aikylthioureyl, C1.6 alkylureyl, amino, aryl, arylcarbonyl, aryloxy, di-C1.6-alkylamino, carbamimidoyl, C1.6 alkoxycarbonyl, C3.7-cycloalkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C1.6-alkylcarboxamide, di-C1.6-alkylsulfonamide, di-CI.6-alkylthiocarboxamido, guanidine, C1.6 haloalkoxy, C1.6 haloalkyl, halogen, C1.6 haloallcylsulfmyl, C1_6 haloalkyisuifonyl, C1.6 haloalkylthio, heteroaryl, heteroaryl-C3.3-alkylene, heteroarylcarbonyl, heteroaryloxy, heterocychccarboxamide, hydroxyl, hydroxylamino and nitro;
wherein each available R2 is optionally substituted with one or more substituents selected independently from the group consisting of C1.6 acyl, C1.6 acyloxy, C2.6 alkenyl, C1.6 alkoxy, C1.6 alkyl, C1.6 alkylamino, C1.6 aikylcarboxamide, C2.6 allcynyl, C1.6 alkylsulfonamide, CI-6 alkylsulfinyl, C1_6 alkylsulfonyl, C1.6 alkylthio, C1.6 alkylthiocarboxamide, C1.6 alkylthioureyl, C1-6 allylureyl, amino, aryl, di-C34-alkylamino, C1.6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-Cl_6-alkylcarbo2:amide, di-C1.6-alkylsulfonamide, di-C1.6-allylthiocarboxamido, C3.6 haloalkoxy, C1.6 haloalkyl, halogen, CI-6 haloalkylsulfmyl, C1.6 haloalkylsulfonyl, C3.6 haloalkylthio, heterocyclic, heteroaryl, hydroxyl, hydroxylamino and nitro, and wherein C1.6 alkyl is further optionally substituted with one or more substituents selected independently from the group consisting of C3.6 acyl, C1.6 alkoxy, Cy6 alkylamino, C1_6 alkylcarboxamide, C3.6 alkylsulfonamide, C1_6 alkylsulfinyl, C3.6 alkylsulfonyl, C1.6 alkylthio, C1.6 allylureyl, amino, di-C1-6-allylamino, C1.6 alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 eycloalkyl, di-C1.6-alkylcarboxamide, di-C1.6-allylsulfonamide, C1_6 haloalkoxy, C1.6 haloallcyl, halogen, C1.6 haloalkylsulfinyl, C1.6 haloalkylsulfonyl, C1.6 haloalkylthio, heterocyclic, hydroxyl, hydroxylamino and nitro.
5 The present invention also encompasses diastereomers as well as optical isomers, e.g.
mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and diastereomers, which arise as a consequence of structural asymmetry in certain compounds of the invention, Separation of the individual isomers or selective synthesis of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.
10 Specific examples of GPR119 agonists disclosed in WO 2005/121121 include the following compounds according to Formula (V) (referred to herein as Group El): 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-6-(4-inethanesulfonyl-phenoxy)-pyrimidine; {6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]-pyrimidin-4-yl}-(4-methanesulfonyl-phenyl)-amine; 4-{[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-piperidine-15 1-carboxylic acid tert-butyl ester; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-({ [6-(2,5-Difluoro-beezylamino)-pyrimidin-4-yl]-methyl-amino } -methyl)-piperidine-l -carboxylic acid tert-butyl ester; 4-[({6-[(Benzo[1,3]dioxol-5-ylmethyl)-amino)-pyrimidin-4-yl}-methyl-amino)-20 methyl]-piperidine-l-carboxylic acid tert-butyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-fluoro-phenoxy)-piperidin-1-yl]-pyrimidin-4-yl}-alpine; 4-({Methyl-[6-(2-pyridin-4-yl-ethylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-({Methyl-16-(2-pyridin-3-yl-ethylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[(Methyl-{6-[(pyridin-3-ylmethyl)-amino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-25 carboxylic acid tert-butyl ester; 4-[({6-[(2-Fluoro-4-methanesulfonyl-phenyl)-methyl-amino]-pyrimidin-4-yl}-metlryl-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2-Fluor o-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-rrietiryl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester; 4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-aurino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[({6-[4-(2-MethanesulfonyI-ethyl)-30 phenylamino]-pyrimidin-4-yl}-methyl-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester;
4-({ [6-(4-Ethy lsu lfany l-phenylamino)-pyrimidin-4-yl] -methyl-amino } -methyl)-p iperid ine-1-carboxylic acid tert-butyl ester; 4-({[6-(4-Isopropylsulfanyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Ethylsulfamoyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
35 4-({Methyl-[6-(4-methylsulfamoyl-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Dimethylsulfamoyl-phenylamino)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({Methyl-[6-(4-methylsulfamoylmethyl-phenylamino)-pyrimidin-4-yl]-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({Methyl-[6-(4-sulfamoyl-phenylamino)-pyrimidin-4-ylj-amino }-methyl)-piperidine-1-carboxylic acid tert-butyl ester; 4-({Methyl-[6-(4-[1,2,4]triazol-1-yl-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-({Methyl-[6-(4-[1,2,4]triazol-1-ylmethyl-phenylamino)-pyrimidin-4-yl]-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[(Methyl-{6-[4-(2-[1,2,43triazol-1-yl-ethyl)-phenylamino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-({{6-(Benzo[1,3]dioxol-5-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(6-Methanesulfonyl-pyridin-3 -ylamino)-pyrimidin-4-yl]-methyl-amino } -methyl)-piperidine- l -carboxylic acid tert-butyl ester; 4-({[6-(3,5-Dimethoxy-phenylamino)-pyrimidin-4-y1]-methyl-amino}-methyl)-piperid ne-l-carboxylic acid tert-butyl ester; 4-[(Methyl-{6-[4-(2-oxo-oxazolidin-4-ylmethyl)-phenylamino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-[({6-[4-(1,1-Dioxo-12 6-thiomorpholin-4-ylmethyl)-phenylamino] -pyrimidin-4-yl} -methyl-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-({Methyl-j6-(4-pyrazol-1-yl-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-({[6-(2,2-Difluoro-benzo[1,3]dioxol-5-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({Methyl-[6-(4-trifluoromethanesulfonyl-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[(Methyl-{6-[4-(morpholine-4-sulfonyl)-phenylamino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-[(Methyl-(6-[2-(pyridine-2-carbonyl)-phenylamino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-carboxylic acid tart-butyl ester; 4-({[6-(2-Fluoro-5-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; N-Ethyl-3-fluoro-4-[6-(methyl-piperidin-4-ylmethyl-amino)-pyrimidin-4-ylamino]-benzenesulfonamide; 3-Fluoro-N-isopropyl-4-[6-(methyl-piperidin-4-ylmethyl-amino)-pyrimidin-4-ylamino]-benzenesulfonamide; 4-({[6-(3,4-Difiuoro-phenylarino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2,6-Difiuoro-phenylamino)-pyrimidin-4-ylj-methyl-amino}-methyl)-piperidine-l-carboxylic acid tzrt-butyl ester; 4-({[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-arnino}-methyl)-piperidine-I-carboxylic acid tert-butyl ester; 4-({16-(2,3-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-1-carboxylic acid tert-butyl ester; 4-({Methyl-[6-(2,3,5-trifluoro-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tort-butyl ester;
4-({[6-(2-Fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2-Fluoro-4-methyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(3-Chloro-2-fluoro-phenylamino)-pyrimidin-4-ylj-methyl-amino}-methyl)-piperidine-I-carboxylic acid tert-butyl ester; 4-({[6-(2,4-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-[(Methyl-{6-[2-(1-oxy-pyridin-3-yl)-ethylamino]-pyrimidin-4-yl)-amino)-methyl]-piperidhie- 1-carboxylic acid tert-butyl ester; 4-[(Methyl-{6-[2-(1-oxy-pyridin-3-yl)-ethylamino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-carboxylic acid isobutyl ester; 4-({[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester; 4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-l-carboxylic acid isobutyl ester; 4-[({6-[2-(2-Fluoro-phenoxy)-etliylamino]-pyrimidin-4-yl}-methyl-amino)-methyl]-piperidine-1-carboxylic acid tert-butyl ester; 4-({[6-(2-Fluoro-phenoxy)-pyrimidin-4-yl]-methyl-amino}-methyI)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2,5-Difluoro-phenoxy)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[({6-[2-(2-Chloro-phenoxy)-ethylamino]-pyrimidin-4-yl)-methyl-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2-Chloro-phenoxy)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[({6-[2-(4-Fluoro-phenoxy)-propylamino]-pyrimidin-4-yl}-methyl-amino)-methyl]-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Ethylsulfamoyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2-Fluoro-4-isopropylsulfamoyl-phenylamino)-pyrimidin-4-yl]-methyl-amino } -methyl)-piperidine- l-carboxylic acid tert-butyl ester; 4-({[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino} -methyl)-piperidine-1 -carboxylic acid tert-butyl ester; 4-({[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester;
4-({ [6-(5-Carboxy-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino } -methyl)-piperidine- l -carboxylic acid tert-butyl ester; 4-({[6-(6-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2,6-Dimethoxy-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 6-{6-[(1-tert-Butoxycarbonyl-piperidin-4-ylmethyl)-methyl-amino]-pyrimidin-4-ylamino}-nicotinic acid;
4-({ [6-(6-Acetylamino-pyridin-3-ylamino)-pyrimidin-4-yl]-methyl-amino} -methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(5-Fluoro-pyridin-2-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Cyano-2-ethyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Butyryl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(5-Bromo-3-methyl-pyridin-2-ylamino)-pyrimidin-4-yI]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(3-Bromo-5-methyl-pyridin-2-ylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({Methyl-[6-(5-trifluoromethyl-pyridin-2-ylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Bromo-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(3-Carboxy-4-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(4-Ethoxycarbonyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester; 4-({[6-(4-Carboxy-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-1-carboxylic acid isobutyl ester; 4-({[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino)-methyl)-piperidine-l-carboxylic acid isopropyl ester; 4-({[6-(4-Cyano-2-fluoro-............
phenylamino)-pyrimidin-4-yl]-methyl-amino}-metiryl)-piperidine-l-carboxylic acid butyl ester; 4-({ [6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid cyclopropylmethyl ester; {4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperazin-1-y1}-acetic acid ethyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-piperazin-1-yl]-pyrimidin-4-yl}-amine; 4-({[6-(2,5-Ditluoro-4-hydroxy-phenylamino)-pyrimidin-4-yl]-methyl-amino} -methyl)-piperidine- l -carboxylic acid isobutyl ester; 4-({[6-(4-Ethylcarbamoyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester; 4-[({6-[2-Fluoro-4-(N-hydroxycarbamimidoyl)-phenylamino]-pyrimidin-4-yl}-methyl-amino)-methyl]-piperidine-l-carboxylic acid isobutyl ester; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-1-carboxylic acid 3-methyl-butyl ester; 4-({[6-(2,5-Difluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino }-methyl)-piperidine- l -carboxylic acid isopropyl ester; (5-Butyl-pyridin-2-yl)-[4-({[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidin-1-yl]-methanone;
N-(2-Fluoro-4-methanesulfonyl-phenyl)-N'-(5'-fluoro-3,4,5,6-tetrahydro-2H-[ 1,2']bipyridinyl-4-ylmethyl)-N'-methyl-pyrimidine;-4,6-diamine; 4-({[6-(4-Carbamimidoyl-2-fluoro-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid cyclobutyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-ylamino]-piperidine-1-carboxylic acid tert-butyl ester; N-(2-Fluoro-4-methanesulfonyl-phenyl)-N'-[1-(3-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-piperidin-4-yhnethyl]-N'-methyl-pyrimidine;-4,6-diamine; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-methyl-amino} -methyl)-piperidine-l -carboxylic acid 1-ethyl-propyl ester; 4-({Ethyl-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-amino}-methyl)-piperidine-1-carboxylic acid tert-butyl ester;
4-({Ethyl-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-y1]-amino}-methyl)-piperidine-l-carboxylic acid isopropyl ester; 4-({[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-etlryl-amino}-methyl)-piperidine-l-carboxylic acid isopropyl ester; 4-({[6-(4-Amino-2,5-difluoro-phenoxy)-pyrimidin-4-yl]-ethyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[6-(2,5-Difluoro-4-methoxy-phenylamino)-pyrimidin-4-yl]-ethyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({ [6-(2,5-Difluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-ethyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({Ethyl-[6-(2,4,5-Difluoro-pbenylamino)-pyrimidin-4-yl]-amino }-methyl)-piperidine-l-carboxylic acid tert-butyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; 4-[(Ethyl-{6-[4-(N-ethylcarbamimidoyl)-2,5-difluoro-phenylamino]-pyrimidin-4-yl}-amino)-methyl]-piperidine-l-carboxylic acid isopropyl ester; 4-({[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yl]-ethyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-[({6-[5-(2-Amino-ethyl amino)-4-cyano-2-fluoro-phenylamino] -pyrimidin-4-y1 } -ethy l-amino)-methyl]-piperidine-1-carboxylic acid isopropyl ester; {1-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperidin-4-yl}-acetic acid methyl ester; 3-{4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-piperazin-l-yl)-propionic acid ethyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isobutyl-phenyl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isopropyl-phenyl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; {6-[4-(3-Cyclopropylmethyl-[1,2,4]oxadiazol-5-yl)-piperidin-1-y1]-pyrimidin-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
(2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-isobutyl-[1,2,4]oxadiazol-5 yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isopropoxy-phenyl)-piperazin-1-yl]-pyrimidin-4-yl}-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(4-isopropoxy-phenyl)-piperidin-1-yl]-pyrimidin-4-y1}-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(5-isopropoxy-pyridin-2-yl)-piperazin-l-yl]-pyrimidin-4-yl} -amine; {6-[4-(3-Dimethylaminomethyl-[ 1,2,4] oxadiazol-5-yl)-piperidin-1-yl]-pyrimidin-4-yl}-(2-fluoro-4-methanesulfonyl-phenyl)-amine;
(2-Fluoro-4 -methanesulfonyl-phenyl)-(6- { 4-[2 -(3 -isopropyl-[ 1,2,4) oxadiazol-5 -yl)-ethyl]-piperazin-l -yl}-pyrimidin-4-yl)-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(5-isopropoxy-pyridin-2-yloxy)-piperidin-1-yl]-pyrimidin-4-yl}-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3-pyridin-3-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pyrimidin-4-yl}-amine; 2,5-Difluoro-4-{6-[4-(4-isopropoxy-phenyl)-piperazin-l-yl]-pyrimidin-4-ylamino}-benzonitrile; 4-{[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-ylamino]-methyl}-piperidine-l-carboxylic acid tert-butyl ester; 4-{[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-ylamino]-methyl}-piperidine-l-carboxylic acid isopropyl ester; 4-({[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yl]-isopropyl-amino}-methyl)-piperidine-l-carboxylic acid tert-butyl ester; 4-({[4-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester; and 4-({[2-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-4-yl]-methyl-amino}-methyl)-piperidine-l-carboxylic acid isobutyl ester.
Specific examples of GPR1 19 agor_ists disclosed in U.S. Patent Application No. 60/577,354 include the following compounds according to Formula (V) (referred to herein as Group E2): 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3-isopropyl-[1,2,4]
oxadiazol-5-ylmethyl)-piperidin-4-yloxy]-pyrimidin-4-yl}-amine; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; (6-Chloro-pyridin-2-yl)-{4-[6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-1-yl} -methanone; (6-Bromo-pyrid in-2-yl)- { 4- [6-(2-fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-1-yl} -methanone; {4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-l-yl}-(6-methyl-pyridin-2-yl)-methanone; {4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-I-yl}-(6-fluoro-pyridin-2-yl)-methanone; {4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidin-l-yl}-pyridin-2-yl-methanone; (5-Bromo-pyridin-3-yl)-{4-[6-(2-fluoro-4-methanesulfonyi-phenylamino)-pyrimidin-4-yloxy]-piperidin-l-yl}-methanone; {4-[ 6-(2-Fluoro-4-methanesulfonyi-phenylamino)-pyrimidin-4-y loxy] -piperidin-l -y1 } -(5-methyl-pyridin-3-yl)-methanone; (5,6-Dichloro-pyridin-3-y1)-{4-[6-(2-fluoro-4-methanesulfonyi-phenylamino)-pyrimidin-4-yloxy]-piperidin-1-yl}-methanone; 4-[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-5 4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2,5-Difluoro-4-methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tort-butyl ester;
4-[6-(2,4,5-Trifluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester;
4-[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tent-butyl ester; 4-[6-(3-Fluoro-4-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tart-butyl ester; 4-[6-10 (3-Hydroxy-4-methoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(6-Cyano-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(3-Chioro-4-cyan-phenylamino)-pyrimidui-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(6-Chioro-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(3-Fluoro-4-methoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid 15 tert-butyl ester; 4-[6-(3,4-Dimethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2,3-Dihydro-benzo[1,4]dioxin-6-ylamino)-pyrimidin-4-yloxy]-piperidine-l-earboxylic acid tent butyl ester; 4-[6-(4-Cyano-2,5-difluoro-phenylamino)-pyrimidin-4 yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(4-Cyano-5-ethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(4-Ethoxy-2,5-difluoro-20 phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Ethylsulfanyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester;
4-[6-(4-Isopropylsulfanyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; (5-Butyl-pyridin-2-yl)- {4-[6-(2-fluoro-4-methanesulfonyi-phenylamino)-pyrimidin-4-yloxy]-pineridin- l -yl}-methanone; 4-[6-(5-Chioro-3-methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-25 carboxylic acid tert-butyl ester; 4-[6-(6-Acetylamino-4-methyl-pyridin-3-ylarnino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(5-Fluoro-4-methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(6-Methoxy-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(6-Methoxy-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperid'uie-l-carboxylic acid tert-butyl ester; 4-[6-(6-30 Fluoro-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester;
4-[6-(2-Chioro-6-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(4-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tort-butyl ester; 4-[6-(2-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester; 4-[6-(6-Chioro-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic 35 acid tert-butyl ester; 4-[6-(6-Fluoro-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2-Chloro-4-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(6-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester; 4-[6-(5-Fluoro-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester; 4-[6-(2-Fluoro-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid tert-butyl ester; 4-[6-(6-Chloro-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2-Methyl-pyridin-4-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(4-Chloro-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2,5-Difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Methoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Cyano-3-methoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3-Fluoro-4-hydroxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[6-(6-Ethoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-isopropoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; (2-Fluoro-4-methanesulfonyl-phenyl)-[6-(5'-isopropoxy-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-yloxy)-pyrimidin-4-yl]-amine; (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3-isopropyl-[1,2,4]oxadiazol-5-y1)-piperidin-4-yloxy]-pyrimidin-4-yl}-amine; 4-[6-(4-Cyano-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[6-(Pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(Pyridin-4-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-propoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[6-(4-Ethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Dimethylamino-2-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-isopropylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Methyl-6-propylamino-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(2-Methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Isopropylamino-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Methyl-6-propoxy-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Iodo-2-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-iodo-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[Methyl-(2-methyl-4,5,6,7-tetrahydro-2H-indazol-3-yl)-amino]-pyrimidin-4-yloxy} -piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Methyl-2H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Phenyl-2H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-tort-Butyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-p-Tolyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Methoxy-5-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Metltyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Aeetylamino-3-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3-Chloro-4-fluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3,5-Dimethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Ethyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Methyl-quinolin-6-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Methylsulfanyl-benzothiazol-6-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Moipholin-4-yl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Benzenesulfonyl-thiophen-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Piperidin-1-yl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[6-(3-Trifluoromethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Oxo-5,6,7,8-tetrahydro-naphthalen-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Methyl-lH-pyrazolo[3,4-b]pyridin-3 ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(5-Cyano-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(4-Bromo-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Trifluoromethyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Methyl-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Cyclopropyl-lH-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,6-Dimethyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Cyano-2-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l -carboxylic acid isopropyl ester; 4-[6-(4-Methoxy-2-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,4-Dimethoxy-plien),lainino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[Acetyl-(2-fluoro-4-methanesulfonyl-phenyl)-amino]-pyrimidin-4-yloxy}piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Carbamoyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[4-(3,4-Difluoro-phenyl)-thiazol-2-ylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Oxo-l-phenyl-4,5-dihydro-1H-pyrazol-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3-Oxazol-5-yl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Trifluoromethyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-I-carboxylic acid isopropyl ester;
4-[6-(4-Chloro-2-trifluoromethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[(5-Pyridin-2-yl-thiophen-2-ylmethyl)-amino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[5-(4-Chloro-phenyl)-2H-pyrazol-3-ylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(1-Oxo-indan-5-ylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-{6-[5-(1-Methyl-pyrrolidin-2-yl)-pyridin-2-ylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(6-Methoxy-2-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(5-Bromo-3-methyl-pyridin-2-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-[6-(2-Chloro-6-methyl-pyridin-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Ethynyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Bromo-2-trifluoromethoxy-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3-Iodo-4-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-5-methyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[5-(4-Methoxy-phenyl)-[1,3,4]thiadiazoi-2-ylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(3,5-Dimethyl-isoxazol-4-ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[2-(2,5-Difluoro-4-propoxy-phenylamino)-pyridin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-4-morpholin-4-yl-phenylamino)-pyrimidin-4-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[6-(2-Methyl-4-propylamino-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(4-methyl-piperazin-1-yl)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester;
4-{6-[2,5-Difluoro-4-(2-pyrrolidin-1-yl-ethoxy)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[4-(2-Dimethylamino-ethoxy)-2,5-difluoro-phenylamino]-pyrimidin-4-yloxy}-piperidine-1-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-morpholin-4-yl-ethoxy)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,4-Difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,4,5-Trifluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxytic, acid isopropyl ester; 4-[6-(4-Methanesulfonyl-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester;
4-{6-[Acetyl-(4-methanesulfonyl-phenyl)-amino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester;
(2,5-D ifluoro-4-propoxy-phenyl)- (6-[ 1-(5 -isopropyl-[ 1,2,4] oxadiazol-3-yl)-p iperidin-4-yloxy]-pyrimidin-4-yi}-amine; 4-{6-[2,5-Difluoro-4-(morpholin-4-ylamino)-pheuylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(2-methoxy-ethylamino)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester;
4-(6-{2,5-Difluoro-4-[(tetrabydro-furan-2-ylmethyl)-amino]-phenylamino } -pyrimidin-4-yloxy)-piperidine-l -carboxylic acid isopropyl ester; 4-[6-(4-Butylamino-2,5-difluoro-phenylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(3-methyl-butylamino)-phenylamino]-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-2-methyl-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-D ifluoro-4-(2-morpholin-4-yl-ethylamino)-phenylamino]-pyrimidin-4-yloxy} -piperidine-l -carboxylic acid isopropyl ester; 4-{6-[2-(2,5-Difluoro-phenoxy)-ethylamino]-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2,5-Difluoro-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(4-Bromo-2-Fuoro-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[6-(2-Fluoro-4-morpholin-4-yl-phenoxy)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-{6-[2,5-Difluoro-4-(tetrahydro-furan-2-yimethoxy)-phenylamino]-pyrimidin-4-yloxy)-piperidine-l-carboxylic acid isopropyl ester;
4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[5-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-3-yloxy]-piperidine-l-carboxylic acid tert-butyl ester; 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[4-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-2-yloxy]-piperidine-1-carboxylic acid isopropyl ester; 4-[4-(2,5-Difluoro-4-propoxy-phenylamino)-pyridin-2-yloxy]-piperidine-l-carboxylic acid isopropyl ester; and 4-[2-(2-Fluoro-4-methanesulfonyl-phenylamino)-pyridin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester; 4-[2-(2,5-Difluoro-4-propoxy-phenylamino)-pyridin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester.
Examples of GPR119 agonists are described in International Application No.
PCT/GB2004/050046 (published as WO 2005/061489). Disclosed in International Application No.
PCTIGB2004/050046 as a GPRI 19 agonist is a compound of Formula (VI):
R'-A-V-B-R2 (VI) wherein:
V is a 5-membered heteroaryl ring containing up to four heteroatoms selected from 0, N and S, optionally substituted by C1-4 alkyl;
A is -CH=CH- or (CH2),,;
B is -CH=CH- or (CH2),,, where one of the CH2 groups may be replaced by 0, NR5, S(O)m, C(O) or C(O)NR12;
n is independently 0, 1, 2 or 3;
in is independently 0, 1 or 2;
R' is 3- or 4-pyridyl, 4- or 5-pyrimidinyl or 2-pyrazinyl, any of which may be optionally substituted by one or more substituents selected from halo, C1_4 alkyl, C1_4 fluoroalkyl, C24 alkenyl, C2_4 alkynyl, C3_7 cycloalkyl, aryl, OR6, CN, NO2, S(O),,,R6, CON(R6)2, N(R6)2, NR1OCOR6, NR'OS02R6, SO2N(R6)2, a 4- to 7-membered heterocyclyl group or a 5- or 6-membered heteroaryl group;
R2 is 4- to 7-membered cycloalkyl substituted by R3, C(O)OR3, C(O)R3 or S(O)2R3, or 4- to 7-membered heterocyclyl, containing one or two nitrogen atoms which is unsubstituted or substituted by C(O)OR4, C(O)R3, S(O)2R3, C(O)NHR4, P(O)(OR")2 or a 5-or 6-membered nitrogen containing heteroaryl group;

R3 is C3.8 alkyl, C3.S alkenyl or C3.8 alkynyl, any of which may be optionally substituted with up to 5 fluoro or chloro atoms, and may contain a CH2 group that may be replaced by 0, or C3_7 cycloalkyl, aryl, heterocyclyl, heteroaryl, C alkylC3.7 cycloalkyl, C1 4 allcylaryl, C1_4 aIkylheterocyclyl or C1_4 alkylheteroaryl, any of which may be optionally substituted with one or 5 more substituents selected from halo, C1.4 alkyl, C14 fluoroalkyl, OR6, CN, CO2CI-4 alkyl, N(R6)2 and NO2;
R4 is C2_8 alkyl, C2.8 alkenyl or C2_8 alkynyl, any of which may be optionally substituted with up to 5 fluoro or chloro atoms, and may contain a CH2 group that may be replaced by 0, or C3.7 cycloalkyl, aryl, heterocyclyl, heteroaryl, C1_4 alkylC3.7 cycloalkyl, C1.4 alkylaryl, C14 10 allrylheterocyclyl or C1_4 alkylheteroaryl, any of which may be substituted with one or more substituents selected from halo, C1.4 alkyl, C1.4 fluoroalkyl, OR6, CN, CO2C1.4 allryl, N(R6)2 and NO2;
R5 is hydrogen, C(O)R7, S(O)2R8, C3.7 cycloalkyl or C1.4 alkyl optionally substituted by OR6, C3.7 cycloalkyl, aryl, heterocyclyl or heteroaryl, wherein the cyclic groups may be 15 substituted with one or more substituents selected from halo, Cl-2 alkyl, C1.2 fluoroalkyl, OR6, ON, N(R6)2 and NO2;
R6 are independently hydrogen, C14 alkyl, C3-7 cycloalkyl, aryl, lieterocyclyl or heteroaryl, wherein the cyclic groups may be substituted with one or more substituents selected from halo, C1.4 alkyl, C1_4 fluoroalkyl, OR9, CN, SO2CH3i N(R10)2 and NO2; or a group (N(R10)2 20 may form a 4- to 7-membered heterocyclic ring optionally containing a further heteroatom selected from 0 and NR10;
R7 is hydrogen, C1.4 alkyl, OR6, N(R6)2 aryl or heteroaryl;
R8 is C1-a alkyl. CI-4 fluoroalkyl, aryl or heteroaryl;
R9 is hydrogen, Cl-2 alkyl or C1.2 fluoroalkyl;
25 R10 is hydrogen or C1_4 alkyl;
R11 is phenyl; and R'L is hydrogen, C1-; alkyl Or C3-7 cycloalkyl.
The present invention also encompasses diastereomers as well as optical isomers, e.g.
mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and 30 diastereomers, which arise as a consequence of structural asymmetry in certain compounds of the invention. Separation of the individual isomers or selective synthesis of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.
Specific examples of GPR119 agonists disclosed in International Application No.
PCT/GB2004/050046 include the following compounds according to Formula (VI) (referred to herein 35 as Group F1): 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-1-carboxylic acid tert-butyl ester; 3-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 4-[5-(4-Pentylcycloh,exylmethyl)-[1,2,4]oxadiazol-3-yl]pyridine; trans-2-Chloro-4-[5-(4-pentylcyclohexane)-[ 1,2,4j oxadiazol-3-yl]pyridine; trans-4-[5-(4-Pentylcyclohexane)-[
1,2,4]oxadiazol-3-yhnethyl]pyridine; 4-(3-Pyridin-4-ylmethyl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid tert-butyl ester; t7,ans-3-[5-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-3-ylmethyl]pyridine; 4-[5-(4-Butylcyclohexane)-[1,2,4]oxadiazol-3-yl]pyridine; 4-[5-(4-n-Propylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine; bans-4-[5-(4-Pentylcyclohexane)-[1,2,4]oxadiazol-3-yl]pyridine;
4[2-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)-ethyl]piperidine-l-carboxylic acid tert-butyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)piperidine-l-carboxylic acid tert-butyl ester; 3-[5-(4-Propylcyclohexyl)-[1,2,4)oxadiazol-3-yl]pyridine; 3-[5-(4-Butylcyclohexane)-[1,2,4] oxadiazol-3-yl]pyridine; trans-4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine-2-carboxylic acid methylamide; trans-4-[5-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine-2-carboxylic acid amide;
trans-4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2-Chloro-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-3-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2-Methyl-3-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2-Chloro-6-methyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine-2-carbonitrile; trans-2-Chloro-3-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2-Chloro-6-methyl-3-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine;
trans-2-Methyl-5-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-3-Methyl-5-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2,6-Dichloro-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2-Chloro-6-methoxy-4-[3-(4-pentylcyclohexyl)-[ 1,2,4]oxadiazol-5-yl]pyridine; trans-5-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]-2-[1,2,4]triazol-1-ylpyridine; 2-[3-(4-Pentylcyclohexyl)-[I,2,4]oxadiazol-5-yl]pyrazuie; 4-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yljpyririidine; bans-5-[3 -(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine-2-carbonitrile; trans-5-Chloro-2-methylsulfanyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyrimidine; trans-2-F.luoro-5-[3-(4-pentyleyclohexyl)-[ 1,2,4] oxadiazol-5-yl]pyridine; trans-2-Fluoro-4-[3-(4-pentylcyclohexyl)-[
1,2,4]oxadiazol-5-yl]pyridine; trans-2-Irnidazol-1-y1-5-[3-(4-pentylcyclohexy!)-[1,2,4]oxadiazol-5-yl]pyridine; trans-2-Methyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-3-Methyl-4-[3-(4-pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]pyridine; trans-4-{2-[3-(4-Pentylcyclohexyl)-[1,2,4]oxadiazol-5-yl]vinyl}pyridine; 4-(5-Pyridin-4-yi-[1,2,4]oxadiazol-3-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-1-carboxylic acid tert-butyl ester; (E)-4-[5-(2-Pyridin-3-yl-vinyl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-1-carboxylic acid tert-butyl ester; (E)-4-[5-(2-Pyridin-3-yl-vinyl)-[1,2,4]oxadiazol-3-yl]piperidine-l-carboxylic acid tert-butyl ester; (E)-4-[5-(2-Pyridin-3-yl-vinyl)-[1,2,4]oxadiazol-3-ylmethyl]piperidine-l-carboxylic acid tert-butyl ester; (E)-4-[5-(2-Pyridin-4-yl-vinyl)-[1,2,4]oxadiazol-3-yl]piperidine-l-carboxylic acid tert-butyl ester; 4-[5-(2-Pyridin-4-yl-ethyl)-[1,2,4]oxadiazol-3-yl]-piperidine-l-carboxylic acid tert-butyl ester; 4-{5-[2-(2-Cyanopyridin-4-yl)ethylj-[1,2,4]oxadiazol-3-yl}piperidine-1-carboxylic acid tert-butyl ester;
4-{5-[2-(2-Cyanopyridin-4-yI)ethyl]-[1,2,4]oxadiazol-3-ylmethoxy}piperidine-l-carboxylic acid tent-butyl ester;
4-{5-[2-(2-Cyanopyridin-4-yl)ethyl]-[ 1,2,4]oxadiazol-3-ylmethyI}piperidine-l-carboxylic acid tert-butyl ester; 4-(5-Piperidin-4-yl-[l,2,4]oxadiazol-3-yl)pyridine; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid isobutyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid 2-methoxyethyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid ethyl ester; 3,3-Dimethyl-l-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidin-1-yl]butan-l-one;
2-Cyclopentyl-l-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-y1)piperidin-l-yl]ethanone; 4-{5-[1-(Butane-l-sulfonyl)piperidin-4-yl]-[1,2,4]oxadiazol-3 yl}pyridine; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid propylamide; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid tert-butylamide; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yhnethoxy)piperidine-l-carboxylic acid cyclopentyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmetboxy)piperidine-l-carboxylic acid benzyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid isobutyl ester; 4-(3-Pyridin-4-yl-[1,2,4] oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid ethyl ester; 4-(3-Pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid cycloheptyl ester;
4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid methyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 2-methoxy-ethyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid isopropyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 4-methoxy-phenyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 2,2,2-trichloroethyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yhnethoxy)piperidnie-l-carboxylic acid 4-chloro-phenyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid phenyl ester; 4-(3-Pyridin-4-yl-[l,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 2-ethyl-hexyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid propyl ester; 4-(3-Pyridin-4-yi-[1,2,4joxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid hzxyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5ylmethoxy)piperidine-l-carboxylic acid (IR,2S,5R)-2-isopropyl-5-methylcyclohexyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiaz_ol-5-ylm.ethoxy)piperidine-l-carboxylic acid (1S,2R,5S)-2-isopropyl-5-methylcyclohexyl ester; 4-(3 Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmetlioxy)piperidine-l-carboxylic acid 2,2-dimethylpropyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid naphthalen-1-yl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 2-methoxy-phenyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 3-trifluoromethylphenyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid prop-2-ynyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid but-2-ynyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid pentyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid p-tolyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 2-chloro-phenyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid naphthalen-2-yl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic acid butyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 4-methoxycarbonyl-phenyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid 4-fluoro-phenyl ester; 3-Methyl-l-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yhnethoxy)piperidin-1-yl]-butan-l-one; Phenyl-{4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-l-yl]methanone; 1-[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]butan-l-one; 2,2-Dimethyl-1-[4-(3-pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethoxy)piperidin-l-yl]propan-l-one; Cyclopentyl-{4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yhnethoxy)piperidin-1-yl]methanone; [4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-l-y1] p-tolylmethanone; 3,3-Dimethyl-l-[4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]butan-l-one; 4-{5-[1-(Butane-l-sulfonyl) piperidin-4-yloxymethyl]-[1,2,4]oxadiazol-3-yl}pyridine; 4-{5-[1-(Propane-l-sulfonyl) piperidin-4-yloxymethyl]-[1,2,4]oxadiazol-3-yl}pyridine; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yhnethoxy)piperidine-l-carboxylic acid tert-butylamide; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidine-l-carboxylic acid o-tolylamide; trans-4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)cyclohexanecarboxylic acid propyl ester; trans-4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)cyclohexanecarboxylic acid butyl ester; trans-4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yl)cyclohexanecarboxylic acid isobutyl ester; trans-4-[5-(4-Propoxymethylcyclohexyl)-[ 1,2,4] oxadiazol-3-yl]pyridine; trans-4-[5-(4-Butoxymethylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine; cis-4-[5-(3-Butoxymethylcyclopentyl)-[1,2,4]oxadiazol-3 yl]pyridine; cis-4-[5-(3-Propoxymethylcyclopentyl)-[
1,2,4]oxadiazol-3-yl]pyridine; cis-4-[5-(3-Butoxymeth),lcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)-3,4,5,6-tetrahydro-2H-[1,3']bipyridinyl; 2-[4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yllpyrazine; 2-{4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidin-1-yl]pyrimidine; (4-Pentylcyclohexyl)-(3-pyridin-4-yl-[1,2,4]oxadiazo1-5-ylmethyl)atnine; (4-Pentylcyclohexyl-methyl)-(3-pyridin-4-yl-[i, 2,4]oxadiazol-5-ylmethyl)amine; 4-[(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-l-carboxylic acid tert-butyl ester; 4-{[3-Pyridin-4-y1-[1,2,4]oxadiazol-5-ylmethyl)amino]methyl}-piperidin-l-carboxylic acid tert-butyl ester; 4-{[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethyl]amino) -piperidine-l-carboxylic acid tert-butyl ester; Methyl-(4-pentylcyclohexyl)-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amine;
Methyl-(4-pentylcyclohexylmethyl)-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amine; 4-[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-l-carboxylic acid tert-butyl ester; 4-{Ethyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-l-carboxylic acid tert-butyl ester; 4-[Propyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-l-carboxylic acid tert-butyl ester; 4-{Cyclopropylmethyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-l-carboxylic acid tert-butyl ester; 4-[Butyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-l-carboxylic acid tert-butyl ester; 4-{[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]methyl}-piperidine-l-carboxylic acid tert-butyl ester; 4-{[Ethyl-(3-pyridin-4-y1-[1,2,4]oxadiazol-5-ylmetlryl)amino]metlryl}-piperidine-l-carboxylic acid tent-butyl ester; 4-{[5-(2-Cyanopyridin-4-y1)-[1,2,4]oxadiazol-3-ylmethyl]ethylamino}-piperidine-l -carboxylic acid tert-butyl ester; 4-[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1-carboxylic acid cyclopentyl ester; 4-{[Methyl-(3-pyridin-4-yl-[1,2,4]oxadiazol-ylmethyl)amino]methyl}-piperidine-l-carboxylic acid 2,2,2-trichloroethyt ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-yhnethoxymethyl)piperidine-l-carboxylic acid tent-butyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethyl)piperazine-l-carboxylic acid tert-butyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethylsulfanyl)piperidine-l-carboxylic acid tent-butyl ester; 4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethanesulfonyl)piperidine-l-carboxylic acid tent-butyl ester; 4-(5-Pyridin-4-yl-[1,3,4]oxadiazol-2-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 3-Pyridin-4-yl-[1,2,4]oxadiazole-5-carboxylic acid (4-pentylcyclohexyl)amide; [4-(3-Pyridin-4-yl-[1,2,4]oxadiazol-5-ylmethoxy)piperidui-1-yl]phosphonic acid diphenyl ester; 4-(4-Pyridin-4-yl-thiazol-2-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 4-(2-Pyridin-4-yl-thiazol-4-ylmethyl)piperidine-l-carboxylic acid tert-butyl ester; trai?s-4-[5-(4-Pentyl-cyclohexyl)-[1,3,4]thiadiazol-2-yl]pyridine; 4-(5-Pyridin-4-yl-[1,3,4]thiadiazol-2-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 4-(5-Pyridin-4-yI-4H-[1,2,4]triazol-3-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester; 4-[2-(5-Pyridin-4-yl-isoxazol-3-yl)ethyl]piperidine-l-carboxylic acid tert-butyl ester; 4-(5-Pyridin-4-yl-isoxazol-3-ylmethoxy)piperidine-l-carboxylic acid tert-butyl ester;
4-(5-Pyridin-4-yl-isoxazol-3-ylmethyl)piperidine-l-carboxylic acid tert-butyl ester; 4-[2-(1-Methyl-5-pyridin-4-yl-1H-pyrazol-3-yl)ethyl]piperidine-l-carboxylic acid tert-butyl ester; 4-[2-(2-Methyl-5-pyridin-4-yl-2H-pyrazol-3-yl)ethyl]-piperidine-l-carboxylic acid tert-butyl ester; (E)-4-{5-[2-(2-Cyanopyridin-4-yl)vinyl]-[1,2,4]oxadiazol-3-yl}piperidine-l-carboxylic acid tert-butyl ester; 4-{5-[2-(2H-Tetrazol-5-yl)pyridine-4-yl]-[ 1,2,4]oxadiazol-3-ylmethoxy}-piperidine-l-carboxylic acid tert-butyl ester; 4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethoxy]piperidine-l-carboxylic acid isupropyl ester; and 4-[5-(2-Cyanopyridin-4-yl)-[1,2,4]oxadiazol-3-ylmethoxy)piperidine-l-carboxylic acid phenyl ester.
In one aspect of the present invention, the GPRl 19 agonise is a compound of Formula (I).
In one aspect of the present invention, the GPR1 19 agonist is a compound of Formula (II).
in one aspect of the present invention, the GPRI 19 agonist is a compound of Formula (III).
in one aspect of the present invention, the GPR119 agonist is a compound of Formula (IV).
In one aspect of the present invention, the GPR119 monist is a compound of Formula (V).
In one aspect of the present invention, the GPR1 19 monist is a compound of Formula (VI).
In one aspect of the present invention, the GPRI 19 agonist is a compound of Formula (VI), provided that the compound is not 4-(5-piperidin-4-yl-[1,2,4]oxadiazol-3-yl)pyridine, 4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine- 1 -carboxylic acid butyl ester, 4-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine, 3-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine, or 3-15-(4-propylcyclohexyl)-[ 1,2,4] oxadiazol-3-yl]pyridine.

In one aspect of the present invention, the GPR119 agonist is selected from Group Al, Group B1, Group B2, Group B3, Group B4, Group B5, Group Cl, Group C2, Group C3, Group C4, Group C5, Group C6, Group C7, Group C8, Group C9, Group C 10, Group D 1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7, Group D8, Group D9, Group D10, Group D11, Group D 12, Group D 13, Group D 14, Group E 1, Group E2 or Group F 1.
In one aspect, the GPR119 agonist is selected from the left column of Table B.
Specific examples of GPR 119 agonists include 2-(pyridine-4-yl)ethyl thiobenzoate and L-a-lysophosphatidylcholine oleoyl, as disclosed in EP 1338651.
Examples of GPR 119 agonists may be found in International Application WO
03/026661.
GPRI 19 agonists disclosed in WO 03/026661 include but are not limited to the compounds in Table C.

TABLE C

Cmpd Chemical Structure Chemical Name No.

N [2-(4-Bromo-phenyl)-6-1C N N,CH3 methyl-pyrimidin-4-yl]-~ /
Br H methyl-amine N [2-(4-Bromo-phenyl)-6-Br methyl-pyrimidin-4-yl]-p-2C \ I N N
(, H tolyl-amine N / OCH3 [2-(4-Bromo-phenyl)-6-3C \ methyl-pyrimidin-4-yl]-(4-N N
H methoxy-phenyl)-amine Br [2-(4-Bromo-phenyl)-6-N O
4C N N methyl-pyrimidin-4-ylj-J
phenyl-amine Br Cmpd Chemical Structure Chemical Name No.

[2-(4-Bromo-phenyl)-6-I methyl-pyrimidin-4-yl]-Br I H cyclohexyl-amine N 5-[2-(4-Bromo-phenyl)-6-6C I N N~~~OH ethyl-pyrimidin-4-ylamino]-H pentan-l-ol Br N Nz~ 3-[2-(4-Bromo-phenyl)-6-N N'-~'~CN methyl-pyrimidin-4-ylamino]-7C ) B r i H propionitrile N [2-(4-Bromo-phenyl)-6-ethyl-8C pyrimidin-4-yl]-(4-fluoro-N N
Br e H/ F benzyl)-amine N CI [2-(4-Bromo-phenyl)-6-ethyl-9C N pyrimidin-4-y1]-[2-(4-chloro-N H phenyl)-ethyl]-amine Br N [2-(4-Bromo-phenyl)-6-ethyl-1 OC N N N pyrimidin-4-yl]-pyridin-2-H ylmethyl-amine Br N [2-(4-Bromo-phenyl)-6-11 C methyl-pyrimidin-4-yl]-N N
I , H pyridin-3-ylmethyl-amine Br Cmpd Chemical Structure Chemical Name No.

N O 3-{[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-ylamino]-12C ~ N N tIN H
Br I / H methyl)-1H-pyridin-2-one N 4- {[2-(4-Bromo-phenyl)-6-13 C H O ethyl-pyrimidin-4-ylamino]-/ NH methyl}-lH-pyridin-2-one Br N NH 4-{2-[2-(4-Bromo phenyl)-6-methy1-pYidin-4-ylamino 14C N N O ]-Br / H ethyl}-1H-pyridin-2-one [2-(3-Chloro-4-fluoro-phenyl)-O
N CL-0 6-ethyl-pyrimidin-4-yl]-(l,l-15C Cl N H N dioxo-hexahydro-116-F thiopyran-4-yl)-amine N [6-Methyl (3,4,5-trifluoro-)?,,k N H NN, O phenyl)-pyrimidin-4-yl]-[2-(l-F oxy-pyridin-3-yl)-ethyl]-amine F

N / [6-Ethyl-2-(3,4,5 trifluoro-17 C F' N H N O phenyl)-pyrimidin-4-yl]-[2-(l -F / oxy-pyridin-3-yl)-ethyl]-amine F

F N [6-Methyl-2-(2,4,5-trifluoro-18C N H NO phenyl)-pyrimidin-4-y1]-[2-(l-F / oxy-pyridin-3-yl)-ethyl]-amine F

Cmpd Chemical Structure Chemical Name No.

N / ' 4- { 4-Methyl-6-[2-(1-oxy-19C Jf/1N N N,\ pyridin-3-yl)-ethylamino]-H O pyrimidin-2-yl}-benzonitrile NC

N / I OH 2-[4-(6-Methyl-2-phenyl-20C pyrimidin-4-ylamino)-N N
H phenyl]-ethanol N [2-(3-Chloro-phenyl)-6-21C CI Me methyl-pyrimidin-4-yl]-N N"
H methyl-amine 2- { [2-(4-Bromo-phenyl)-6-N Nzt: methyl-pyrimidin-4-yl]-I
22C I N N_ % OH methyl-amino}-ethanol;
Br e Me compound with methane Examples of GPR119 agonists may be found in International Application JP
2004269468.
GPR119 agonists disclosed in JP 2004269468 include but are not limited to the compounds in Table D.

TABLE D

Cmpd Chemical Structure Chemical Name No.

N 3-[6-Ethyl-2-(3,4,5-trifluoro-1D F ` N N~~OH phenyl)-pyrimidin-4-F I / H OH ylamino]-propane 1,2-diol F

Cmpd Chemical Structure Chemical Name No.

F N (S)-3-[6-Methyl-2-(2,3,5-I
2D F N N (S) 'OH trifluoro-phenyl)-pyrimidin-4-OH ylamino] -propane- 1,2-diol F

N (S)-3-[2-(4-Bromo-3-fluoro-Br Phenyl)-6-methyl-pyrimidin-3D F \ I N N^SOH
/ H OH 4-ylamino] -propane- 1,2-diol N (R)-3-[6-Ethyl-2-(3,4,5-4D F N N~OH trifluoro-phenyl)-pyrimidin-4-F H OH ylamino]-propane-l,2-diol F

(R)-3- [2-(3 -Chloro-4-fluoro-N
5D C' I lR1 phenyl)-6-ethyl-pyrimidin-4-\ N N" ~O H
/ H OH ylamino] propane-l,2-diol F

F (R)-3-[2-(4-Bromo-2,5-F N ~
c difluoro-phenyl)-5-fluoro-6-6D N N~OH
H = methyl-pyrimidin-4-ylamino]-gr OH
F propane-l,2-diol (R)-3-[2-(4-Chloro-2,5-F N
difluoro-phenyl)-6-7D \ N NH
/ H = difluoromethyl-pyrimidin-4-ylamino] -propane-l,2-diol F

Examples of GPR 119 agonists may be found in International Application JP
2004269469.
GPR1 19 agonists disclosed in JP 2004269469 include but are not limited to the compounds in Table E.

TABLE E

Cmpd Chemical Structure Chemical Name No.

o 5-{2-[2-(4-Bromo-phenyl)-6-N
lE NH ethyl-pyrimidin-4-ylamino]-N N
H ethyl} -IH-pyridin-2-one Br F N O 5-{2-[6-Methyl-2-(2,4,5-F trifluoro-phenyl)-pyrimidin-4-NH

H ylamino]-ethyl}-1H-pyridin-2-F one 4-{2-[2-(4-Chloro-2,5-difluoro-phenyl)-6-ethyl-F Lm, NH
3E I H 0 pyrimidin-4-ylamino]-ethyl}-CI
IH-pyridin-2-one F

6-Chloro-4- {2-[6-methyl-2-F N NH (2,4,5-trifluoro-phenyl)-H pyrimidin-4-ylamino]-ethyl }-F 1 H-pyridin-2-one F
--~~^ -- - F ?N'_ NH 4-{1-Hydroxy-2-[6-methyl-2-(2,4,5-trif uoro-phenyl)-H OH pyrimidin-4-ylamino]-ethyl}-F 1 H-pyridin-2-one F N 4- {I -Metbyl-2-[6-methyl-2-II O (2,4,5-trifluoro-phenyl)-6E N N ~ / NH
H pyrimidin-4-ylamino]-ethyl}-F
F IH-pyridin-2-one In one aspect of the present invention, the GPR119 agonist is a compound which comprises Group Al, Group B1, Group B2, Group B3, Group B4, Group B5, Group C1, Group C2, Group C3, Group C4, Group C5, Group C6, Group C7, Group C8, Group C9, Group CIO, Group D1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7, Group D8, Group D9, Group D10, Group DI I, Group D12, Group D13, Group D14, Group El, Group E2 or Group Fl.
In one aspect, the GPR119 agonist is not identical to a compound included in the left column of Table B.
In one aspect, the GPR1 19 agonist is not identical to a compound disclosed in International Application No. PCT/US2004/001267.
In one aspect, the GPR1 19 agonist is not identical to a compound disclosed in International Application No. PCT/GB2004/050046.
In one aspect, the GPRI 19 agonist is not identical to a compound of Formula (I).
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group Al.
In one aspect, the GPRI 19 agonist is not identical to a compound disclosed in International Application No. PCT/US2004/005555.
In one aspect, the GPR119 agonist is not identical to a compound of Formula (II).
In one aspect, the GPRI 19 agonist is not identical to a compound which comprises Group B 1, Group B2, Group B3, Group B4 or Group B5.
In one aspect, the GPR119 agonist is not identical to a compound, taken individually, which comprises any one of Group B1, Group B2, Group B3, Group B4 or Group B5 taken individually.
In one aspect, the GPR1 19 agonist is not identical to a compound which comprises Group B 1.
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group B2. In one aspect, the GPRI 19 agonist is not identical to a compound which comprises Group B3. In one aspect, the GPRI19 agonist is not identical to a compound which comprises Group B4. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group B5.
In one aspect, the GPRI 19 agonist is not identical to a compound disclosed in International Application No. PCT/USO4/022327.
In one aspect, the GPR119 agonist is not identical to a compound of Formula (III).
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group Cl, Group C2, Group C3, Group C4, Group C5, Group C6, Group C7, Group C8, Group C9 or Group C10.
In one aspect, the GPR119 agonist is not identical to a compound, taken individually, which comprises any one of Group Cl, Group C2, Group C3, Group C4, Group C5, Group C6, Group C7, Group CS, Group C9 or Group C10 taken individually.
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group Cl.
In one aspect, the GPRI 19 agonist is not identical to a compound which comprises Group C2. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C3. In one aspect, the GPRI19 agonist is not identical to a compound which comprises Group C4. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C5. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C6. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C7. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C8. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C9. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group C10.
In one aspect, the GPR119 agonist is not identical to a compound disclosed in International Application No. PCT/USO4/022417.
In one aspect, the GPR119 agonist is not identical to a compound of Formula (IV).
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7, Group D8, Group D9, Group D10, Group D11, Group D12, Group D13 or Group D14.
In one aspect, the GPR119 agonist is not identical to a compound, taken individually, which comprises any one of Group D1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7, Group D8, Group D9, Group DiO, Group Dll, Group D12, Group D13 or Group D14 taken individually.
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D1.
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D2. In one aspect, the GPR1 19 agonist is not identical to a compound which comprises Group D3. In one aspect, the GPRI 19 agonist is not identical to a compound which comprises Group D4.
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D5. In one aspect, the GPR1 19 agonist is not identical to a compound which comprises Group D6. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D7. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D8. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D9. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group Dl0. In one aspect, the GPR1 19 agonist is not identical to a compound which comprises Group Dll. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D12. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D13. In one aspect, the GPR119 agonist is not identical to a compound which comprises Group D14.
In one aspect, the GPR119 agonist is not identical to a compound disclosed in U.S. Patent Application No. 60/577,354.
In one aspect, the GPR119 agonist is not identical to a compound of Formula (V).
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group El or Group E2.

In one aspect, the GPR119 agonist is not identical to a compound which comprises Group El.
In one aspect, the GPR119 agonist is not identical to a compound which comprises Group E2.
In one aspect, the GPRI 19 agonist is not identical to a compound of Formula (VI).
In one aspect, the GPRI 19 agonist is not identical to a compound which comprises Group Fl.
In one aspect, the GPR119 agonist is not identical to a compound disclosed in EP 1338651.
In one aspect, the GPR119 agonist is not identical to 2-(pyridine-4-yl)ethyl thiobenzoate.
In one aspect, the GPRI 19 agonist is not identical to L-a-lysophosphatidylcholine oleoyl.
In one aspect, the GPR119. agonist is not identical to a compound disclosed in WO
03/026661.
In one aspect, the GPRI 19 agonist is not identical to a compound in Table C.
In one aspect, the GPRI 19 agonist is not identical to a compound disclosed in JP
2004269468.
In one aspect, the GPR119 agonist is not identical to a compound in Table D.
In one aspect, the GPR119 agonist is not identical to a compound disclosed in JP
2004269469.
In one aspect, the GPR119 agonist is not identical to a compound in Table E.
In one aspect, the GPRI19 agonist is not identical to a compound disclosed in WO
2005/061489.
In one aspect, the GPRI19 agonist is not identical to 4-(5-piperidin-4-yl-[1,2,4]oxadiazol-3-yl)pyridine. In one aspect, the GPR119 agonist is not identical to 4-(3-pyridin-4-yl-[1,2,4]oxadiazol-5-yl)piperidine-l-carboxylic acid butyl ester. In one aspect, the GPR1 19 agonist is not identical to 4-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine. In one aspect, the GPR119 agonist is not identical to 3-[5-(4-butylcyclohexyl)-[1,2,4]oxadiazol-3-yl]pyridine. In one aspect, the GPR119 agonist is not identical to 3-[5-(4-propylcyclohexyl)-[ 1,2,4]oxadiazol-3-yl]pyridine.
In one aspect of the present invention, any one or more GPR119 agonist can be excluded from any embodiment of the present invention.
In one aspect of the present invention, any one or more GPR119 agonist which comprises Group Al, Group Bl, Group B2, Group B3, Group B4, Group B5, Group Cl, Group C2, Group C3, Group C4, Group CS, Group C6, Group C7, Group CS, Group C9, Group CIO, Group D1, Group D2, Group D3, Group D4, Group D5, Group D6, Group D7, Group D8, Group D9, Group D10, Group DI I, Group D12, Group D13, Group D14, Group El, Group E2 or Group 171 can be excluded from any embodiment of the present invention.
In one aspect of the present invention, the GPRI 19 agonist has an EC50 of less than about 10 M, less than about I ~uM, less than about 100 nM, less than about 75 mM, less than about 50 nM, less than about 25 nM, less than about 20 nM, less than about 15 nM, less than about 10 n1M, less than about 5 rill!, less than about 4 nM, less than about 3 nM, less than about 2 nM, or less than about I
nM. Preferably the GPRI 19 agonist has an EC50 of less than about 50 ruM, less than about.25 nM, less than about 20 nM, less than about 15 nM, less than about 10 nM, less than about 5 nM, less than about 4 nM, less than about 3 nM, less than about 2 nM, or less than about 1 nM.
In one aspect of the present invention, the GPR119 agonist is a selective GPR119 agonist, wherein the selective GPR 119 agonist has a selectivity for GPR 119 over corticotrophin-releasing factor-I (CRF-1) receptor of at least about 100-fold.
In one aspect of the present invention, the GPR 119 agonist is orally active.
In one aspect of the present invention, the GPR119 agonist is an agonist of human GPR1 19.
DPP-IV Inhibitors The class of DPP-IV inhibitors useful in the novel therapeutic combinations of the present invention include compounds which exhibit an acceptably high affinity for DPP-IV. The DPP-IV
inhibitor or pharmaceutically acceptable salt may be any DPP-IV inhibitor, more preferably a selective dipeptidyl peptidase inhibitor, and most preferably a selective DPP-1V inhibitor.
Examples of DPP-IV inhibitors are described in Villhauer et al., J Med Chem (2003) 46:2774-2789, for LAF237; Ahren et al, J Clin Endocrinol Metab (2004) 89:2078-2084; Villhauer et al., J Med Chem (2002) 45:2362-2365 for NVP-DPP728; Ahren et al, Diabetes Care (2002) 25:869-875 for NVP-DPP728; Peters et al., Bioorg Med Chem Lett (2004) 14:1491-1493;
Caldwell et al., Bioorg Med Chem Lett (2004) 14:1265-1268; Edmondson et al., Bioorg Med Chem Lett (2004) 14:5151-5155; and Abe et al., J Nat Prod (2004) 67:999-1004.
Specific examples of DPP-IV inhibitors include, but are not limited to, dipeptide derivatives or dipeptide mimetics such as alanine-pyrrolidide, isoleucine-thiazolidide, and the pseudosubstrate N-valyl prolyl, O-benzoyl hydroxylamine, as described e.g. in U.S. Pat. No.
6,303,661.
Examples of DPP-IV inhibitors may be found in U.S. Pat. Nos. 6,869,947, 6,867,205, 6,861,440, 6,849,622, 6,812,350, 6,803,357, 6,800,650, 6,727,261, 6,716,843, 6,710,040, 6,706,742, 6,645,995, 6,617,340, 6,699,871, 6,573,287, 6,432,969, 6,395,767, 6,380,398, 6,303,661, 6,242,422, 6,166,063, 6,100,234, 6,040,145. Examples of DPP-IV inhibitors may be found in U.S. Pat. Publication Nos. 2005059724, 2005059716, 2005043292, 2005038020, 2005032804, 2005004205, 2004259903, 2004259902, 2004259883, 2004254226, 2004242898, 2004229926, 2004180925, 2004176406, 2004138214, 2004116328, 2004110817, 2004106656, 2004097510, 2004087587, 2004082570, 2004077645, 2004072892, 2004063935, 2004034014, 2003232788, 2003225102, 2003216450, 2003216382, 2003199528, 2003195188, 2003162820, 2003149071, 2003134802, 2003130281, 2003130199, 2003125304, 2003119750, 2003119738, 2003105077, 2003100563, 2003087950, 2003078247, 2002198205, 2002183367, 2002103384, 2002049164, 2002006899.

Examples of DPP-IV inhibitors may be found in International Applications WO
2005/087235, WO 2005/082348, WO 2005/082849, WO 2005/079795, WO 2005/075426, WO
2005/072530, WO 2005/063750, WO 2005/058849, WO 2005/049022, WO 2005/047297, WO
2005/044195, WO 2005/042488, WO 2005/040095, WO 2005/037828, WO 2005/037779, WO
2005/034940, WO 2005/033099, WO 2005/032590, WO 2005/030751, WO 2005/030127, WO
2005/026148, WO 2005/025554, WO 2005/023762, WO 2005/020920, WO 05/19168, WO
05/12312, WO 05/12308, WO 05/12249, WO 05/11581, WO 05/09956, WO 05/03135, WO 05/00848, WO
05/00846, WO 04/112701, WO 041111051, WO 04/111041, WO 04/110436, WO
04/110375, WO
04/108730, WO 04/104216, WO 04/104215, WO 04/103993, WO 04/103276, WO
04/99134, WO
04/96806, WO 04/92128, WO 04/87650, WO 04/87053, WO 04/85661, WO 04/85378, WO
04/76434, WO 04/76433, WO 04/71454, WO 04/69162, WO 04/67509, WO 04/64778, WO
04/58266, WO 04/52362, WO 04/52850, WO 04/50022, WO 04/50658, WO 04/48379, WO
04/46106, WO 04/43940, WO 04/41820, WO 04/41795, WO 04/37169, WO 04/37181, WO
04133455, WO 04/32836, WO 04/20407, WO 04/18469, WO 04/18468, WO 04/18467, WO
04/14860, WO 04/09544, WO 04/07468, WO 04/07446, WO 04/04661, WO 04/00327, WO
031106456, WO 03/104229, WO 03/101958, WO 03/101448, WO 03/99279, WO 03/95425, WO
03/84940, WO 03/82817, WO 03/80633, WO 03/74500, WO 03/72556, WO 03/72528, WO
03/68757, WO 03/68748, WO 03/57666, WO 03/57144, WO 03/55881, WO 03/45228, WO
03/40174, WO 03/38123, WO 03/37327, WO 03/35067, WO 03/35057, WO 03/24965, WO
03/24942, WO 03/22871, WO 03/15775, WO 03/04498, WO 03/04496, WO 03/02530, WO
03/02596, WO 03/02595, WO 03/02593, WO 03/02553, WO 03/02531, WO 03/00181, WO
03/00180, WO 03/00250, WO 02/83109, WO 02/83128, WO 02/76450, WO 02/68420, WO
02/62764, WO 02/55088, WO 02/51836, WO 02/38541, WO 02/34900, WO 02/30891, WO
02/30890, WO 02/14271, WO 02/02560, WO 01/97808, WO 01/96295, WO 01/81337, WO
01/81304, WO 01/68603, WO 01/55105, WO 01/52825, WO 01/34594, WO 00/",1135, WO
00/69868, WO 00/56297, WO 00/56296, WO 00/34241, WO 00/23421, WO 00/10549, WO
99/67278, WO 99/62914, WO 99/61431, WO 99/56753, WO 99/25719, WO 99/16864, WO
98/50066, WO 98/50046, WO 98/19998, WO 98/18763, WO 97/40832, WO 95/29691, WO
95/15309, WO 93/10127, WO 93/08259, WO 91/16339, EP 1517907, EP 1513808, EP
1492777, EP
1490335, EP 1489088, EP 1480961, EP 1476435, EP 1476429, EP 1469873, EP
1465891, EP
1463727, EP 1461337, EP 1450794, EP 1446116, EP 1442049, EP 1441719, EP
11..26366, EP
1412357, EP1406873, EP 1406872, EP 1406622, EP 1404675, EP 1399420, EP
1399471, EP
1399470, EP 1399469, EP 1399433, EP 1399154, EP 1385508, EP 1377288, EP
1355886, EP
1354882, EP 1338592, EP 1333025, EP 1304327, EP 1301187, EP 1296974, EP
1280797, EP
1282600, EP 1261586, EP 1258476, EP 1254113, EP 1248604, EP 1245568, EP
1215207, EP
1228061, EP 1137635, EP 1123272, EP 1104293, EP 1082314, EP 1050540, EP
1043328, EP
0995440, EP 0980249, EP 0975359, EP 0731789, EP 0641347, EP 0610317, EP
0528858, CA

2466870, CA 2433090, CA 2339537, CA 2289125, CA 2289124, CA 2123128, DD
296075, DE
19834591, DE 19828113, DE 19823831, DE 19616486, DE 10333935, DE 10327439, DE
10256264, DE 10251927, DE 10238477, DE 10238470, DE 10238243, DE 10143840, FR
2824825, FR 2822826, JP2005507261, JP 2005505531, JP 2005502624, JP 2005500321, JP
2005500308, JP2005023038, JP 2004536115, JP 2004535445, JP 2004535433, JP 2004534836, JP
2004534815, JP 2004532220, JP 2004530729, JP 2004525929, JP 2004525179, JP 2004522786, JP
2004521149, JP 2004503531, JP 2004315496, JP 2004244412, JP 2004043429, JP 2004035574, JP
2004026820, JP 2004026678, JP 2004002368, JP 2004002367, JP 2003535898, JP 2003535034, JP
2003531204, JP 2003531191, JP 2003531118, JP 2003524591, JP 2003520849, JP 2003327532, JP
2003300977, JP 2003238566, JP 2002531547, JP 2002527504, JP 2002517401, JP 2002516318, JP
2002363157, JP 2002356472, JP 2002356471, JP 2002265439, JP 2001510442, JP 2000511559, JP
2000327689, JP 2000191616, JP 1998182613, JP 1998081666, JP 1997509921, JP 1995501078, JP
1993508624,.
In one aspect of the present invention, the DPP-IV inhibitor is valine-pyrrolidide [Deacon et al, Diabetes (1998) 47:764769].
In one aspect of the present invention, the DPP-IV inhibitor is 3-(L-Isoleucyl)thiazolidine (isoleucine-thiazolidide). Isoleucine-thiazolidide may be found in JP
2001510442, WO 97/40832, US 6,303,661, and DE 19616486. Isoleucine-thiazolidide is described as an orally active and selective DPP-IV inhibitor [Pederson et al, Diabetes (1998) 47:1253-1258].
In one aspect of the present invention, the DPP-IV inhibitor is 1-[2-[5-cyanopyridin-2-yl)amino]ethylamino]acetyl-2-cyan-(S)-pyrrolidine (NVP-DPP728). NVP-DPP728 may be found in WO 98/19998 and JP 2000511559. NVP-DPP728 is described as an orally active and selective DPP-IV inhibitor [Villhauer et al, J Med Chem (2002) 45:2362-2365].
In one aspect of the present invention, the DPP-IV inhibitor is 3(R)-Amino-l-[3-(trifluoromethyl)-5,6,7,8-tetrahydro [ 1,2,4]triazolo[4,3-a]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-l-one (MK-0431). MK-0431 may be found in EP 1412357, WO
03/04498, US 6,699,871, and US 2003100563. MK-0431 is described as an orally active and selective DPP-N inhibitor [Weber et al, Diabetes (2004) 53(Suppl.2):A151, 633-P (Abstract)].
In one aspect of the present invention, the DPP-N inhibitor is (1-[[3-hydroxy-l-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine (LAF237). LAF237 may be found in US
6,166,063, WO 00/34241, EP 1137635, and JP 2002531547.

LAF237 is described as an orally active and selective DPP-IV inhibitor [Villhauer et al, J Med Chem (2003) 46:2774-2789].
In one aspect of the present invention, the DPP-IV inhibitor is (IS,3S,5S)-2-[2(S)-Amino-2-(3-hydroxyadamantan-1-yl)acetyl]-2-azabicyclo[3.1.0]hexane-3-carbonitrile (BMS-477118).
In one aspect of the present invention, the DPP-IV inhibitor is [1-[2(S)-Amino-methylbutyryl]pyrrolidin-2(R)-yl]boronic acid (PT-100).
In one aspect of the present invention, the DPP-IV inhibitor is GSK-823093.
In one aspect of the present invention, the DPP-IV inhibitor is PSN-9301.
In one aspect of the present invention, the DPP-IV inhibitor is T-6666.
In one aspect of the present invention, the DPP-IV inhibitor is SYR-322.
In one aspect of the present invention, the DPP-IV inhibitor is SYR-619.
In one aspect of the present invention, the DPP-IV inhibitor is CR-14023.
In one aspect of the present invention, the DPP-IV inhibitor is CR-14025.
In one aspect of the present invention, the DPP-IV inhibitor is CR- 14240.
In one aspect of the present invention, the DPP-IV inhibitor is CR-13651.
In one aspect of the present invention, the DPP-IV inhibitor is NNC-72-2138.
In one aspect of the present invention, the DPP-IV inhibitor is NN-7201.
In one aspect of the present invention, the DPP-IV inhibitor is PHX- 1149.
In one aspect of the present invention, the DPP-IV inhibitor is PHX-1004.
In one aspect of the present invention, the DPP-IV inhibitor is SNT- 189379.
In one aspect of the present invention, the DPP-IV inhibitor is GRC-8087.
In one aspect of the present invention, the DPP-IV inhibitor is PT-630.
In one aspect of the present invention, the DPP-IV inhibitor is SK-0403.
In one aspect of the present invention, the DPP-IV inhibitor is GSK-825964.
In one aspect of the present invention, the DPP-IV inhibitor is TS-021.
In one aspect of the present invention, the DPP-IV inhibitor is GRC-8200.
In one aspect of the present invention, the DPP-IV inhibitor is GRC-8116.
In one aspect of the present invention, the DPP-IV inhibitor is FE 107542.
In one aspect of the present invention, the DPP-IV inhibitor is selected from the right column of Table B.
In one aspect of the present invention, the DPP-IV inhibitor is not a dipeptide derivative.
In one aspect of the present invention, the DPP-IV inhibitor is not a dipeptide mimetic.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to valine-pyrrolidide.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to alanine-pyrrolidide.

In one aspect of the present invention, the DPP-IV inhibitor is not identical to 3-(L-Isoleucyl)thiazolidine (isoleucine-thiazolidide).
In one aspect of the present invention, the DPP-IV inhibitor is not identical to N-valyl propyl,O-benzoyl hydroxylamine.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to 1-[2-[5-cyanopyridin-2-yl)amino]ethylamino]acetyl-2-cyano-(S)-pyrrolidine (NVP-DPP728).
In one aspect of the present invention, the DPP-IV inhibitor is not identical to 3(R)-Amino-l-[3-(trifluoromethyl)-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-l -one (IVIK-0431).
In one aspect of the present invention, the DPP-IV inhibitor is not identical to (1-[[3-hydroxy-I-adamantyl)amino]acetyl]-2-cyano-(S)-pyrrolidine (LAF237).
In one aspect of the present invention, the DPP-IV inhibitor is not identical to (IS,3S,5S)-2-[2(S)-Amino-2-(3-hydroxyadamantan-1-yl)acetyl]-2-azabicyclo[3.1.0]hexane-3-carbonitrile (BMS-477118).
In one aspect of the present invention, the DPP-IV inhibitor is not identical to [1-[2(S)-Amino-3-methylbutyryl]pyrrolidin-2(R)-yl]boronic acid (PT-100).
In one aspect of the present invention, the DPP-IV inhibitor is not identical to GSK-823093.
In one aspect of the present invention, the DPP-1V inhibitor is not identical to PSN-9301.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to T-6666.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to SYR-322.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to SYR-619.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to CR-14023.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to CR-14025.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to CR-14240.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to CR-13651.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to NNC-72-2138.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to NN-7201.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to PHX-1149.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to PHX-1004.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to SNT-189379.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to GRC-8087.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to PT-630.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to SK-0403.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to GSK-825964.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to TS-021.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to GRC-8200.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to GRC-8116.

In one aspect of the present invention, the DPP-IV inhibitor is not identical to FE107542.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to a compound included in the right column of Table B.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to a compound disclosed in a U.S. patent having a U.S. Pat. No. selected from the group consisting of 6,869,947, 6,867,205, 6,861,440, 6,849,622, 6,812,350, 6,803,357, 6,800,650, 6,727,261, 6,716,843, 6,710,040, 6,706,742, 6,645,995, 6,617,340, 6,699,871, 6,573,287, 6,432,969, 6,395,767, 6,380,398, 6,303,661, 6,242,422, 6,166,063, 6,100,234, and 6,040,145.
In one aspect of the present invention, the DPP-W inhibitor is not identical to a compound disclosed in a U.S. patent application having a Publication No. selected from the group consisting of 2005059724, 2005059716, 2005043292, 2005038020, 2005032804, 2005004205, 2004259903, 2004259902, 2004259883, 2004254226, 2004242898, 2004229926, 2004180925, 2004176406, 2004138214, 2004116328, 2004110817, 2004106656, 2004097510, 2004087587, 2004082570, 2004077645, 2004072892, 2004063935, 2004034014, 2003232788, 2003225102, 2003216450, 2003216382, 2003199528, 2003195188, 2003162820, 2003149071, 2003134802, 2003130281, 2003130199, 2003125304, 2003119750, 2003119738, 2003105077, 2003100563, 2003087950, 2003078247, 2002198205, 2002183367, 2002103384, 2002049164, and 2002006899.
In one aspect of the present invention, the DPP-IV inhibitor is not identical to a compound disclosed in an International Application selected from the group consisting of WO 2005/087235, WO
2005/082348, WO 2005/082849, WO 2005/079795, WO 2005/075426, WO 2005/072530, WO
2005/063750, WO 2005/058849, WO 2005/049022, WO 2005/047297, WO 2005/044195, WO
2005/042488, WO 2005/040095, WO 2005/037828, WO 2005/037779, WO 2005/034940, WO
2005/033099, WO 2005/032590, WO 2005/030751, WO 2005/030127, WO 2005/026148, WO
2005/025554, WO 2005/023762, WO 2005/020920, WO 05/19168, WO 05/12312, WO
05/12308, WO 05/12249, WO 05/11581, WO 05/09956, WO 05/03135, WO 05/00848, WO 05/00846, WO
04/112701, WO 041111051, WO 04/111041, WO 04/1 1 043 6, WO 04/110375, WO
04/108730, WO
04/104216, WO 04/104215, WO 04/103993, WO 04/103276, WO 04/99134, WO 04,96806, WO
04/92128, WO 04/87650, WO 04/87053, WO 04/85661, WO 04/85378, WO 04/76434, WO
04/76433, WO 04/71454, WO 04/69162, WO 04/67509, WO 04/64778, WO 04/58266, WO
04/52362, WO 04/52850, WO 04/50022, WO 04/50658, WO 04/48379, WO 04/46106, WO
04/43940, WO 04/41820, WO 04/41795, WO 04/37169, WO 04/37181, WO 04/33455, WO
04/32836, WO 04/20407, WO 04/18469, WO 04/18468, WO 04/18467, WO 04/14860, WO
04/09544, WO 04/07468, WO 04/07446, WO 04/04661, WO 04/00327, WO 03/106456, WO
03/104229, WO 03/101958, WO 03/101448, WO 03/99279, WO 03/95425, WO 03/84940, WO
03/82817, WO 03/80633, WO 03/74500, WO 03/72556, WO 03/72528, WO 03/68757, WO
03/68748, WO 03/57666, WO 03/57144, WO 03/55881, WO 03/45228, WO 03/40174, WO
03/38123, WO 03/37327, WO 03/35067, WO 03/35057, WO 03/24965, WO 03/24942, WO

03/22871, WO 03/15775, WO 03/04498, WO 03/04496, WO 03/02530, WO 03/02596, WO
03/02595, WO 03/02593, WO 03/02553, WO 03/02531, WO 03/00181, WO 03/00180, WO
03/00250, WO 02/83109, WO 02/83128, WO 02/76450, WO 02/68420, WO 02/62764, WO
02/55088, WO 02/51836, WO 02/38541, WO 02/34900, WO 02/30891, WO 02/30890, WO
02/14271, WO 02/02560, WO 01/97808, WO 01/96295, WO 01/81337, WO 01/81304, WO
01/68603, WO 01/55105, WO 01/52825, WO 01/34594, WO 00/71135, WO 00/69868, WO
00/56297, WO 00/56296, WO 00/34241, WO 00/23421, WO 00/10549, WO 99/67278, WO
99/62914, WO 99/61431, WO 99/56753, WO 99/25719, WO 99/16864, WO 98/50066, WO
98/50046, WO 98/19998, WO 98/18763, WO 97/40832, WO 95/29691, WO 95/15309, WO
93/10127, WO 93/08259, WO 91/16339, EP 1517907, EP 1513808, EP 1492777, EP
1490335, EP
1489088, EP 1480961, EP 1476435, EP 1476429, EP 1469873, EP 1465891, EP
1463727, EP
1461337, EP 1450794, EP 1446116, EP 1442049, EP 1441719, EP 1426366, EP
1412357, EP1406873, EP 1406872, EP 1406622, EP 1404675, EP 1399420, EP 1399471, EP
1399470, EP
1399469, EP 1399433, EP 1399154, EP 1385508, EP 1377288, EP 1355886, EP
1354882, EP
1338592, EP 1333025, EP 1304327, EP 1301187, EP 1296974, EP 1280797, EP
1282600, EP
1261586, EP 1258476, EP 1254113, EP 1248604, EP 1245568, EP 1215207, EP
1228061, EP
1137635, EP 1123272, EP 1104293, EP 1082314, EP 1050540, EP 1043328, EP
0995440, EP
0980249, EP 0975359, EP 0731789, EP 0641347, EP 0610317, EP 0528858, CA
2466870, CA
2433090, CA 2339537, CA 2289125, CA 2289124, CA 2123128, DD 296075, DE
19834591, DE
19828113, DE 19823831, DE 19616486, DE 10333935, DE 10327439, DE 10256264, DE
10251927, DE 10238477, DE 10238470, DE 10238243, DE 10143840, FR 2824825, FR 2822826, JP2005507261, JP 2005505531, JP 2005502624, JP 2005500321, JP 2005500308, 1P2005023038, JP
2004536115, JP 2004535445, JP 2004535433, JP 2004534836, JP 2004534815, JP
2004532220, JP
2004530729, JP 2004525929, JP 2004525179,JP 2004522786,JP 2004521149, JP
2004503531, JP
2004315496, JP 2004244412, JP 2004043429, JP 2004035574, JP 2004026820, JP
2004026678, JP
2004002368, JP 2004002367, JP 2003535898, JP 2003535034, JP 2003531204, JP
2003531191, JP
2003531118, JP 2003524591, JP 2003520849, JP 2003327532, JP 20033009 77, JP
2003238566, JP
2002531547, JP- 2002527504, JP 2002517401, JP 2002516318, JP 2002363157, JP
2002356472, JP
200-4356471,,'P 2002265439, JP 2001510442, JP 2000511559, JP 2000327689, JP
2000191616, JP
1998182613, JP 1998081666, JP 1997509921, JP 1995501078, and JP 1993508624.
In one aspect of the present invention, any one or more DPP-W inhibitor can be excluded from any embodiment of the present invention.
In one aspect of the present invention, the DPP-IV inhibitor has an IC50 of less than about 10 M, less than about i }LM, less than about 100 nM, less than about 75 nM, less than about 50 nM, less than about 25 aM, less than about 20 niM, less than about 15 nM, less than about 10 nM, less than about 5 nM, less than about 4 nM, less than about 3 nM, less than about 2 nM, or less than about 1 nM. Preferably the DPP-IV inhibitor has an IC50 of less than about 50 nM, less than about 25 nM, less than about 20 nM, less than about 15 nM, less than about 10 nM, less than about 5 nM, less than about 4 nM, less than about 3 nM, less than about 2 nM, or less than about 1 DM.
In one aspect of the present invention, the DPP-IV inhibitor a selective DPP-IV inhibitor, wherein the selective DPP-IV inhibitor has a selectivity for human plasma DPP-IV over one or more of PPCE, DPP-II, DPP-8 and DPP-9 of at least about 10-fold, more preferably of at least about 100-fold, and most preferably of at least about 1000-fold.
In one aspect of the present invention, the DPP-IV inhibitor is orally active.
In one aspect of the present invention, the DPP-IV inhibitor is an inhibitor of human DPP-IV.
Combination of GPR119 Agonist and DPP-IV Inhibitor By way of illustration and not limitation, an exemplary combination of GPRI 19 agonist and DPP-IV inhibitor in accordance with the present invention is provided by selecting a GPR1 19 agonist from the left column of Table B and a DPP-IV inhibitor from the right column of Table B. It is expressly contemplated that each individual combination of GPR119 agonist and DPP-IV inhibitor provided by selecting a GPRI 19 agonist from the left column of Table B and a DPP-IV inhibitor from the right column of Table B is a separate embodiment within the scope of the present invention.
TABLE B
GPR119 Agonist DPP-IV Inhibitor [6-(4-Benzenesulfonyl-piperidin-1-yl)-5-nitro- valine-pyrrolidide pyrimidin-4-yl] -(4-methanesulfonyl-phenyl)-amine {4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro- 3-(L-Isoleuoyl)thiazolidine pyrimidin-4-yll-piperadin-l-yl}-acetic acid ethyl (isoleucine-thiazolidide) ester (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[4-(3- 1-[2-[5-cyanopyrid n-2-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-l-yl]- yl)amino]ethylamino]acetyl-2-cyano-(S)-5-n itro-pyrimidin-4-yl} -amine pyrrolidine (NVP-DPP728) 6'-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-3'- 3(R)-Amino-l-[3-(trifluoromethyl)-5,6,7,8-nitro-3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4- tetrahydro[1,2,4]triazolo[4,3-a]pyrazin-7-yl]-4-carboxylic acid ethyl ester (2,4,5 -trifluorophonyl)butan-I -one (MK-0431) 1-[4-(4-Acetyl-3'-nitro-3,4,5,6-tetrahydro-2H- (1-[[3-hydroxy-l-adamantyl)amino]acetyl]-2-[ 1,2']bipyridinyl-6'-yloxy)-phenyl]-ethanone cyano-(S)-pyrrolidine (LAF237) 6'-[4-(4-Hydroxy-benzenesulfonyl)-pheno(I S,3S,58)-2-[2(S)-Amino-2-(3-nitro-3,4,5,6-tetrahydro-2H-[ 1,2']bipyridinyl-4- hydroxyadamantan-l-yl)acetyl]-2-carboxylic acid ethyl ester azabicyclo[3.1.O]hexane-3-carbonitrile (BMS-4771 18) 1-[5-(4-Benzoyl-phenoxy)-2-nitro-phenyl]- [1-[2(S)-Amino-3-methylbutyryl]pyrrolidin-2(R)-piperidine-4-carboxylic acid ethyl ester yl]boronic acid (PT-100) 1-{ 5-[4-(2-Methoxycarbonyl-acetyl)-phenoxy]-2- GSK-823 093 nitro-phenyl}-piperidine-4-carboxylic acid ethyl ester 1-[5-(2-Amino-4-ethanesulfonyl-phenoxy)-2- PSN-9301 nitro-phenyl]-piperidine-4-carboxylic acid ethyl ester 5-Bromo-l -[4-nitro-3-(4-propyl-piperidin-1-yl)- T-6666 phenyl]-1 H-pyridin-2-one 6'-Benzenesulfonylamino-3'-nitro-3,4,5,6- SYR-322 tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester 6'-(Benzenesulfonyl-methyl-amino)-3'-vitro- SYR-619 3,4,5, 6-tetrahydro-2H-[ 1,2']bipyridinyl-4-carboxylic acid ethyl ester 6'-(Benzenesulfonyl-butyl-amino)-3'-nitro- CR-14023 3,4,5,6-tetrahydro-2H-[1,2']bipyridinyl-4-carboxylic acid ethyl ester 1-[5-(4-Benzoyl-phenylamino)-2-nitro-phenyl]- CR-14025 piperidine-4-carboxylic acid ethyl ester {4-[4-Nitro-3-(4-propyl-piperidin-1-yl)- CR-14240 phenylamino]-phenyl} -phenyl-methanone 3-[6-(4-Methanesulfonyl-phenylamino)-5-vitro- CR-13651 pyrimidin-4-yloxymethyl] -pyrro lidine-l -carboxylic acid tert-butyl ester 4-[5-Cyano-6-(6-methylsulfanyl-pyridin-3 - NNC-72-213 8 ylamino)-pyrimidin-4-yloxy]-piperidine- l -carboxylic acid tert-butyl ester 4-[5-Cyano-6-(6-methanesulfonyl-pyridin-3- NN-7201 ylamino)-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester 4-[6-(4-Methanesulfonyl-phenylamino)-5-nitro- PBX-1149 pyrimidin-4-yloxy]-piperidine-l-carboxylic acid tert-butyl ester (4-Methanesulfonyl-phenyl)-[5-nitro-6- PHX-1004 (piperidin-4-yloxy)-pyrimidin-4-yl]-amine 1-{4-[6-(4-Methanesulfonyl-phenylamino)-5- SNT-189379 nitro-pyrimidin-4-yloxy] -pip eridin- l -yl} -3,3-dimethyl-butan-l -one 4-16-(4-Methanesulfonyl-phenylamino)-5-nitro- GRC-8087 pyrimidin-4-ylamino]-piperidine-l -carboxylic acid tert-butyl ester N-(4-Methanesulfonyl-phenyl)-5-nitro-N'- PT-630 piperidin-4-yl-pyrimidin-4,6-diamine 1-{4-[6-(4-Methanesulfonyl-phenylamino)-5- SK-0403 nitro-pyrimidin-4-ylamino]-piperidin-1-yl} -ethanone 4-[6-(4-Cyano-2-fluoro-phenylamino)-5-ethynyl- GSK-825964 pyrimidin-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester 4-[5-Ethynyl-6-(2-fluoro-4-[1,2,4]triazol-1-yl- 8-(3-Aminopiperidin-1-yl)-N2,7-dibenzyl-l-phenylamino)-pyrimidin-4-yloxy]-piperidine-l- methylguanine trifluoroacetate carboxylic acid isopropyl ester 4-(5-Ethynyl-6-[1-(3-isopropyl-[1,2,4]oxadiazol- N-[2-[2-[8-(3-Aminopiperidin-l-y1)-7-(2-5-yl)-piperidin-4-yloxy]-pyrimidin-4-ylamino}- butynyl)-3-methylxanthin-l-3-fluoro-benzonitrile yl]acetyl]phenyl]formamide 4-[5-Acetyl-6-(6-methanesulfonyl-pyridin-3- 8-[3(R)-Aminopiperidin-l-yl]-7-(2-butynyl)-3-ylamino)-pyrimidin-4-yloxy]-piperidine-l- riethyl=1-(quinazolin-2-ylmethyl)xanthine carboxylic acid isobutyl ester 1-[4-(1-Benzyl-azetidin-3-yloxy)-6-(6- 8-(3-Aminopiperidin-1-yl)-1-(benzo[c]-1,8-methanesulfonyl-pyridin-3-ylamino)-pyrimidin- naphthyridin-6-ylmethyl)-7-(2-butynyl)-3-5-yl]-ethanone methylxanthine 4-[5-Cyano-6-(6-propylamino-pyridin-3- 2-[8-[3(R)-Aminopiperidin-I-yl]-7-(2-butynyl)-ylamino)-pyrimidin-4-yloxy]-piperidine-l- 3-methylxanthin-l-yl]-N-(2-pyridyl)acetamide carboxylic acid isopropyl ester 4-({[6-(2-Fluoro-4-methanesulfonyl- 2-(3-Aminopiperidin-l-yl)-3-(2-butynyl)-5-phenylamino)-5-methyl-pyrimidin-4-yl]- (quinoxalin-6-ylmethyl)-4,5-dihydro-3H-isopropyl-amino} -methyl)-piperidine-l - imidazo[4,5-d] pyridazin-4-one carboxylic acid tert-butyl ester 4-(2-Fluoro-4-methanesulfonyl-phenoxy)-6-[1- (1S,3S,5S)-2-[2(S)-Amino-4,4-(3-methoxy-propyl)-piperidin-4-yloxy]-5-methyl- dimethylpentanoyl]-2-azabicyclo [3.1.O]hexane-pyrimidine 3(S)-carbonitrile trifluoroacetate 1-{4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)- Nl-(1-Cyanoethyl)-N1,3-dimethyl-L-valinamide 5-inethyi-pyrimidin-4-yloxy]-piperidin-l -yl}-3-methoxy-propan-2-ol 4-{6-[2-Fluoro-4-(5-isopropoxymethyl- (1 S,3S,5S)-2-[2(S)-Amino-2-[1-(3,3-[1,2,4]oxadiazol-3-yl)-phenoxy]-5-methyl- dimethylbutyryl)piperidin-4-yl]acetyl]-2-pyrimidin-4-yloxy}-piperidine-l-carboxylic acid azabicyclo[3.1.0]hexane-3-carbonitrile isopropyl ester 4-[6-(2-Fluoro-4-morpholin-4-yl-phenoxy)-5- 2-[7-(2-Butynyl)-1-(2-phenylethyl)-8-(1-methyl-pyrimidin-4-yloxy)-piperidine-l- piperazinyl)xanthin-3-yl] N-(2-carboxylic acid isopropyl ester propynyl)acetamide hydrochloride {4-[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5- 2-[7-(2-Butynyl)-1-(3-cyanobenzyl)-6-oxo-8-(1-methyl-pyrimidin-4-yloxy]-piperidin-l-yl)-[6-(2- piperazinyl)-6,7-dihydro-lH-purin-2-yloxy]-N-pyrrolidin-l-yl-ethyl)-pyridin-3-yl]-methanone methylbenzamide trifluoroacetate (6-Amino-pyridin-3-yl)-{4-[6-(2-fluoro-4- 2-[3-(2-Butynyl)-4-oxo-2-(1-piperazinyl)-4,5-methanesulfonyl-phenoxy)-5-methyl-pyrimidin- dihydro-3H-imidazo[4,5-d]pyridazin-5-4-yloxy]-piperidin-1-yl}-methanone ylmethyl]benzonitrile trifluoroacetate 4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl- N-[1(S)-[2(S)-Cyanopyrrolidin-1-ylcarbonyl]-4-phenoxy)-5-methyl-pyrimidin-4-yl]-amino}- (pyrazin-2-ylcarboxamido)butvl]carbamic acid 1-methyl)-piperidine-1-carboxylic acid tert-butyl acetoxyethyl ester ester 4-({Cyclopropyl-[6-(2-fluoro-4-methanesulfonyl- 2(S),4-Diamino-l-(4-thiomorpholinyl)butan-l-phenoxy)-5-m thyl-pyrimidin-4-yl]-amino}- one methyyl)-piperidine-l-carboxylic acid isopropyl ester 4-({[6-(2-Fluoro-4-methanesulfonyl-phenoxy)-5- 1-[Perhydroindol-2(S)-ylcarbonyl]azetidine-2(S)-methyl-pyrimidin-4-yl]-isopropyl-amino}- carbonitrile methyl)-piperidine-l-carboxylic acid isopropyl ester 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)- 1-(2-Benzothiazolyl)-1-[1-[(2S,3aS,7aS)-5-methyl-pyrimidin-4-ylsulfanyl]-piperidie-1- perhydroindol-2-ylcarbonyl]pyrrolidin-2(S)-carboxylic acid isopropyl ester yl]methanone hydrochloride 4-[I-(4-Methanesulfonyl-phenyl)-1H- 1-[2(S)-Amino-2-cyclohexylacetyl]-4-pyrazolo [3,4-d]pyrimidin-4-yloxy]-piperidine-l - methylazetidine-2-carbonitrile hydrochloride carboxylic acid tert-butyl ester 4-[l-(4-Methanesulfonyl-phenyl)-3-methyl-1H- 6-[2-[2-[5(S)-Cyano-4,5-dihydro-lH-pyrazol-l-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidine-l- yl]-2-oxoethylamino]ethylamino]pyridine-3-carboxylic acid tert-butyl ester carbonitrile 4-[l-(4-Methanesulfonyl-phenyl)-3,6-dimethyl- 6-[2-[2-[2(S)-Cyano-4(S)-fluoropyrrolidin-l-yl]-IH-pyrazolo[3,4-d]pyrimidin-4-yloxy]- 2-oxoethylamino]-2-methylpropylamino]-N,N-piperidine-1-carboxylic acid tert-butyl ester dimetlrylpyridine-3-sulfonamide 4-({[1-(2,5-Difluoro-phenyl)-1H-pyrazolo[3,4- trans-N-[4-[1(S)-Amino-2-[3(S)-fluoropyrrolidin-d]pyrimidin-4-yl]-methyl-amino}-methyl)- 1-yl]-2-oxoethyl]cyclohexyl]-2,4-piperidine-1-carboxylic acid tert-butyl ester difluorobenzenesulfonamide 2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)- 2(S)-A ino-l-(1-pyrrolidinyl)-2-[4-(thiazol-2-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin- ylamino)cyclohexyl]ethanone trifluoroacetate 1-yl} -1-(4-trifluoromethoxy-phenyl)-ethanone 2-{4-[1-(2-Fluoro-4-methanesulfonyl-phenyl)- N-[(1R,3R)-3-[1(S)-Amino-2-oxo-2-(1-1H-pyrazolo[3,4-d]pyrimidin-4-yloxy]-piperidin-pyrrolidinyl)ethyl]cyclopentyl]-4-1-yl} -1-(3-fluoro-phenyl)-ethanone (methylsulfonyl)benzenesulfonamide 4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H-purin- 3(R)-Amino-l-(6-benzyl-3-methyl-5,6,7,8-6-yloxy]-piperidine-l-carboxylic acid isobutyl tetrahydroimidazo[1,2-a]pyrazin-7-yl)-4-(3,4-ester difluorophenyl)butan-l-one {4-[9-(6-Methanesulfonyl-pyridin-3-yl)-9H- trans-N-[4-[1(S)-Amino-2-oxo-2-(1-purin-6-yloxy]-piperidin-i-yl}-pyridin-3-yl- pv-rrolidinyl)ethyl]cyclohexyl]-2,4-methanone difluorobenzenesulfonamide 4-[9-(4-Methanesulfonyl-phenyl)-9H-purin-6- 3(R)-Amino-4-(2,5-difluorophenyl)-1-[4-yloxy]-piperidine-l-carboxylic acid tert-butyl hydroxy-2-(trifluoromethyl)-5,6,7,8-ester tetrahydropyrido[3,4-d]pyrimidin-7-yl]butan-l-one 4-[9-(2-Fluoro-4-propionylsulfamoyl-phenyl)- N-[(1R,3R)-3-[1(S)-Amino-2-oxo-2-(1-9H-purin-6-yloxy]-piperidine-l-carboxylic acid pyrrolidin.yl)ethyl]cyclopentyl]-2-isopropyl ester (methylsulfon,mido)ethanesulfonamide 4-[9-(4-Cyano-2-fluoro-phenyl)-9H-purin-6- 2-[4-[3(R)-Amino-4-(2-fluorophenyl)butyryl]-yloxy]-piperidine-l-carboxylic acid isopropyl 3(R)-benzylpiperazin-1-yl]-N-[3-ester (methylsulfonamido)phenyl] acetamide 4-[9-(2-Fluoro-4-sulfamoyl-phenyl)-9H-purin-6- 3(R)-Amino-l-(3-thiazolidinyl)-4-(2,4,5-yloxy]-piperidine-l-carboxylic acid isopropyl tifluorophenyl)butan-l-one ester 4-[3-(4-Methanesulfonyl-phenyl)-3H- 4-{3(R)-Amino-4-(2,4,5-trifluorophenyl)butyryl]-[ 1,2,3]triazolo [4,5-d]pyrimidin-7-yloxy]- 3 (R)-methyl-l,4-diazepan-2-one piperidine-l-carboxylic acid tert-butyl ester 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[1-(3- 3(S)-Amino-4-(3,3-difluoropyrrolidin-1-yl)-N,N-isopropyl-[1,2,4]oxadiazol-5-yl)-piperidin-4- dimethyl-4-oxo-2(S)-[4-([1,2,4]triazolo[1,5-yloxy]-3H-[ 1,2,3]triazolo[4,5-d]pyrimidine a]pyridin-6-yl)phenyl]butyramide 3-Fluoro-4-{7-[1-(3-isopropyl-[ 1,2,4]oxadiazol- 3(R)-Amino-l-[2-(trifluoromethyl)-5,6,7,8-5-yl)-piperidin-4-yloxy]-[1,2,3]triazolo[4,5- tetrahydro[1,2,4]triazolo[1,5-a]pyrazine-7 yr]-4-d]pyrimidin-3-yl}-N-propionyl- (2,4,5-trifluorophenyl)butanone hydrochloride benzenesulfonamide 3-Fluoro-4-{7-[1-(3-isopropyl-[ 1,2,4]oxadiazol- 2(S)-Amino-3(S)-(4-fluorophenyl)-1-(3-5-yl)-piperidin-4-yloxy]-[1,2,3]triazolo[4,5- thiazolidinyl)butan-1 -one d]pyrimidin-3 -yl } -benzonitrile 4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5- 7-[3(R)-Amino-4-(2,5-difluorophenyl)butyryl]-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic 5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine-2-acid tert-butyl ester carboxylic acid ethyl ester 4-({Ethyl-[3 -(4-methanesulfonyl-phenyl)- 3 (R)-Amino-l -(S-chloro-l ,2,3,4-isoxazolo[4,5-d]pyrimidin-7-yl)-amino}-methyl)- tetrahydropyrazino[1,2-a]benzimidazol-2-yl)-4-piperidine-l-carboxylic acid tert-butyl ester (2,5-difluorophenyl)butan-l-one trifluoroacetate 4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5- 3(R)-Amino-4-(2,5-difluorophenyl)-1-[2-(4-d]pyrimidin-7-ylsulfanyl]-piperidine-l- fluorophenyl)-4,5,6,7-tetrahydrothiazolo[4,5-carboxylic acid tert-butyl ester c]pyridin-5-yl]butan-1-one 4-[3-(4-Methanesulfonyl-phenyl)-isoxazolo[4,5- 2-(4-[2-[3(R)-Amino-4-(2-fluorophenyl)butyryl]-d]pyrimidin-7-yloxy]-piperidine-l-carboxylic 1,2,3,4-tetrahydroisoquinolin-3-acid isopropyl ester ylcarboxamidomethyl] phenyl] acetic acid 4-[S-(2-Fluoro-4-methanesulfonyl-phenyl)- 3(S)-Amino-2-oxopiperidin-1-ylphosphonic [1,7]naphthyridin-4-yloxy]-piperidine-l- diamide hydrochloride carboxylic acid isopropyl ester 4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)- 2-[2-(5-Nitropyridin-2-ylarnino)ethylamino]-1-quinolin-4-yloxy]-piperidine-1-carboxylic acid (1-pyrrolidinyl)ethanone dihydrochloride isopropyl ester 4-[8-(4-Methylsulfanyl-phenyl)-quinolin-4- 2-[8-(3-Aminopiperidin-l-yl)-1,3-yloxy]-piperidine-l-carboxylic acid isopropyl dimethylxanthin-7-ylmethyl]benzonitrile ester hemisuccinate 4-[8-(4-Methanesulfonyl-phenyl)-quinolin-4- 2(S)-Amino-2-cyclohexyl-l-(3,3,4,4-yloxy]-piperidine-l-carboxylic acid isopropyl tetrafluoropyrrolidin-1-yl)ethanone hydrochloride ester 4-[8-(2-Fluoro-4-methanesulfonyl-phenyl)- 2(S)-Amino-2-cyclohexyl-l-(3-fluoropyrrolidin-pyrido [3,4-d]pyrimidin-4-yloxy]-piperidine-l - 1-yl)ethanone carboxylic acid isopropyl ester 4-[8-(2-Fluoro-4-propionylsulfamoyl-phenyl)- 2-Amino-l-cyclopentyl-3-methylpentan-l-one pyrido [3,4-d]pyrimidin-4-yloxy]-piperidine-l - hydrochloride carboxylic acid isopropyl ester 4-[8-(4-Cyano-2-fluoro-phenyl)-pyrido[3,4- 4-Amino-5-oxo-5-(1-pyrrolidinyl)pentanamide d]pyrimidin-4-yloxy] -piperidine-l-carboxylic acid isopropyl ester 3-(2-Fluoro-4-methanesulfonyl-phenyl)-7-[4-(3- 1-[2-[1, 1 -Dimethyl-2-(6-phenylpyridin-2-isopropyl-[1,2,4]oxadiazol-5-yl)-cyclohexyloxy]-ylamino)ethylamino]acetyl]pyrrolidine-2(S)-pyrazolo[1,5-a]pyrimidine carbonitrile hydrochloride 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol- (7R*,8S*,13bS*)-7-Butyl-11,12-dimethoxy-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyriinidin- ,3,4,4a,6,7,8,9,9a,13b-decahydro-lH-pyrido[1,2-3-yl)-N-propionyl-benzenesulfonamide f]phenanthridin-8-amine 3-Fluoro-4-{7-[4-(3-isopropyl-[1,2,4]oxadiazol- 5-(Aminomethyl)-6-(2,4-dichlorophenyl)-2-(3,5-5-yl)-cyclohexyloxy]-pyrazolo[1,5-a]pyrimidin- dimethoxyphenyl)pyrimidin-4-amine 3-yl} -benzonitrile 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-1- 3-(Aminomethyl)-4-(2,4-dichlorophenyl)-7,8-methyl-lH-pyrazolo[4,3-d]pyrimidin-7-yloxy]- dimethoxy-5H-indeno[1,2-b]pyridin-2-amuse piperidine-l-carboxylic acid isopropyl ester 4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-l- 5-(Aminomethyl)-6-(2,4-dichlorophenyl)-N2-(2-methyl-1H-pyrazolo[4,3-d]pyrimidin-7-yloxy]- methoxyethyl)-N2-methylpyrimidine-2,4-diamine piperidine-l-carboxylic acid isopropyl ester 4-[3-(4-Cyano 2-tiuoro-phenyl)-i-methyl-lH- 4,4-Difluoro-l-[2-[exo-8-(2-pyrimidinyl)-8-pyrazolo[4,3 -d] pyrimidin-7-yloxy]-piperidine- l - azabicyclo[3.2.1 ] oct-3-carboxylic acid isopropyl ester ylamiuo]acetyl]pyrrolidine-2(S)-carbonitrile 4-[3-(2-Fluoro-4-methanesulfonyl-phenyl)-2- exo-3-[2-{8-(2-Pyrimidinyl)-8-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]- azabicyclo[3.2.1 ]oct-3 -piperidine-l-carboxylic acid isopropyl ester ylamino]acetyl]thiazolidine-4(R)-carbonitrile 4-[3-(2-Fluoro-4-propionylsulfamoyl-phenyl)-2- 1-[2-[3-(2,3-Dihydro-lH-isoindol-2-yl)-1,1-methyl-2H-pyrazolo[4,3-d]pyrimidin-7-yloxy]- dmethyl-3-oxopropylamino]acetyl]pyrrolidine-piperidine-l-carboxylic acid isopropyl ester 2(S)-carbonitrile 4-[3-(4-Cyano-2-fluoro-phenyl)-2-methyl-2H- 8-(3-Aminoperhydroazepin-1-yi)-3-methyl-7-(2-WO 2006/076231 PCT[US2006/00010 pyrazolo[4,3-d]pyrimidin-7-yloxy]-piperidine-l- methylbenzyl)-2,3,6,7-tetrahydro-lH-purine-2,6-carboxylic acid isopropyl ester dione 4-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl -- 8-[3(R)-Aminopiperidin-1-yl]-7-(5-fluoro-2-piperidin-l-yl]-6-(4-methanesulfo.nyl-phenoxy)- methylbenzyl)-1,3-dimethylxanthine pyrimidine {6-[4-(3-Isopropyl-[1,2,4]oxadiazol-5-yl)- 2-[2-(3-Aminopiperidin-l-yl)-6,7-dimethoxy-4-piperidin-l-yl]-pyrimidin-4-yl} -(4- oxo-3,4-dihydroquinazolin-3-methanesulfonyl-phenyl)-amine ylmethyl]benzonitrile 4- {[6-(2-Fluoro-4-methanesulfonyl- 1-[2(S)-Amino-3,3-dimethylbutyryl]-4(S)-phenylamino)-pyrimidin-4-yl]-methyl-amino) - fluoropyrrolidine-2(S)-carbonitrile hydrochloride piperidine- l-carboxylic acid tert-butyl ester 4-[6-(2-Fluoro-4-methanesulfonyl-phenylamino)- 2-[3-(Aminomethyl)-4-butoxy-2-(2,2-pyrimidin-4-yloxy]-piperidine-l-carboxylic acid dimethylpropyl)-1-oxo-1,2-dihydroisoquinolin-6-tert-butyl ester yloxy]acetamide hydrochloride (2-Fluoro-4-methanesulfonyl-phenyl)-{6-[1-(3- 3-(3-Chloroimidazo[1,2-a]pyridin-isopropyl-[1,2,4]oxadiazol-5-ylmethyl)-piperidin- ylmethylsulfonyl)-N,N-dimethyl-lH-1,2,4-4-yloxy]-pyrimidin-4-yl}-amine; 4-[6-(2-Fluoro- triazole-l-carboxamide 4-methanesulfonyl-phenylamino)-pyrimid in-4-yloxy]-piperidine-l-carboxylic acid isopropyl ester (6-Chloro-pyridin-2-yl)-{4-[6-(2-fluoro-4- 6-Chloro-2-isobutyl-4-phenylquinolin-3-methanesulfonyl-phenylamino)-pyrimidin-4- ylmethylamine yloxy]-piperidin-1-yl} -methanone [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]- trans- 1-[2-[4-(1,3-Dioxo-2,3-dihydro-lH-methyl-amine isoirdol-2-yl)cyclohexylamino]acetyl] pyrrolidine-2(S)-carbonitrile hydrochloride [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]- trans-4-[2-[4(R)-Cyanothiazolidin-3-yl]
p-tolyl-amine oxoethylamino]-N,N-dimethylcyclohexanecarboxamide hydrochloride [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]- N-(5-Chloropyridin-2-yl)-2-[4-[1-[2-(4-(4-methoxy-phenyl)-amine cyanothiazolidin-3-yl)-2-oxoethyl] hydrazino] piperidin-1-yl] acetamide tris(trifluoroacetate) [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]- 6-[2-[2-[2(S)-Cyanoazetidin-1-yl]-2-phenyl-amine oxoethylamino]ethylamino]pyridine-3-carbonitrile dihydrochloride [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]- 4(S)-Fluoro-l-[2-[1-(2-hydroxyacetyl)-4-cyclohexyl-amine methylpiperidin-4-ylamino]acetyl]pyrrolidine-2(S)-carbonitrile fumarate 5-[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4- TS-021 ylamino]-pentan-l -ol 3-[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4- GRC-8200 ylamino]-prop ionitr ile [2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-yl]-(4- GRC-8116 fluoro-benzyl)-amine [2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-yl]-[2- FE107542 (4-chloro-phenyl)-ethyl]-amine [2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-yl]-pyridin-2-ylmethyl-amine [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl] -pyridin-3-ylmethyl-amine 3- { [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl amino]-methyl } -1 H-pyridin-2-one 4- { [2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-ylamino]-methyl} -1 H-pyridin-2-one 4-{ 2-[2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-ylamino]-ethyl} -1 H-pyridin-2-one [2-(3 -Chloro-4-fluoro-phenyl)-6-ethyl-pyrimidin-4-yl]-(1,1-dioxo-hexahydro-116-thiopyran-4-yl)-amine [6-Me thyl-2-(3,4,5-trifluoro-phenyl)-pyrimidin-4-yi]-[2-(1-oxy-pyridin-3-yl)-ethyl]-amine [6-Ethyl-2-(3,4,5-trifluoro-phenyl)-pyrimidin-4-yl]-[2-(1-oxy-pyridin-3-yl)-ethyl]-amine [6-ivlethyl-2-(2,4, 5-trifluoro-phenyl)-pyrimidin-4-yl]-[2-(l-oxy-pyridin-3-yl)-ethyl]-amine 4- {4-Me thyl-6-[2-(1-oxy-pyridin-3 -yl)-ethylamino]-pyrimidin-2-yl} -benzonitrile 2-[4-(6-Methyl-2-phenyl-pyrimidin-4-ylamino)-phenyl]-ethanol [2-(3 -Chloro-phenyl)-6-methyl-pyrimidin-4-yl]-methyl-amine 2-{ [2-(4-Bromo-phenyl)-6-methyl-pyrimidin-4-yl]-methyl-amino}-ethanol; compound with methane 3-[6-Ethyl-2-(3,4,5-trifluoro-phenyl)-pyrimidin-4-ylamino]-prop ane-1,2-diol (S')-3-[6-Methyl-2-(2,3,5-trifluoro-phenyl)-pyrimidin-4-ylamino]-propane-1, 2-diol (5)-3 -[2-(4-Bromo-3 -fluoro-phenyl)-6-methyl-pyrimidin-4-ylamino]-propane-l,2-diol (R)-3-[6-Ethyl-2-(3,4, 5-trifluoro-phenyl)-pyrimidin-4-ylamino] -propane- 1,2-diol (R)-3-[2-(3-Chloro-4-fluoro-phenyl)-6-ethyl-pyrimidin-4-ylamino] -propane-l,2-diol (R)-3-[2-(4-Bromo-2, 5-difluoro-phenyl)-5-fluoro-6-methyl-pyrimidin-4-ylamino] propane-1,2-diol (R)-3-[2-(4-Chloro-2,5-difluoro-phenyl)-6-difluoromethyl-pyrimidin-4-ylamino]-propane-1,2-diol 5-{2-[2-(4-Bromo-phenyl)-6-ethyl-pyrimidin-4-ylamino]-ethyl}-1H-pyridin-2-one 5-{2-[6-Methyl-2-(2,4,5-trifluoro-phenyl)-pyrimidin-4-ylamino]-ethyl} -1H-pyridin-2-one 4-{2-[2-(4-Chloro-2,5-difluoro-phenyl)-6-ethyl-pyrimidin-4-ylamino]-ethyl) -1 H-pyridin ;2-one 6-Chloro-4-{2-[6-methyl-2-(2,4, 5-trifluoro-phenyl)-pyrimidin-4-ylamino]-ethyl } -1 H-pyridin-2-one 4-{1-Hydroxy-2-[6-methyl-2-(2,4,5-trifluoro-phenyl)-pyrimidin-4-yl amino]-ethyl} -1 H-pyridin-2-one 4-{1-Methyl-2-[6 =methyl-2-(2,4,5-trifluoro-phenyl)-pyrimidin-4-ylamino]-ethyl} -1H-pyridin-2-one 4-(3-Pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic acid tort-butyl 4-(3-Pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic acid tert-butyl ester 4-[5-(2-Cyanopyridin-4-yl)-[ I,2,4]oxadiazol-3-ylmethoxy]piperidine-1-carboxylic acid ten-butyl ester 4-(3-Pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethoxy)piperidine- l -carboxylic acid cyclopentyl ester 4-(3-Pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethoxy)piperidine-1-carboxylic acid 2,2,2-trichloroethyl ester 4-[Ethyl-(3-pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1-carboxylic acid tert-butyl ester 4-[Methyl-(3-pyridin-4-yl-[ 1,2,4]oxadiazol-5-ylmethyl)amino]piperidine-1-carboxylic acid cyclopentyl ester 4-1 [Methyl-(3-pyridin-4-yl-[ 1 ,2,4]oxadiazol-5-ylmethyl)amino]methyl } piperidine-l -carboxylic acid 2,2,2-trichloroethyl ester Additionally, compounds of the invention, including those illustrated in TABLE
B, encompass all pharmaceutically acceptable salts, solvates, and hydrates thereof. See, e.g., Berge et al (1977), Journal of Pharmaceutical Sciences 66:1-19; and Polymorphism in Pharmaceutical Solids (1999) Brittain, ed., Marcel Dekker, Inc..
As relates to the combination therapy described above, the compounds according to the invention can be administered in any suitable way. Suitable routes of administration include oral, nasal, rectal, transmucosal, transdermal, or intestinal administration, parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, intrapulmonary (inhaled) or intraocular injections using methods known in the art. Other suitable routes of administration are aerosol and depot formulation. Sustained release formulations, particularly depot, of the invented medicaments are expressly contemplated. In certain preferred embodiments, the compounds according to the present invention are administered orally. The compounds according to the present invention can be made up in solid or liquid form, such as tablets, capsules, powders, syrups, elixirs and the like, aerosols, sterile solutions, suspensions or emulsions, and the like. In certain embodiments, one or both of the GPR1 19 agonist and the DPP-IV inhibitor are administered orally.
Formulations for oral administration may be in the form of aqueous solutions and suspensions, in addition to solid tablet and capsule formulations. The aqueous solutions and suspensions may be prepared from sterile powders or granules. The compounds may be dissolved in water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and/or various buffers. Other adjuvants are well and widely known in the art.
It will be appreciated that the GPR1 19 agonist and the DPP-IV inhibitor may be present as a combined preparation for simultaneous, separate or sequential use for the treatment or prevention of diabetes or a condition related thereto. Such combined preprations may be, for example, in the form of a twin pack.
It will therefore be further appreciated that the invention contemplates a product comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor as a combined preparation for simultaneous, separate or sequential use in the prevention or treatment of diabetes or a condition related thereto.
A combination of the present invention comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor can be prepared by mixing the GPRI 19 agonist and the DPP-IV
inhibitor either all togethez or independently with a pharmaceutically acceptable carrier, excipient, binder, dilutent, etc. as described herein, and administering the mixture or mixtures either orally or non-orally as a pharmaceutical composition(s).
It will therefore be further appreciated that the GPR119 agonist and the DPP-IV inhibitor or pharmaceutical composition can be administered in separate doseage forms or in a single doseage form.
It is further appreciated that when the GPRI19 agonist and the DPP-IV
inhibitor are in separate doseage forms, GPR119 agonist and DPP-1V inhibitor can be administered by different routes.
Pharmaceutical compositions of the GPR119 agonist and DPP-IV inhibitor, either individually or in combination, may be prepared by methods well known in the art, e.g., by means of conventional mixing, dissolving, granulation, dragee-making, levigating, emulsifying, encapsulating, entrapping, lyophilizing processes or spray drying.
Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Suitable pharmaceutically acceptable carriers are available to those in the art [see, e.g., Remington: The Science and Practice of Pharmacy, (Gennaro et al., eds.), 20`b Edition, 2000, Lippincott Williams & Wilkins; and Handbook of Pharmaceutical Excipients (Rowe et al., eds), 40' Edition, 2003, Pharmaceutical Press]. Proper formulation is dependent upon the route of administration chosen. The term "carrier" material or "excipient" material herein means any substance, not itself a therapeutic agent, used as a carrier and/or dilutent and/or adjuvant, or vehicle for delivery of a therapeutic agent to a subject or added to a pharmaceutical composition to improve its handling or storage properties or to permit or facilitate formation of a dose unit of the composition into a discrete article such as a capsule or tablet suitable for oral admininstration.
Excipients can include, by way of illustration and not limitation, diluents, disintegrants, binding agents, adhesives, wetting agents, polymers, lubricants, glidants, substances added to mask or counteract a disagreeable taste or odor, flavors, dyes, fragrances, and substances added to improved appearance of the composition. Acceptable excipients include stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, magnesium carbonate, talc, gelatin, acacia gum, sodium alginate, pectin, dextrin, mannitol, sorbitol, lactose, sucrose, starches, gelatin, cellulosic materials, such as cellulose esters of alkanoic acids and cellulose alkyl esters, low melting wax cocoa butter or powder, polymers, such as polyvinyl-pyrrolidone, polyvinyl alcohol, and polytheylene glycols, and other pharmaceutically acceptable materials. The components of the pharmaceutical composition can be encapsulated or tableted for convenient administration.
Pharmaceutically acceptable refers to those properties and/or substances which are acceptable to the patient from a pharmacological/toxicological point of view and to the manufacturing pharmaceutical chemist from a physical/chemical point of view regarding composition, formulation, stability, patient acceptance and bioavailability.
When the GPR119 agonist and the DPP-1V inhibitor are in separate doseage forms, it is understood that a pharmaceutically acceptable carrier used for the GPR1 19 agonist formulation need not be identical to a pharmaceutically acceptable carrier used for the DPP-IV
inhibitor formulation.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum Arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical compositions which can be used orally include push-fit capsules made of gelatin, as welll as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with a filler such as lactose, a binder such as starch, and/or a lubricant such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, liquid polyethylene glycols, cremophor, capmul, medium or long chain mon-, di- or triglycerides. Stabilizers may be added in these formulations, also.

Additionally, the GPR119 agonist and DPP-W inhibitor may be delivered using a sustained-release system. Various sustained-release materials have been established and are well known to those skilled in the art. Sustained-release tablets or capsules are particularly preferred. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed. The dosage form may also be coated by the techniques described in the U.S. Pat.
Nos. 4,256,108, 4,166,452, and 4,265,874 to form osmotic therapeutic tablets for controlled release.
It is expressly contemplated that a combination therapy of the present invention may be administered or provided alone or in combination with one or more other pharmaceutically or physiologically acceptable compound. In one aspect of the present invention, the other pharmaceutically or physiologically acceptable compound is not a GPR119 agonist and is not a DPP-IV inhibitor. In one aspect of the present invention, the other pharmaceutically or physiologically acceptable compound is a pharmaceutical agent selected from the group consisting of sulfonylurea (e.g., glibenclamide, glipizide, gliclazide, glimepiride), meglitinide (e.g., repaglinide, nateglinide), biguanide (e.g., metformin), alpha-glucosidase inhibitor (e.g., acarbose, epalrestat, miglitol, voglibose), thizaolidinedione (e.g., rosiglitazone, pioglitazone), insulin analog (e.g., insulin lispro, insulin aspart, insulin glargine), chromium picolinate/biotin, and biological agent (e.g., adiponectin or a fragment comprising the C-terminal globular domain thereof, or a multimer of adiponectin or said fragment thereof; or an agonist of adiponectin receptor AdipoRl or AdipoR2, preferably wherein said agonist is orally active). In one aspect of the present invention, the pharmaceutical agent is metformin. In one aspect of the present invention, the pharmaceutical agent is an agonist to adiponectin receptor AdipoRl or AdipoR2, preferably wherein the agonist is orally active.
In a combination therapy according to the present invention, the GPR119 agonist according to the present invention and the DPP-IV inhibitor according to the present invention can be administered simultaneously or at separate intervals. When administered simultaneously the GPR1 19 agonist and the DPP-IV inhibitor can be incorporated into a single pharmaceutical composition or into separate compositions, e.g., the GPR119 agonist in one composition and the DPP-IV
inhibitor in another composition.. Each of these compositions may be formulated with common excipients, diluents or carriers, and compressed into tablets, or formulated elixirs or solutions; and as sustained relief dosage forms and the Like. The GPR119 agonist and DPP-IV inhibitor may be administered via different routes. For example, the GPR119 agonist may be administered orally via tablet and the DPP-IV
inhibitor may be administered via inhalation.
d When separately administered, therapeutically effective amounts of the GPRI 19 agonist an the DPP-IV inhibitor according to the present invention are administered on a different schedule. One may be administered before the other as long as the time between the two administrations falls within a therapeutically effective interval. A therapeutically effective interval is a period of time beginning when one of either (a) the GPRI 19 agonist or (b) the DPP-IV inhibitor is administered to a mammal and ending at the limit of the beneficial effect in the treatment of the combination of (a) and (b).

In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier.
In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR1 19 agonist according to the present invention and an amount of a DPP-1V inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-1V
inhibitor are in amounts sufficient to give an effect in lowering a blood glucose level in a subject.
In certain embodiments, the blood glucose level is an elevated blood glucose level.
In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to give an effect in lowering a blood glucose level in a subject, and wherein the amount of the GPR1 19 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering the blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR1 19 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to give an effect in lowering a blood glucose level in a subject, and wherein the effect is a synergistic effect. In certain embodiments, the blood glucose level is an elevated blood glucose level.
In one aspect, the present invention relates to a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to give an effect in lowering a blood glucose level in a subject, wherein the effect is a synergistic effect, and wherein the amount of the GPR1 19 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering the blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to give an effect in increasing a blood GLP-1 level in a subject.
In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPRI 19 agonist and the DPP-1V
inhibitor are in amounts sufficient to give an effect in increasing a blood GLP-1 level in a subject, and wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in increasing a blood GLP-1 level in the subject.
In one aspect, the present invention features a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-1V inhibitor according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to give an effect in increasing a blood GLP-l level in a subject, and wherein the effect is a synergistic effect.
In one aspect, the present invention relates to a pharmaceutical composition comprising or consisting essentially of a combination of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention, together with at %5 least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of the pharmaceutical composition wherein the GPR119 agonist and the DPP-IV
inhibitor are in amounts sufficient to give an effect in increasing .a blood GLP-l level in a subject, wherein the effect is a synergistic effect, and wherein the amount of the GPRI 19 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in increasing a blood GLP-1 level in the subject.
Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an amount to achieve their intended purpose. In some embodiments, a pharmaceutical composition of the present invention is understood to be useful for treating or preventing diabetes and conditions related thereto. Diabetes and conditions related thereto are according to the present invention. In some embodiments, a pharmaceutical composition of the present invention is understood to be useful for treating or preventing a condition ameliorated by increasing a blood GLP-1 level, Conditions ameliorated by increasing a blood GLP-1 level are according to the present invention.

In certain embodiments of the combination therapy of the present invention, the amount of GPR119 agonist according to the present invention and the amount of DPP-IV
inhibitor according to the present invention are provided in amounts to give a synergistic effect in lowering a blood glucose level in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
Determination of the amounts of GPR119 agonist and DPP-IV inhibitor providing a synergistic effect in lowering blood glucose level in a subject is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In one embodiment of the combination therapy of the present invention, the amount of GPRI 19 agonist according to the present invention and the amount of DPP-IV inhibitor according to the present invention are provided in amounts to give a synergistic effect in lowering a blood glucose level in a subject, wherein the amount of the GPRI 19 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering the blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. Determination of the amounts of GPR1 19 agonist and DPP-IV inhibitor providing a synergistic effect in lowering blood glucose level in a subject, wherein the amount of the GPR1 19 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering blood glucose level in the subject, is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
In certain embodiments of the combination therapy of the present invention, the amount of GPR119 agonist according to the present invention and the amount of DPP-IV
inhibitor according to the present invention are provided in amounts to give a synergistic effect in increasing a blood GLP-l level in a subject. Determination of the amounts of GPR119 agonist and DPP-IV
inhibitor providing a synergistic effect in increasing a blood GLP-l level in a subject is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In one embodiment of the combination therapy of the present invention, the amount of GPR119 agonist according to the present invention and the amount of DPP-IV inhibitor according to the presentinvention are provided in amounts to give a synergistic effect in increasing a blood GLP-l level in a subject, wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in increasing a blood GLP-1 level in the subject. Determination of the amounts of GPRI19 agonist and DPP-IV inhibitor providing a synergistic effect in increasing a blood GLP-1 level in a subject, wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV
inhibitor alone are therapeutically ineffective in increasing a blood GLP-l level in the subject, is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
The data obtained from animal studies, including but not limited to studies using mice, rats, rabbits, pigs, and non-human primates, can be used in formulating a range of dosage for use in humans. In general, one skilled in the art understands how to extrapolate in vivo data obtained in an animal model system to another, such as.a human. In some circumstances, these extrapolations may merely be based on the weight of the animal model in comparison to another, such as a human; in other circumstances, these extrapolations are not simply based on weights but rather incorporate a variety of factors. Representative factors include the type, age, weight, sex, diet and medical condition of the patient, the severity of the disease, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetic and toxicology profiles of the particular compound employed, whether a drug delivery system is utilized, on whether an acute or chronic disease state is being treated or prophylaxis is conducted or on whether further active compounds are administered in addition to the compounds of the present invention and as part of a drug combination.
The dosage regimen for treating a disease condition with the compounds and/or compositions of this invention is selected in accordance with a variety factors as cited above.
Thus, the actual dosage regimen employed may vary widely and therefore may deviate from a preferred dosage regimen and one skilled in the art will recognize that dosage and dosage regimen outside these typical ranges can be tested and, where appropriate, may be used in the methods of this invention.
An exemplary and preferred animal model system is oral glucose tolerance test (oGTT) in mice (see, Example 1). In this model, by way of illustration and not limitation, an amount of a GPR119 agonist alone or a DPP-IV inhibitor alone which is therapeutically ineffective is an amount of the GPR119 agonist alone or the DPP-IV inhibitor alone producing an Area Under Curve (AUC) inhibition of glycemic excursion less than or equal to about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5%, more preferably less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5%. In this model, by way of illustration and not limitation, an amount of a GPRI19 agonist alone or a DPP-IV inhibitor alone which is therapeutically ineffective is an amount of the GPR119 agonist alone or the DPP-IV inhibitor alone producing an Area Under Curve (AUC) inhibition of glycemic excursion about 0-30%, about 0-25%, about 0-20%, about 0-15%, about 0-10%, or about 0-5%, more preferably about 0-25%, about 0-20%, about 0-15%, about 0-10%, or about 0-5%. In this model, by way of illustration and not limitation, a therapeutically effective amount of a combination of a GPR119 agonist and a DPP-lV inhibitor in accordance with the present invention is an amount of the combination producing an Area Under Curve (AUC) inhibition of glycemic excursion greater than about 30%, greater than about 35%, greater than about 40%, greater than about 45%, greater than about 50%, greater than about 55%, greater than about 60%, greater than about 65%, greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%, or greater than about 95%, more preferably greater than about 35%, greater than about 40%, greater than about 45%, greater than about 50%, greater than about 55%, greater than about 60%, greater than about 65%, greater than about 70%, or greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%, or greater than about 95%.
Dosage amount and interval may be adjusted in order to provide a synergistic effect in lowering a blood glucose level in the subject in accordance with the present invention or to provide a synergistic effect in increasing a blood GLP-1 level in the subject in accordance with the present invention. In certain embodiments, the blood glucose level is an elevated blood glucose level. It will be appreciated that the exact dosage of a GPR119 agonist or DPP-IV inhibitor in accordance with the present invention will vary depending on the combination of the GPR119 agonist and DPP-IV
inhibitor, its potency, the mode of administration, the age and weight of the patient and the severity of the condition to be treated. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. By way of illustration and not limitation, an amount of GPR119 agonist or DPP-IV inhibitor providing a synergistic effect in lowering a blood glucose level in the subject in accordance with the present invention or providing a synergistic effect in increasing a blood GLP-1 level in the subject in accordance with the present invention is less than about 0.001 mg/kg body weight, less than about 0.005 mg/kg body weight, less than about 0.01 mg/kg body weight, less than about 0.05 mg/kg body weight, less than about 0.1 mg/kg body weight, less than about 0.5 mg/kg body weight, less than about 1 mg/kg body weight, less than about 5 mg/kg body weight, less than about 10 mg/kg body weight, less than about 50 mg/kg body weight, or less than about 100 mg/kg body weight. In certain embodiments, the blood glucose level is an elevated blood glucose level. In some embodiments, an amount of GPR119 agonist or DPP-IV inhibitor providing a synergistic effect in lowering a blood glucose level in the subject in accordance with the present invention or providing a synergistic effect in increasing a blood GLP-1 level in the subject in accordance with the present invention is less than about 0.001-100 mg/kg body weight, less than about 0.001-50 mg/kg body weight, less than about 0.001-10 mg/kg body weight, less than about 0.001-5 mg/kg body weight, less than about 0.001-1 mg/kg body weight, less than about 0.001 to 0.5 mg/kg body weight, less than about 0.001-0.1 mg/kg body weight, less than about 0.001-0.05 mg/kg body weight, less than about 0.001-0.01 mg/kg body weight, or less than about 0.001-0.005 mg/kg body weight. In certain embodiments, the blood glucose level is an elevated blood glucose level. In. some embodiments, an amount of GPRI 19 agonist or DPP-IV
inhibitor providing a synergistic effect in lowering a blood glucose level in the subject in accordance with the present invention or providing a synergistic effect in increasing a blood GLP-1 level in the subject in accordance with the present invention is about 0.001-100 mg/kg body weight, about 0.001-50 mg/kg body weight, about 0.001-10 mg/kg body weight, about 0.001-5 mg/kg body weight, about 0.001 to 1 mg/kg body weight, about 0.001-0.5 mg/kg body weight, about 0.001-0.1 mg/kg body weight, about 0.001-0.05 mg/kg body weight, about 0.001-0.01 mg/kg body weight, or about 0.001-0.005 mg/kg body weight. In certain embodiments, the blood glucose level is an elevated blood glucose level.
An additional exemplary and preferred animal model system is increase of a blood GLP-1 level after glucose challenge in mice (see, Example 3).
Dosage amount and interval may be adjusted individually to provide plasma levels of GPRl19 agonist according to the present invention and DPP-IV inhibitor according to the present invention which provide a synergistic effect in lowering a blood glucose level in the subject according to the present invention or provide a synergistic effect in increasing a blood GLP-1 level in the subject according to the present invention. In certain embodiments, the blood glucose level is an elevated blood glucose level. Dosage intervals can also be determined using the value for a selected range of GPR119 agonist concentration or the value for a selected range of DPP-IV
inhibitor concentration providing a synergistic effect in lowering a blood glucose level in the subject according to the present invention or providing a synergistic effect in increasing a blood GLP-1 level in the subject according to the present invention. In certain embodiments, the blood glucose level is an elevated blood glucose level. GPR119 agonist and DPP-IV inhibitor should be administered using a regimen that maintains plasma levels within the selected range of GPR119 agonist concentration and DPP-1V inhibitor concentration, respectively, for 10-90% of the time, preferably between 30-99%
of the time, and most preferably between 50-90% of the time. In cases of local administration or selective uptake, the range of GPRI 19 agonist concentration or the range of DPP-IV inhibitor concentration providing a synergistic effect in lowering a blood glucose level in the subject according to the present invention or providing a synergistic effect in increasing a blood GLP-1 level in the subject according to the present invention may not be related to plasma concentration. In certain embodiments, the blood glucose level is an elevated blood glucose level.
The amount of composition admininistered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration, and the judgement of the prescribing physician.
In one aspect, the present invention accordingly features a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR1 19 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention.
In one aspect, the present invention relates to a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPRI 19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in lowering a blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
In one aspect, the present invention relates to a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention-features said mehod wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in lowering a blood glucose level in the subject, and wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering the blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
In one aspect, the present invention relates to a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPRI 19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in lowering a blood glucose level in the subject, and wherein the effect is a synergistic effect. In certain embodiments, the blood glucose level is an elevated blood glucose level.
In one aspect, the present invention relates to a method of treating or preventing diabetes or a condition related thereto comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPR119 agonist and the DPP-1V inhibitor are administered in amounts sufficient to give an effect in lowering a blood glucose level in the subject, wherein the effect is a synergistic effect, and wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering the blood glucose level in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.
A combination therapy of the present invention is useful in treating or preventing diabetes or a condition related thereto in a mammal, including and most preferably in a human. in some embodiments, diabetes is Type 1 diabetes. In some preferred embodiments, diabetes is Type 2 diabetes. A condition related to diabetes includes, but is not limited to, hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity. It is understood that conditions related to diabetes can be included in embodiments individually or in any combination.
In one aspect, the present invention accordingly features a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV
inhibitor according to the present invention.
In one aspect, the present invention relates to a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPRI 19 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in increasing a blood GLP-1 level in the subject.
In one aspect, the present invention relates to a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPR1 19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in increasing a blood GLP-1 level in the subject, and wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in increasing a blood GLP-1 level in the subject.
In one aspect, the present invention relates to a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPRI19 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPR1 19 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in increasing a blood GLP-1 level in the subject, and wherein the effect is a synergistic effect.
In one aspect, the present invention relates to a method of treating or preventing a condition ameliorated by increasing a blood GLP-1 level comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of a GPR119 agonist according to the present invention and an amount of a DPP-IV inhibitor according to the present invention. In a related aspect, the present invention features said method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to give an effect in increasing a blood GLP-1 level in the subject, wherein the effect is a synergistic effect, and wherein the amount of the GPR119 agonist alone and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in increasing a blood GLP-l level in the subject.
A combination therapy of the present invention is useful in treating or preventing a condition ameliorated by increasing a blood GLP-1 level in a mammal, including and most preferably in a human. A condition ameliorated by increasing a blood GLP-1 level includes, but is not limited to, diabetes, a condition related to diabetes, myocardial infarction, learning impairment, memory impairment, and a neurodegenerative disorder, wherein a condition related to diabetes includes, but is not limited to, hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta-cell insufficiency, enteroendocrine cell insufficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity, wherein a neurodegenerative disorder includes, but is not limited to, excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, motor-neuron disease, traumatic brain injury, spinal cord injury, and peripheral neuropathy. In some embodiments, diabetes is Type 1 diabetes. In some preferred embodiments, diabetes is Type 2 diabetes. It is understood that conditions ameliorated by increasing a blood GLP-1 level can be included in embodiments individually or in any combination.

Without further elaboration, it is believed that one skilled in the art can, using the preceding description, practice the present invention to its fullest extent. The foregoing detailed description is given for clearness of understanding only, and no unnecessary limitation should be understood therefrom, as modifications within the scope of the invention may become apparent to those skilled in the art.

The inventions described in this application were made by Arena Pharmaceuticals, Inc as a result of activities undertaken within the scope of a December 20, 2004 joint research agreement between Ortho-McNeil Pharmaceutical, Inc. and Arena Pharmaceuticals, Inc.

Throughout this application, various publications, patents and patent applications are cited.
Citation herein by Applicant of a publication, patent, or patent application is not an admission by Applicant of said publication, patent, or patent application as prior art.

EXAMPLES
Without further elaboration, it is believed that one skilled in the art can, using the preceding description, practice the present invention to its fullest extent. The following detailed examples are to be construed as merely illustrative, and not limitations of the preceding disclosure in any way whatsoever. Those skilled in the art will promptly recognize appropriate variations from the procedures.

EXAMPLE 1: SYNERGISTIC EFFECT OF GPR119 AGONIST AND DPP-IV INHIBITOR IN
LOWERING AN
ELEVATED BLOOD GLUCOSE LEVEL IN ORAL GLUCOSE TOLERANCE TEST (oGTT) m MICE
Oral glucose tolerance test (oGTT) in mice was carried out as described here.
Overnight fasted mice (n=6 mice per treatment) were administered via oral gavage with vehicle (PET), a GPRI 19 agonist (AR231453) at 1 mkg (milligram compound per kilogram of body weight), a DPP-IV inhibitor (AR247810) at 0.1 mkg, or a combination of the GPR119 agonist (1 mkg) and the DPP-IV inhibitor (0.1 mkg). Thirty minutes later, a glucose bolus (3 gram/kg) was then delivered per orally. Plasma glucose levels were determined at the indicated time points over a two hour period using blood (-5 l) collected from tail nick and a glucose meter. Gyycemic excursion curve was graphed based on data from 6 mice and given in mean values +/- SEM (Figure 1A). Area Under Curve (AUC) of the glycemic excursion was calculated for each mouse and AUC
inhibition (%) was reported in Figure 1B.
In this Example, GPR119 agonist given at 1 mkg alone, or DPP-IV inhibitor given at 0.1 mkg alone produced an AUC inhibition of glycemic excursion less than 15-20% in this mouse model, which is regarded as therapeutically ineffective for the long term glycemic control in diabetic patients.
On the other hand, the combination of both compounds at their therapeutically ineffective dose (0.1 mkg for the DPP-IV inhibitor, and 1 mkg for the GPR1 19 agonist in this Example) produced an AUC
inhibition over 60%. Typically, a therapeutically effective dose would create an AUC inhibition above 30% in this mouse model study, such as that observed for the incretin mimetic exendin-4 at -60%.
Both the DPP-IV inhibitor and the GPR119 agonist alone can produce an effective therapeutic response (at around 40% AUC inhibition) in this type of mouse model study, but only at significantly higher doses (Figure IC and Figure 1D, respectively).

EXAMPLE 2: COMBINATION OF GPR119 AGONIST AND DPP-IV TNIIIBITOR FOR TREATING OR
PREVENTING DIABETES AND CONDITIONS RELATED THERETO
A GPR1 19 agonistt in accordance with the present invention is selected. A DPP-IV inhibitor in accordance with the present invention is selected.
Titration of the GPR119 agonist with respect to percent inhibition of Area Under Curve (AUC) in mouse oral glucose tolerance test (oGTT) is determined across a dose range from about 0.01 mkg (milligram compound per kilogram of body weight) to about 100 mkg. See Example 1. A dose of the GPR119 agonist producing an AUC inhibition of glycemic excursion of about 15-20% is chosen. Typically, a dose of GPR119 agonist producing an AUC inhibition 30% or less is therapeutically ineffective in this mouse model.
Titration of the DPP-IV inhibitor with respect to percent inhibition of Area Under Curve (AUC) in mouse oral glucose tolerance test (oGTT) is determined across a dose range from about 0.01 mkg (milligram compound per kilogram of body weight) to about 100 ml-,o,. See Example 1. A dose of the DPP-IV inhibitor producing an AUC inhibition of glycemic excursion of about 15-20% is chosen. Typically, a dose of DPP-IV inhibitor producing an AUC inhibition 30%
or less is therapeutically ineffective in this mouse model.
The AUC inhibition of glycemic excursion produced by the combination of the chosen dose of the GPR119 agonist and the chosen dose of the DPP-1V inhibitor is determined in mouse oGTT
assay. Therapeutic efficacy of the combination of the GPR1 19 agonist and the DPP-IV inhibitor is determined. Typically, an amount of the combination producing an AUC
inhibition above 30% is therapeutically effective in this mouse model. Synergism between the GPR119 agonist and the DPP-IV inhibitor is determined.
Data obtained from this mouse model can be used to formulate a range of doseage for use in humans. In general, one skilled in the art understands how to extrapolate in vivo data obtained in an animal model system to another, such as a human. A combination of GPRI 19 agonist and DPP-IV
inhibitor in accordance with the present invention is useful in treating or preventing diabetes and conditions related thereto.
It is understood that the foregoing is intended to be illustrative and not limiting.

EXAMPLE 3:: SYNERGISTIC EFFECT OF GPR119 AGONIST AND DPP-IV INHIBITOR IN
INCREASING

C57b1k/6 male mice (8 weeks of age) were fasted for 18 hours, and randomly assigned into twelve groups with n=6 for each group. Mice were administered per orally with vehicle (PET), GPR119 agonist (10 mg/kg) DPP-1V inhibitor (lmg/kg), or a combination of GPR119 agonist and DPP-IV inhibitor, as indicated. The GPR1 19 agonist (AR231453) and the DPP-IV
inhibitor (AR247810) used here are identical to those used in Example 1. Thirty minutes after treatment, a glucose bolus at 3g/lcg were delivered per orally, and plasma were collected at 0 minute (no glucose bolus), and at 2 minutes and 5 minutes after glucose bolus. Plasma GLP-1 levels were determined by using a GLP-1 ELISA kit purchased from Linco Research Laboratory [Glucagon-Like Peptide-1 (Active) ELISA kit, Catalog'4EGLP-35K].
Administration of a GPR119 agonist together with a DPP-1V inhibitor was found to produce a synergistic effect in increasing a blood GLP-1 level. See Figure 2.
EXAMPLE 4: MELANOPHORE ASSAY FOR GPR119 AGONIST ACTIVITY
Melanophores are maintained in culture as reported by Potenza et al [Pigment Cell Research (1992) 5:372-378] and transfected with an expression vector encoding a GPR1 19 receptor (GPR119;
e.g., human GPR119, GenBank Accession No. AAP72125 and alleles thereof) using electroporation.
Following electroporation, the transfected cells are plated into 96 well plates for the assay. The cells are then allowed to grow for 48 hours in order to both recover from the electroporation procedure and attain maximal receptor expression levels.

On the assay day, the growth medium on the cells is replaced with serum-free buffer containing lOnM melatonin. The melatonin acts via an endogenous Gi-coupled GPCR in the melanophores to lower intracellular cAMP levels. In response to lowered cAMP levels, the melanophores translocate their pigment to the center of the cell. The net effect of this is a significant decrease in the absorbance reading of the cell monolayer in the well, measured at 600-650nM.
After a 1-hour incubation in melatonin, the cells become completely pigment-aggregated. At this point a baseline absorbance reading is collected. Serial dilutions of test compounds are then added to the plate, and compounds having GPRI 19 agonist activity produce increases in intracellular cAMP levels. In response to these increased cAMP levels, the melanophores translocate their pigment back into the cell periphery. After one hour, stimulated cells are fully pigment-dispersed. The cell monolayer in the dispersed state absorbs much more light in the 600-650nm range. The measured increase in absorbance compared to the baseline reading allows one to quantitate the degree of receptor stimulation and plot a dose-response curve.
Materials and methods relating to melanophore assay are found in U.S. Pat.
Nos. 5,462,856 and 6,051,386.
Other assays for identifying a compound as a GPR119 agonist will be readily apparent to the skilled artisan (see, e.g., Example 7, infra).

Polynucleotide encoding endogenous human GPR119 was cloned by PCR using the specific primers 5'-GTCCTGCCACTTCGAGACATGG-3' (SEQ ID NO:3; sense, ATG as initiation codon) 5'-GAAACTTCTCTGCCCTTACCGTC-3' (SEQ ID NO:4; antisense, 3' of stop codon) and human genomic DNA as template. TaqPlus Precision DNA polymerase (Stratagene) was used for amplification by the following cycle with step 2 to step 4 repeated 35 times:
94 C, 3 minutes; 94 C, 1 minute; 58 C, 1 minute; 72 C, 2 minutes; 72 C, 10 minutes.
A 1.0 Kb PCR fragment of predicted size was isolated and cloned into the pCRR-TOPOTm vector (Invitrogen) and completely sequenced using the T7 DNA sequenase kit (Amersham). See, SEQ ID NO:1 for nucleic acid sequence and SEQ ID NO:2 for the deduced amino acid sequence.

RECEPTOR EXPRESSION
Although a variety of cells are available to the art for the expression of G
protein-coupled receptors, it is most preferred that mammalian cells or melanophores be utilized. The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan. See, e.g., Example 4, supra, as it relates to melanophores.
a. Transient Transfection On day one, 6x106/ 10 cm dish of 293 cells are plated out. On day two, two reaction tubes are prepared (the proportions to follow for each tube are per plate): tube A is prepared by mixing 4ug DNA (e.g., pCIvIV vector; pCMV vector with receptor cDNA, etc.) in 0.5 ml serum free DMEM
(Gibco BRL); tube B is prepared by mixing 244l lipofectamine (Gibco BRL) in 0.5m1 serum free DMEIVI. Tubes A and B are admixed by inversions (several times), followed by incubation at room temperature for 30-45min. The admixture is referred to as the "transfection mixture". Plated 293 cells are washed with IXPBS, followed by addition of 5 ml serum free DMEM. 1 ml of the transfection mixture is added to the cells, followed. by incubation for 4hrs at 37 C/5% CO2. The transfection mixture is removed by aspiration, followed by the addition of 10ml of DMEM/10% Fetal Bovine Serum. Cells are incubated at 37 C/5% CO2. After 48hr incubation, cells are harvested and utilized for analysis.
b. Stable Cell Lines Approximately 12x106 293 cells are plated on a 15cm tissue culture plate.
Grown in DME
High Glucose Medium containing ten percent fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours following plating of 293 cells (or to -80%
confluency), the cells are transfected using 12 g of DNA (e.g., pCMV-neon vector with receptor cDNA). The 12p.g of DNA is combined with 6041 of lipofectamine and 2m1 of DME
High Glucose Medium without serum. The medium is aspirated from the plates and the cells are washed once with medium without serum. The DNA, lipofectamine, and medium mixture are added to the plate along with 10ml of medium without serum. Following incubation at 37 C for four to five hours, the medium is aspirated and 25m1 of medium containing serum is added. Twenty-four hours following transfection, the medium is aspirated again, and fresh medium with serum is added. Forty-eight hours following transfection, the medium is aspirated and medium with serum is added containing geneticin (G418 drug) at a final concentration of approximately 12x106 293 cells are plated on a 15cm tissue culture plate. Grown in DME High Glucose Medium containing ten percent fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours following plating of 293 cells (or to -80% confluency), the cells are transfected using 12 .g of DNA (e.g., pCMV vector with receptor eDNA). The 12 g of DNA is combined with 60 l of lipofectamine and 2m1 of DME
High Glucose Medium without serum. The medium is aspirated from the plates and the cells are washed once with medium without serum. The DNA, lipofectamine, and medium mixture are added to the plate along with 10ml of medium without serum. Following incubation at 37 C for four to five hours, the medium is aspirated and 25m1 of medium containing serum is added.
Twenty-four hours following transfection, the medium is aspirated again, and fresh medium with serum is added. Forty-eight hours following transfection, the medium is aspirated and medium with serum is added containing geneticin (G418 drug) at a final concentration of 500.tg/ml. The transfected cells now undergo selection for positively transfected cells containing the G418 resistance gene. The medium is replaced every four to five days as selection occurs. During selection, cells are grown to create stable pools, or split for stable clonal selection.

A variety of approaches are available for screening candidate compounds as agonists. The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan. Assays for screening compounds as agonists of a G protein-coupled receptor are well known to the skilled artisan (see, e.g., International Application WO 02/42461).
1. Membrane Binding Assays: [35SJGTPyS Assay When a G protein-coupled receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein. The alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Activated receptors continue to exchange GDP for GTP. The non-hydrolyzable GTP
analog, [35S]GTPyS, can be utilized to demonstrate enhanced binding of [31S]GTPyS to membranes expressing activated receptors. The advantage of using [35S] GTPyS binding to measure activation is that: (a) it is generically applicable to all G protein-coupled receptors; (b) it is proximal at the membrane surface making it less likely to pick-up molecules which affect the intracellular cascade.
The assay utilizes the ability of G protein coupled receptors to stimulate [35S]GTPyS binding to membranes expressing the relevant receptors. The assay is generic and has application to drug discovery at all G protein-coupled receptors.
Membrane Preparation In some embodiments, membranes comprising a G protein-coupled receptor of the invention and for use in the identification of candidate compounds as, e.g.,. agonists of the receptor, are preferably prepared as follows:
a. Materials "Membrane Scrape Buffer" is comprised of 20mM HEPES and 10mM EDTA, pH 7.4;
"Membrane Wash Buffer" is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4;
"Binding Buffer" is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl2, pH 7.4.
b. Procedure All materials will be kept on ice throughout the procedure. Firstly, the media will be aspirated from a confluent monolayer of cells, followed by rinse with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer will be added to scrape cells; this will be followed by transfer of cellular extract into 50m1 centrifuge tubes (centrifuged at 20,000 rpm for 17 minutes at 4 C). Thereafter, the supernatant will be aspirated and the pellet will be resuspended in 30m1 Membrane Wash Buffer followed by centrifuge at 20,000 rpm for 17 minutes at 4 C. The supernatant will then be aspirated and the pellet resuspended in Binding Buffer. This will then be homogenized using a Brinkman PolytronTM homogenizer (15-20 second bursts until the all material is in suspension). This is referred to herein as "Membrane Protein".
Bradford Protein Assay Following the homogenization, protein concentration of the membranes will be determined using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80 C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polytron at about 12 x 1,000 rpm for about 5-10 seconds; it is noted that for multiple preparations, the homogenizer should be thoroughly cleaned between homogenization of different preparations).
a. Materials Binding Buffer (as per above); Bradford Dye Reagent; Bradford Protein Standard will be utilized, following manufacturer instructions (Biorad, cat. no. 500-0006).
b. Procedure Duplicate tubes will be prepared, one including the membrane, and one as a control "blank".
Each contained 800, 1 Binding Buffer. Thereafter, lO 1 of Bradford Protein Standard (Img/ml) will be added to each tube, and 1041 of membrane Protein will then be added to just one tube (not the blank). Thereafter, 200 l of Bradford Dye Reagent will be added to each tube, followed by vortex of each. After five (5) minutes, the tubes will be re-vortexed and the material therein will be transferred to cuvettes. The cuvettes will then be read using a CECIL 304ITM
spectrophotometer, at wavelength 595.
Identification Assay a. Materials GDP Buffer consists of 37,5 ml Binding Buffer and 2mg GDP (Sigma, cat. no. G-7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 M GDP
(final concentration of GDP
in each well was 0.1 M GDP); each well comprising a candidate compound, has a final volume of 200 l consisting of 100 l GDP Buffer (final concentration, 0.l M GDP), 501il Membrane Protein in Binding Buffer, and 50 1 [35S]GTPyS (0.6 nM) in Binding Buffer (2.5 1 [35S]GTPyS per 10ml Binding Buffer).

b. Procedure Candidate compounds will be preferably screened using a 96-well plate format (these can be frozen at -80 C). Membrane Protein (or membranes with expression vector excluding the Target GPCR, as control), will be homogenized briefly until in suspension. Protein concentration will then be determined using the Bradford Protein Assay set forth above. Membrane Protein (and control) will then be diluted to 0.25mg/ml in Binding Buffer (final assay concentration, 12.5 g/well). Thereafter, 100 l GDP Buffer was added to each well of a Wallac ScintistripTM (Wallac). A
5u1 pin-tool will then be used to transfer 5 l of a candidate compound into such well (i.e., 5 I in total assay volume of 200 l is a 1:40 ratio such that the final screening concentration of the candidate compound is 10 M).
Again, to avoid contamination, after each transfer step the pin tool should be rinsed in three reservoirs comprising water (1X), ethanol (IX) and water (2X) - excess liquid should be shaken from the tool after each rinse and dried with paper and kimwipes. Thereafter, 50 l of Membrane Protein will be added to each well (a control well comprising membranes without the Target GPCR was also utilized), and pre-incubated for 5-10 minutes at room temperature. Thereafter, 5O 1 of [35S]GTPyS
(0.6 nM) in Binding Buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, plates were covered with foil). The assay will then be stopped by spinning of the plates at 4000 RPM for 15 minutes at 22 C.
The plates will then be aspirated with an 8 channel manifold and sealed with plate covers. The plates will then be read on a Wallac 1450 using setting "Prot. 437" (as per manufacturer's instructions).
2. Adenylyl Cyclase Assay A Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes. The Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.
In certain embodiments, a modified Flash PlateT`~' Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) is utilized for identification of candidate compounds as, e.g., GPR119 agonists in accordance with the following protocol.
Cells transfected with a G protein-coupled receptor of the invention are harvested approximately three days after transfection. Membranes are prepared by homogenization of suspended cells in buffer containing 20mM HEPES, p1-1 7.4 and 10mM MgC12.
Homogenization is performed on ice using a Brinkman Polytronmt for approximately 10 seconds. The resulting homogenate is centrifuged at 49,000 X g for 15 minutes at 4 C. The resulting pellet is then resuspended in buffer containing 20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by centrifugation at 49,000 x g for 15 minutes at 4 C. The resulting pellet is then stored at -80 C until utilized. On the day of direct identification screening, the membrane pellet is slowly thawed at room temperature, resuspended in buffer containing 20mM
HEPES, pH 7.4 and 10mM
MgCI2, to yield a final protein concentration of 0.60mg/ml (the resuspended membranes are placed on ice until use).
cAMP standards and Detection Buffer (comprising 2 MCi of tracer 1[125I]cAMP
(100 l) to 11 ml Detection Buffer] are prepared and maintained in accordance with the manufacturer's instructions.
Assay Buffer was prepared fresh for screening and contained 20mM HEPES, pH
7.4, 10mM MgCl2, 20mM phospocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 M GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer was then stored on ice until utilized.
Candidate compounds are added, preferably, to e.g. 96-well plate wells (3MUwell; 12 M final assay concentration), together with 40 pI Membrane Protein (30pg/well) and 50 I of Assay Buffer. This admixture was then incubated for 30 minutes at room temperature, with gentle shaking.
Following the incubation, 100 1 of Detection Buffer is added to each well, followed by incubation for 2-24 hours. Plates are then counted in a Wallac MicroBetaTM
plate reader using "Prot.
#31" (as per manufacturer's instructions).
3. CRE-Luc Reporter Assay 293 and 293T cells are plated-out on 96 well plates at a density of 2 x 104 cells per well and were transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions. A DNA/lipid mixture is prepared for each 6-well transfection as follows: 260ng of plasmid DNA in 100 l of DMEM is gently mixed with 2 l of lipid in lOO 1 of DMEM (the 260ng of plasmid DNA consists of 200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising a G protein-coupled receptor of the invention or pCMV alone, and I Ong of a GPRS
expression plasmid [GPRS in pcDNA3 (Invitrogen)]. The 8XCRE-Luc reporter plasmid was prepared as follows:
vector SRIF-(3-gal was obtained by cloning the rat somatostatin promoter (-71/+51) at Bg1V-HindIII site in the p(3gal-Basic Vector (Clontech). Eight (8) copies of cAMP response element were obtained by PCR from an adenovirus template AdpCF126CCRE8 [see, Suzuki et al., Hum Gene Ther (1996) 7:1883-1893) and cloned into the SRIF-(3-gal vector at the Kpn-BgIV site, resulting in the 8xCRE-(3-gal reporter vector.
The 8xCRE-Luc reporter plasmid was generated by replacing the beta-galactosidase gene in the 8xCRE-P-gal reporter vector with the luciferase gene obtained from the pGL3-basic vector (Promega) at the HindIII-BamHI site. Following 30 min. incubation at room temperature, the DNA/lipid mixture is diluted with 400 l of DMEM and 100 l of the diluted mixture is added to each well. 100 p1 of DMEM
with 10% FCS are added to each well after a 4hr incubation in a cell culture incubator. The following day the transfected cells are changed with 200 pUwell of DMEM with 10% FCS.
Eight (8) hours later, the wells are changed to 100 pl /well of DMEM without phenol red, after one wash with PBS. Luciferase activity is measured the next day using the LucLiteTM reporter gene assay kit (Packard) following manufacturer instructions and read on a 1450 MicroBetaTM
scintillation and luminescence counter (Wallac).

RADIOLABELED COMPOUND
In certain embodiments, a compound known to be a ligand of a G protein-coupled receptor of the invention is radiolabeled. A radiolabeled compound as described herein can be used in a screening assay to identify/evaluate compounds. In general terms, a newly synthesized or identified compound (i.e., test compound) can be evaluated for its ability to reduce binding of the radiolabeled known ligand to the receptor, by its ability to reduce formation of the complex between the radiolabeled known ligand and the receptor. Suitable radionuclides that may be incorporated in compounds of the present invention include but are not limited to 3H (also written as T), 11C, 14C, 18F, 125I, 82Br, 1231, 1241, 125L 1311, 75Br, 76Br, 150,13N, 35S and 77Br, Compounds that incorporate 3H, 14C, 125I
, 1311, 35S or 82Br will +generally be most useful.
It is understood that a "radiolabelled" compound" is a compound that has incorporated at least one radionuclide. In some embodiments, the radionuclide is selected from the group consisting of 3H, 14C, 1251 , 35S and 82Br. In some embodiments, the radionuclide 3H or 14C.
Moreover, it should be understood that all of the atoms represented in the compounds known to be ligands of a G protein-coupled receptor of the invention can be either the most commonly occurring isotope of such atoms or the more scarce radioisotope or nonradioactive isotope.
Synthetic methods for incorporating radioisotopes into organic compounds including those applicable to those compounds known to be ligands of a G protein-coupled receptor of the invention are well known in the art and include incorporating activity levels of tritium into target molecules include: A. Catalytic Reduction with Tritium Gas - This procedure normally yields high specific activity products and requires halogenated or unsaturated precursors. B.
Reduction with Sodium Borohydride [3H] - This procedure is rather inexpensive and requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters, and the like.
C. Reduction with Lithium Aluminum Hydride [3H ] - This procedure offers products at almost theoretical specific activities. It also requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters, and the like. D. Tritium Gas Exposure Labeling -This procedure involves exposing precursors containing exchangeable protons to tritium gas in the presence of a suitable catalyst. E. N-Methylation using Methyl Iodide [3H] - This procedure is usually employed to prepare 0-methyl or N-methyl (3H) products by treating appropriate precursors with high specific activity methyl iodide (311). This method in general allows for high specific activity, such as about 80-87 Ci/mmol.
Synthetic methods for incorporating activity levels of 1251 into target molecules include: A.
Sandmeyer and like reactions - This procedure transforms an aryl or heteroaryl amine into a diazonium salt, such as a tetrafluoroborate salt, and subsequently to 1251 labelled compound using Na12$I. A represented procedure was reported by Zhu, D.-G. and co-workers in J. Org. Chenz. 2002, 67, 943-948. B. Ortho 125Iodination of phenols - This procedure allows for the incorporation of 125I
at the ortho position of a phenol as reported by Collier, T. L. and co-workers in J Labelled Compd Radiopharin. 1999, 42, S264-S266. C. Aryl and heteroaryl bromide exchange with 125I - This method is generally a two step process. The first step is the conversion of the aryl or heteroaryl bromide to the corresponding tri-allcyltin intermediate using for example, a Pd catalyzed reaction [i.e.
Pd(Ph3P)4] or through an aryl or heteroaryl lithium, in the presence of a tri-alkyltinhalide or hexaalkylditin [e.g., (CH3)3SnSn(CH3)3]. A represented procedure was reported by Bas, M.-D. and co-workers in J. Labelled Compd Radiopharm. 2001, 44, S280-S282.
The foregoing techniques are intended to be illustrative and not limiting.
Other techniques for radiolabeling a compound known to be a ligand of a G protein-coupled receptor of the invention are well known to the skilled artisan.

RECEPTOR BINDING ASSAY
A test compound can be evaluated for its ability to reduce formation of the complex between a compound known to be a ligand of a G protein-coupled receptor of the invention and the receptor.
In certain embodiments, the known ligand is radiolabeled. The radiolabeled known ligand can be used in a screening assay to identify/evaluate compounds. In general terms, a newly synthesized or identified compound (i.e., test compound) can be evaluated for its ability to reduce binding of the radio labeled known ligand to the receptor, by its ability to reduce formation of the complex between the radiolabeled known ligand and the receptor.
Assay Protocol for Detecting the Complex Between a Compound Known to be a Ligand of a G
Protein-Coupled Receptor of the Invention and the Receptor A. Preparation of the Receptor 293 cells are transiently transfected with 10 ug expression vector comprising a polynucleotide encoding a G protein-coupled receptor of the invention using 60 ul Lipofectamine (per 15-cm dish).
The transiently transfected cells are grown in the dish for 24 hours (75%
confluency) with a media change and removed with 10 ml/dish of Hepes-EDTA buffer ( 20mMv1 Hepes + 10 mM
EDTA, pH
7.4). The cells are then centrifuged in a Beckman CoulterTM centrifuge for 20 minutes, 17,000 rpm (JA-25.50 rotor). Subsequently, the pellet is resuspended in 20 mM Hepes + 1 mM
EDTA, pH 7.4 and homogenized with a 50- ml DounceTM homogenizer and again centrifuged. After removing the supernatant, the pellets are stored at -80 C, until used in binding assay.
When used in the assay, membranes are thawed on ice for 20 minutes and then 10 mL of incubation buffer (20 mlvi Hepes, 1 mM MgC12i100 mM NaCl, pH 7.4) added. The membranes are then vortexed to resuspend the crude membrane pellet and homogenized with a Brinkmann PT-3100 Polytron homogenizer for 15 seconds at setting 6. The concentration of membrane protein is determined using the BRL Bradford protein assay.
B. Binding Assay For total binding, a total volume of 50ul of appropriately diluted membranes (diluted in assay buffer containing 50mM Tris HCl (pH 7.4), 10mM MgC12, and 1mM EDTA; 5-50ug protein) is added to 96-well polyproylene microtiter plates followed by addition of 100ul of assay buffer and 50ul of a radiolabeled known ligand. For nonspecific binding, 50 ul of assay buffer is added instead of 100ul and an additional 50u1 of l OuM said known ligand which is not radiolabeled is added before 50u1 of said radiolabeled known ligand is added. Plates are then incubated at room temperature for 60-120 minutes. The binding reaction is terminated by filtering assay plates through a Microplate Devices GF/C Unifilter filtration plate with a Brandell 96-well plate harvestor followed by washing with cold 50 mM Tris HCl, pH 7.4 containing 0.9% NaCl. Then, the bottom of the filtration plate are sealed, 5041 of Optiphase SupermixTM is added to each well, the top of the plates are sealed, and plates are counted in a Trilux MicroBetaTM scintillation counter. For determining whether less of the complex between said radiolabeled known ligand and said receptor is formed in the presence of a test compound, , instead of adding 100ul of assay buffer, 100ul of appropriately diluted said test compound is added to appropriate wells followed by addition of 50ul of said radiolabled known ligand.
A level of specific binding of the radiolabled known ligand in the presence of the test compound less than a level of specific binding of the radiolabeled known ligand in the absence of the test compound is indicative of less of the complex between said radiolabeled known ligand and said receptor being formed in the presence of the test compound than in the absence of the test compound.

The expression of GPR119 mRNA in various tissues was determined using RNase Protection Assay (RPA).
Mouse tissue RNA was obtained commercially (Clontech). A 255 bp protected fragment of mouse GPR119 was cloned into pCRII-TOPO cloning vector (Invitrogen). The sequence of the 255 bp protected fragment was as follows (nucleotides that comprise mouse GPR119 coding region are underlined):
5'-CTGGCCTGCCAGTAATGGCCAGAACGGTGCTGTGACTCTGAGCCTATAGCACAT
CTAATCCTGTCCCATGAGAATCTGAGCTCGCCATCCAGCATGCCTTTGTAAGTGGA
AGTGCTGCTACCTCACCATGGAGTCATCCTTCTCATTTGGAGTGATCCTTGCTGTCC
TAACCATCCTCATCATTGCTGTTAATGCACTGGTAGTTGTGGCTATGCTGCTATCAA
TCTACAAGAATGATGGTGTTGGCCTTTGCTT-3' (SEQ ID NO:5).

The full length probe size was 356 bp. The plasmid was linearized with BamHl and gel purified using the Sephaglass BandprepTM Kit (Amersham). After gel purification of the fragment, a riboprobe was made by in vitro transcription with using T7 RNA polymerase (Ambion MaxiscriptTM
Kit). The probe was purified by acrylamide gel electrophoresis and hybridized with 20ug of total RNA at 45 C overnight. The hybrids were digested with RNAse the following day and run on a 5%
acrylamide gel to detect the results (Ambion, RPA III kit). All the procedures for in vitro transcription and RPA reactions were following the manufacturer's instructions.
The highest level of GPR1 19 expression was found in pancreatic islets, although GPR119 was also found to be expressed in colon and to lesser extent in small intestine. See Figure 3.

Northern blot analysis was used to determine the level of GPR1 19 mRNA
expression in GLUTag (Fla subline; see Example 12, infra), HIT-T15 (a hamster pancreatic beta cell line; ATCC
No. CRL-1777), and NCI-H716 (a human endocrine cell line; ATCC No. CRL-251).
GLUTag is a mouse enteroendocrine cell line that secretes GLP-1 [Brubaker et al., Endocrinology (1998) 139:4108-41141.
RNA was extracted from tissue cultured cells by using RNA Bee (Tel-Test). Ten (10) g of total RNA was separated on a 0.8% agarose gel electrophoresis, and blotted onto nylon membrane (Amersham). The RNA blot was hybridized with a 32P-labeled mouse GPR1 19 cDNA
probe (see, e.g., mouse GPR119, GenBank Accession No. AY288423), followed by reprobing with a 32P-labeled cDNA probe for mouse preproglucagon mRNA as a control. The hybridization signals were visualized by autoradiography.
GLUTag cells (Fla subline; see Example 12, infra) were found to express GPR119 and preproglucagon. See Figure 4.

GLUTag is a mouse enteroendocrine cell line that secretes GLP-1 [Brubaker at al., Endocrinology (1998) 139:4108-4114]. The effect of GPR119 agonist on the level of intracellular cAMP in GLUTag (Fla subline) enteroendocrine cells was determined. The Fro subline of GLUTag was used as a negative control. Northern blot analysis (inset) using mouse GPRI19 cDNA as probe (see, e.g., mouse GPR119, GenBank Accession No. AY288423) indicated that the Fla subline of GLUTag expresses GPR1 19, whereas the Flo subline of GLUTag does not detectably express GPRI19.
GluTag (GLUTag-Fla and GLUTag-Fro) cells were plated at -85% confluency in 15-cm tissue culture plate with regular growth medium. On the next day, cells were scraped off with cold Scraping Buffer (20mM BEPES, 10mM EDTA, pH7.4) and spinned down at 1000 rpm for 17 mins at 4 C. Cell pellets were washed with cold Membrane Wash Buffer (20mM HEPES, 0.1mM EDTA, pH7.4) and spun again as above. The membrane pellets were resuspended in cold Binding Buffer (20mM HEPES, 1mM MgCl2, 100mMNaC1, pH7.4) and homogenized twice using a PolytronTM
homogenizer (Model No. PT3100; Brinkman) at 7000 rpm for 10 seconds. Protein concentration was determined by Bradford Assay. Cell membranes were diluted to a protein concentration of 0.2mg/ml in Binding Buffer. (The final assay concentration was 1 Oug/well).
The cyclase assay was done with a Flash PlateTM Adenylyl Cyclase kit (blew England Nuclear; Cat. No. SMP004A). The Flash Plate wells contain a scintillant coating which also contains a specific antibody recognizing CAMP. The CAMP generated in the wells can be quantitated by a direct competition for binding of radioactive CAMP tracer to the CAMP
antibody.
Details of the cyclase assay as it was carried out are described here. CAMP
standards and Detection Buffer (comprising l Ci of tracer [1251] CAMP (50 l) to llml Detection Buffer) were prepared and maintained in accordance with the manufacturer's instructions.
GPR119 agonist AR231453 was freshly prepared and serially diluted in 50ul freshly prepared 2x Reconstitution Buffer (20mM Phosphocreatine, 20 units/50ul Creatine Phosphokinase, 20uM GTP, 0.2mM
ATP, 1mM
IBMX). Eight doses of GPR119 agonist, from l OuM down to 1.27nM, were tested.
The assay was carried out in a 96-well Flash Plate. GPR119 agonist and cAMP standards were first added to appropriate wells. The cell membranes were then added to the wells, and the plate was incubated for 60 minutes at room temperature. 100ul of Detection Mix containing tracer 3H-cAMP was then added to each well. Plates were incubated for an additional two hours, after which the samples were counted in a Wallac MicroBeta scintillation counter. Values of cAMP/well were then extrapolated from a standard CAMP curve which was contained within each assay plate.
GPR119 agonist was found to elevate the level of intracellular CAMP in GLUTag-Fla cells which express GPR119, but not in GLUTag-Fro cells which do not express GPR119.

agonist was found to elevate cAIvMP in GLUTag cells with an EC50 of about 4.3 nM. See Figure 5.

GLUTag-Fla cells (see Example 12, supra) were plated in 24-well plates on day one in complete culture medium (DMEM/10%FBS). On day two the culture medium was replaced with a low glucose medium (DIvIEM/3mM Glucose/10%FBS). On day three cells were washed twice with 1XPBS. The washed GLUTag-Fla cells were stimulated with GPR119 agonist (AR231453) at various concentrations or with forskolin (lulvl) as a positive control in serum free DMEM with 15mM
glucose for one hour at 37 C and 5%C02 in a tissue culture incubator. The supernatants were then collected and clarified by centrifugation at 500g and 4 C for 5 minutes. GLP-1 released into the supernatant was determined by ELISA using reagents purchased from LINCO
Research Laboratory [Glucagon-Like Peptide-1 (Active) ELISA Kit. Cat. # EGLP-35K].
GLUTag-Fla cells were found to secrete GLP-1 when stimulated with GPR1 19 agonist. See Figure 6.
EXAMPLE 14: EFFECT OF GPR119 AGONIST AR244061 AND DPP-IV INHIBITORS IN
LOWERING
BLOOD GLUCOSE LEVEL IN ORAL GLUCOSE TOLERANCE TEST (OGTT) IN MICE
Oral glucose tolerance test (oGTT) in 7-8 week old C57BL/6J mice was carried out as described here. Overnight fasted mice (n=8 mice per treatment group) were administered via oral gavage with vehicle, a GPR119 agonist (AR244061, different to that used in Example 1), a DPP-TV
inhibitor (MK-043 1, LAF237 or FE107542), or a combination of the GPRI 19 agonist and the DPP-1V
inhibitor. GPR119 agonist AR244061 was administered at 10 mpk or 30 mpk (milligram compound per kilogram of body weight). DPP-IV inhibitors MK-0431 and LAF237 were administered at 1 mpk, and FE107542 was administered at 10 mpk. One hour after compound dosing, a glucose bolus (2 gram/kg) was delivered per orally, and tail blood samples were collected to measure blood glucose at 0, 30, 60 and 120 minutes. Results obtained for MK-0431 are shown in Figure 7;
results obtained for LAF237 are shown in Figure 8; and results obtained for FE107542 are shown in Figure 9. For each treatment group, glycemic excursion curve was graphed and is presented with blood glucose concentration given in mean values +/- standard error of the mean (SEM). Area Under Curve (AUC) of the glycemic excursion was calculated and reported as AUC (% of vehicle control).
From inspection of Figure 7, Figure 8 and Figure 9, it is apparent that whereas at the concentrations used both the GPR1 19 agonist (a GPR119 agonist different to that used in Example 1) and the DPP-IV inhibitor alone (for each of three different DPP-W inhibitors) provided measurable glycemic control, combination of the GPR119 agonist and the DPP-W inhibitor provided a dose-dependent level of glycemic control over that provided by the GPRI19 agonist or DPP-IV inhibitor alone.

While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be understood that the practice of the invention encompasses all of the usual variations, adaptions, or modifications, as come within the scope of the following claims and its equivalents.

SEQUENCE LISTING IN ELECTRONIC FORM
This description contains a sequence listing in electronic form in ASCII text format (file no. 82153-1 09D_ca seglist vl_13Feb2009.txt).
A copy of the sequence listing in electronic form is available from the Canadian Intellectual Property Office.
The sequences in the sequence listing in electronic form are reproduced in the following Table.

SEQUENCE TABLE
<110> Arena Pharmaceuticals, Inc.

<120> COMBINATION THERAPY FOR THE TREATMENT OF DIABETES AND CONDITIONS
RELATED THERETO AND FOR THE TREATMENT OF CONDITIONS AMELIORATED
BY INCREASING A BLOOD GLP-l LEVEL

<130> 82153-109D
<140> not yet assigned <141> 2006-01-009 <150> US 60/643,086 <151> 2005-01-10 <150> US 60/683,172 <151> 2005-05-19 <150> US 60/726,880 <151> 2005-10-14 <160> 5 <170> Patentln version 3.2 <210> 1 <211> 1008 <212> DNA
<213> Homo sapien <400> 1 atggaatcat ctttctcatt tggagtgatc cttgctgtcc tggcctccct catcattgct 60 actaacacac tagtggctgt ggctgtgctg ctgttgatcc acaagaatga tggtgtcagt 120 ctctgcttca ccttgaatct ggctgtggct gacaccttga ttggtgtggc catctctggc 180 ctactcacag accagctctc cagcccttct cggcccacac agaagaccct gtgcagcctg 240 cggatggcat ttgtcacttc ctccgcagct gcctctgtcc tcacggtcat gctgatcacc 300 tttgacaggt accttgccat caagcagccc ttccgctact tgaagatcat gagtgggttc 360 gtggccgggg cctgcattgc cgggctgtgg ttagtgtctt acctcattgg cttcctccca 420 ctcggaatcc ccatgttcca gcagactgcc tacaaagggc agtgcagctt ctttgctgta 480 tttcaccctc acttcgtgct gaccctctcc tgcgttggct tcttcccagc catgctcctc 540 tttgtcttct tctactgcga catgctcaag attgcctcca tgcacagcca gcagattcga 600 aagatggaac atgcaggagc catggctgga ggttatcgat ccccacggac tcccagcgac 660 ttcaaagctc tccgtactgt gtctgttctc attgggagct ttgctctatc ctggaccccc 720 ttccttatca ctggcattgt gcaggtggcc tgccaggagt gtcacctcta cctagtgctg 780 gaacggtacc tgtggctgct cggcgtgggc aactccctgc tcaacccact catctatgcc 840 tattggcaga aggaggtgcg actgcagctc taccacatgg ccctaggagt gaagaaggtg 900 ctcacctcat tcctcctctt tctctcggcc aggaattgtg gcccagagag gcccagggaa 960 agttcctgtc acatcgtcac tatctccagc tcagagtttg atggctaa 1008 <210> 2 <211> 335 <212> PRT
<213> Homo sapien <400> 2 Met Glu Ser Ser Phe Ser Phe Gly Val Ile Leu Ala Val Leu Ala Ser Leu Ile Ile Ala Thr Asn Thr Leu Val Ala Val Ala Val Leu Leu Leu Ile His Lys Asn Asp Gly Val Ser Leu Cys Phe Thr Leu Asn Leu Ala Val Ala Asp Thr Leu Ile Gly Val Ala Ile Ser Gly Leu Leu Thr Asp Gin Leu Ser Ser Pro Ser Arg Pro Thr Gln Lys Thr Leu Cys Ser Leu Arg Met Ala Phe Val Thr Ser Ser Ala Ala Ala Ser Val Leu Thr Val Met Leu Ile Thr Phe Asp Arg Tyr Leu Ala Ile Lys Gln Pro Phe Arg Tyr Leu Lys Ile Met Ser Gly Phe Val Ala Gly Ala Cys Ile Ala Gly Leu Trp Leu Val Ser Tyr Leu Ile Gly Phe Leu Pro Leu Gly Ile Pro Met Phe Gln Gln Thr Ala Tyr Lys Gly Gln Cys Ser Phe Phe Ala Val Phe His Pro His Phe Val Leu Thr Leu Ser Cys Val Gly Phe Phe Pro Ala Met Leu Leu Phe Val Phe Phe Tyr Cys Asp Met Leu Lys Ile Ala Ser Met His Ser Gln Gln Ile Arg Lys Met Glu His Ala Gly Ala Met Ala Gly Gly Tyr Arg Ser Pro Arg Thr Pro Ser Asp Phe Lys Ala Leu Arg Thr Val Ser Val Leu Ile Gly Ser Phe Ala Leu Ser Trp Thr Pro Phe Leu Ile Thr Gly Ile Val Gin Val Ala Cys Gln Glu Cys His Leu Tyr Leu Val Leu Glu Arg Tyr Leu Trp Leu Leu Gly Val Gly Asn Ser Leu Leu Asn Pro Leu Ile Tyr Ala Tyr Trp Gln Lys Glu Val Arg Leu Gln Leu Tyr His Met Ala Leu Gly Val Lys Lys Val Leu Thr Ser Phe Leu Leu Phe Leu Ser Ala Arg Asn Cys Gly Pro Glu Arg Pro Arg Glu Ser Ser Cys His Ile Val Thr Ile Ser Ser Ser Glu Phe Asp Gly <210> 3 <211> 22 <212> DNA
<213> Artificial <220>
<223> Primer <400> 3 gtcctgccac ttcgagacat gg 22 <210> 4 <211> 23 <212> DNA
<213> Artificial <220>
<223> Primer <400> 4 gaaacttctc tgcccttacc gtc 23 <210> 5 <211> 255 <212> DNA
<213> Artificial <220>
<223> Probe <400> 5 ctggcctgcc agtaatggcc agaacggtgc tgtgactctg agcctatagc acatctaatc 60 ctgtcccatg agaatctgag ctcgccatcc agcatgcctt tgtaagtgga agtgctgcta 120 cctcaccatg gagtcatcct tctcatttgg agtgatcctt gctgtcctaa ccatcctcat 180 cattgctgtt aatgcactgg tagttgtggc tatgctgcta tcaatctaca agaatgatgg 240 tgttggcctt tgctt 255

Claims (86)

1. A method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising:
(a) contacting a test compound with a host cell or with a membrane of a host cell that expresses a G protein-coupled receptor, wherein the G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of:
(i) amino acids 1-335 of SEQ ID NO:2;
(ii) amino acids 2-335 of SEQ ID NO:2;
(iii) amino acids 2-335 of SEQ ID NO:2, with the proviso that the G protein-coupled receptor does not comprise the amino acid sequence of SEQ ID NO:2;
(iv) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence being the sequence obtained by a process comprising performing polymerase chain reaction (PCR) on a human DNA sample using specific primers having the sequence set forth in SEQ ID NO:3 and SEQ ID NO:4;
(v) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO: 1; and (vi) a fragment of any one of (i) to (v) having a biological activity of G
Protein-Coupled Receptor119 (GPR119); and (b) determining ability of the test compound to stimulate functionality of the G protein-coupled receptor by: measurement of a level of a second messenger selected from the group consisting of cyclic AMP (cAMP), cyclic GMP (cGMP), inositol 1,4,5-triphosphate (IP3), diacylglycerol (DAG), MAP kinase activity, MAPK/ERK kinase kinase-1 (MEKK1) activity, and Ca2+; a Melanophore assay; or measurement of GTP.gamma.S binding to a membrane comprising said G
protein-coupled receptor;
(c) contacting the test compound which stimulates functionality of the G
protein-coupled receptor in step (b) with a mammalian enteroendocrine cell in vitro; and (d) determining whether the test compound which stimulates functionality of the G protein-coupled receptor in step (b) stimulates GLP-1 secretion from the mammalian enteroendocrine cell, wherein ability of the test compound to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the test compound being a GLP-1 secretagogue.
2. The method of claim 1, wherein the test compound is selected from the group consisting of a small molecule, a polypeptide, and an antibody or an antigen-binding fragment thereof.
3. The method of claim 1 or 2, wherein the host cell comprises an expression vector, said expression vector comprising a polynucleotide encoding the G protein-coupled receptor.
4. The method of claim 1, 2 or 3, comprising measuring the level of cAMP in step (b).
5. The method of any one of claims 1 to 4, wherein the G protein-coupled receptor is recombinant.
6. The method of any one of claims 1 to 5, wherein the host cell is an enteroendocrine cell of a GLUTag cell line.
7. The method of any one of claims 1 to 6, wherein the G protein-coupled receptor comprises amino acids 2-335 of SEQ ID NO:2.
8. The method of any one of claims 1 to 6, wherein the G protein-coupled receptor comprises the amino acid sequence of SEQ ID NO:2.
9. A method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising:
(a) contacting a test compound with a host cell or with a membrane of a host cell that expresses a G protein-coupled receptor, wherein the G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of:
(i) amino acids 1-335 of SEQ ID NO:2;
(ii) amino acids 2-335 of SEQ ID NO:2;
(iii) amino acids 2-335 of SEQ ID NO:2, with the proviso that the G protein-coupled receptor does not comprise the amino acid sequence of SEQ ID NO:2;
(iv) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence being the sequence obtained by a process comprising performing polymerase chain reaction (PCR) on a human DNA sample using specific primers having the sequence set forth in SEQ ID NO:3 and SEQ ID NO:4;
(v) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO: 1; and (vi) a fragment of any one of (i) to (v) having a biological activity of G
Protein-Coupled Receptor119 (GPR119); and (b) determining the ability of the test compound to stimulate functionality of the receptor by:
measurement of a level of a second messenger selected from the group consisting of cyclic AMP (cAMP), cyclic GMP (cGMP), inositol 1,4,5-triphosphate (IP3), diacylglycerol (DAG), MAP kinase activity, MAPK/ERK kinase kinase-1 (MEKK1) activity, and Ca2+; a Melanophore assay; or measurement of GTP.gamma.S binding to a membrane comprising said G protein-coupled receptor;
(c) administering the test compound which stimulates functionality of the G
protein-coupled receptor in step (b) to a mammal; and (d) determining whether the test compound which stimulates functionality of the G protein-coupled receptor in step (b) increases a blood GLP-1 level in the mammal, wherein the ability of the test compound to increase a blood GLP-1 level in the mammal is indicative of the test compound being a GLP-1 secretagogue.
10. The method of claim 9, wherein the mammal is a non-human mammal.
11. The method of claim 9, wherein the mammal is a human.
12. The method of claim 9, 10 or 11, wherein the host cell comprises an expression vector, said expression vector comprising a polynucleotide encoding the G protein-coupled receptor.
13. The method of any one of claims 9 to 12, wherein the second messenger is cAMP.
14. The method of any one of claims 9 to 13, wherein the G protein-coupled receptor is recombinant.
15. The method of any one of claims 9 to 14, wherein the host cell is an enteroendocrine cell of a GLUTag cell line.
16. The method of any one of claims 9 to 15, wherein the G protein-coupled receptor comprises amino acids 2-335 of SEQ ID NO:2.
17. The method of any one of claims 9 to 15, wherein the receptor comprises the amino acid sequence of SEQ ID NO:2.
18. A method of identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising:
(a) contacting a G Protein-Coupled Receptor119 (GPR119) agonist with a mammalian enteroendocrine cell in vitro; and (b) determining whether the GPR119 agonist stimulates GLP-1 secretion from the mammalian enteroendocrine cell;
wherein ability of the GPR119 agonist to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the agonist being a GLP-1 secretagogue.
19. The method of claim 18, wherein the GPR119 agonist is an agonist of human GPR119.
20. The method of claim 18 or 19, wherein the GPR119 agonist is orally active.
21. The method of claim 18, 19 or 20, wherein the GPR119 agonist is a selective GPR119 agonist.
22. The method of any one of claims 18 to 21, wherein the GPR119 agonist has an EC50 of less than 10µM.
23. The method of any one of claims 18 to 22, wherein the enteroendocrine cell is a GLUTag cell line.
24. The method of any one of claims 18 to 23, wherein the GPR119 agonist is a small molecule.
25. A method of identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising:
(a) administering a G Protein-Coupled Receptor119 (GPR119) agonist to a mammal; and (b) determining a blood GLP-1 level in a biological sample obtained from the mammal, wherein the ability of the GPR119 agonist to increase a blood GLP-1 level in the mammal is indicative of the agonist being a GLP-1 secretagogue.
26. The method of claim 25, wherein the GPR119 agonist is an agonist of human GPR119.
27. The method of claim 25 or 26, wherein the GPR119 agonist is orally active.
28. The method of claim 25, 26 or 27, wherein the GPR119 agonist is a selective GPR119 agonist.
29. The method of any one of claims 25 to 28, wherein the GPR119 agonist has an EC50 of less than 10µM.
30. The method of any one of claims 25 to 29, wherein said mammal is a non-human mammal.
31. The method of any one of claims 25 to 29, wherein said mammal is a mouse or a rat.
32. The method of any one of claims 25 to 29, wherein said mammal is a human.
33. The method of any one of claims 25 to 32, wherein the GPR119 agonist is a small molecule.
34. A method of identifying Glucagon-like Peptide-1 (GLP-1) secretagogues comprising:
determining a blood GLP-1 level in a biological sample obtained from a mammal, said mammal having been administered with a G Protein-Coupled Receptor119 (GPR119) agonist;
wherein ability of the GPR119 agonist to increase a blood GLP-1 level in the mammal is indicative of the agonist being a GLP-1 secretagogue.
35. The method of claim 34, wherein the GPR119 agonist is an agonist of human GPR119.
36. The method of claim 34 or 35, wherein the GPR119 agonist is orally active.
37. The method of claim 34, 35 or 36, wherein the GPR119 agonist is a selective GPR119 agonist.
38. The method of any one of claims 34 to 37, wherein the GPR119 agonist has an EC50 of less than 10µM.
39. The method of any one of claims 34 to 38, wherein said mammal is a non-human mammal.
40. The method of any one of claims 34 to 38, wherein said mammal is a human.
41. The method of any one of claims 34 to 40, wherein the GPR119 agonist is a small molecule.
42. The method of claim 24, 33 or 41, wherein said small molecule has a molecular weight of less than 10,000 grams per mole.
43. The method of claim 24, 33 or 41, wherein said small molecule has a molecular weight of less than 5,000 grams per mole.
44. The method of any one of claims 18 to 43, further comprising formulating the GLP-1 secretagogue into a pharmaceutical composition.
45. A method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising:
(a) contacting a G protein-coupled receptor with a ligand to the G protein-coupled receptor in the presence of a test compound, wherein said G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of:
(i) amino acids 1-335 of SEQ ID NO:2;
(ii) amino acids 2-335 of SEQ ID NO:2;
(iii) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO: 1; and (iv) a fragment of any one of (i) to (iii) having a biological activity of G
Protein-Coupled Receptor119 (GPR119); and (b) detecting a complex between the G protein-coupled receptor and the ligand;
and (c) determining whether less of said complex is formed in the presence of the test compound than in the absence of the test compound;
(d) contacting the test compound in the presence of which less of said complex is formed in step (c) with a mammalian enteroendocrine cell in vitro; and (e) determining whether the test compound in the presence of which less of said complex is formed in step (c) stimulates GLP-1 secretion from the mammalian enteroendocrine cell, wherein ability of the test compound to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the test compound being a GLP-1 secretagogue.
46. The method of claim 45, wherein the enteroendocrine cell is a GLUTag cell line.
47. The method of claim 45 or 46, wherein the G protein-coupled receptor is recombinant.
48. The method of claim 45, 46 or 47, wherein the test compound is a small molecule.
49. The method of claim 45, 46 or 47, wherein the test compound is a polypeptide.
50. The method of claim 45, 46 or 47, wherein the test compound is an antibody or an antigen-binding fragment thereof.
51. The method of any one of claims 45 to 50, wherein the ligand is labeled.
52. The method of claim 51, wherein the labeled ligand is a radiolabeled ligand.
53. The method of any one of claims 45 to 52, wherein the G protein-coupled receptor comprises amino acids 2-335 of SEQ ID NO:2.
54. The method of any one of claims 45 to 52, wherein the G protein-coupled receptor comprises the amino acid sequence of SEQ ID NO:2.
55. A method for identifying a Glucagon-like Peptide-1 (GLP-1) secretagogue, comprising:
(a) contacting a G protein-coupled receptor with a ligand to the G protein-coupled receptor in the presence of a test compound, wherein said G protein-coupled receptor comprises an amino acid sequence selected from the group consisting of:
G) amino acids 1-335 of SEQ ID NO: 2;
(ii) amino acids 2-335 of SEQ ID NO:2;
(iii) the amino acid sequence of a G protein-coupled receptor encoded by a polynucleotide comprising a nucleotide sequence, said nucleotide sequence hybridizing under stringent conditions to the complement of the sequence set forth in SEQ ID NO: 1; and (iv) a fragment of any one of (i) to (iii) having a biological activity of G
Protein-Coupled Receptor119 (GPR119); and (b) detecting a complex between the G protein-coupled receptor and the ligand;
and (c) determining whether less of said complex is formed in the presence of the test compound than in the absence of the test compound;

(d) determining blood GLP-1 level in a biological sample obtained from a mammal, said mammal having been administered with the test compound in the presence of which less of said complex is formed in step (c), wherein the ability of the test compound to increase blood GLP-1 level in the mammal is indicative of the test compound being a GLP-1 secretagogue.
56. The method of claim 55, wherein said mammal is a non-human mammal.
57. The method of claim 55, wherein said mammal is a human.
58. The method of claim 55, 56 or 57, wherein the G protein-coupled receptor is recombinant.
59. The method of any one of claims 55 to 58, wherein the test compound is a small molecule.
60. The method of any one of claims 55 to 58, wherein the test compound is a polypeptide.
61. The method of any one of claims 55 to 58, wherein the test compound is an antibody or an antigen-binding fragment thereof.
62. The method of any one of claims 55 to 61, wherein the ligand is labeled.
63. The method of claim 62, wherein the labeled ligand is a radiolabeled ligand.
64. The method of any one of claims 55 to 63, wherein the G protein-coupled receptor comprises amino acids 2-335 of SEQ ID NO:2.
65. The method of any one of claims 55 to 63, wherein the G protein-coupled receptor comprises the amino acid sequence of SEQ ID NO:2.
66. The method of any one of claims 18 to 44, wherein the GPR119 agonist has a selectivity for GPR119 over corticotrophin releasing factor-1 (CRF-1) receptor of at least about 100-fold.
67. The method of any one of claims 18 to 44 and 66, wherein the GPR119 agonist has an EC50 of less than about 1 µM.
68. The method of any one of claims 18 to 44 and 66, wherein the GPR119 agonist has an EC50 of less than about 100 nM.
69. A method of preparing a composition comprising a GPR119 agonist having the effect of a GLP-1 secretagogue, the method comprising:
(a) contacting a G Protein-Coupled Receptor119 (GPR119) agonist in vitro with a mammalian enteroendocrine cell; and (b) determining whether the GPR119 agonist stimulates GLP-1 secretion from the mammalian enteroendocrine cell wherein the ability of the GPR119 agonist to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the agonist being a GLP-1 secretagogue; and (c) formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.
70. A method of preparing a pharmaceutical composition comprising a G Protein-Coupled Receptor119 (GPR119) agonist having the effect of a GLP-1 secretagogue, the GPR119 agonist having been contacted in vitro with a mammalian enteroendocrine cell and determined to stimulate GLP-1 secretion from the mammalian enteroendocrine cell, wherein the ability of the GPR119 agonist to stimulate GLP-1 secretion from the mammalian enteroendocrine cell is indicative of the agonist being a GLP-1 secretagogue, the method comprising formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.
71. A method of preparing a composition comprising a G Protein-Coupled Receptor119 (GPR119) agonist having the effect of a GLP-1 secretagogue, the method comprising:
(a) determining a blood GLP-1 level in a biological sample obtained from a mammal, the mammal having been administered with a GPR119 agonist;
wherein the ability of the GPR119 agonist to increase a blood GLP-1 level in the mammal is indicative of the agonist being a GLP-1 secretagogue; and (b) formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.
72. A method of preparing a pharmaceutical composition comprising a G Protein-Coupled Receptor119 (GPR119) agonist having the effect of a GLP-1 secretagogue, the GPR119 agonist having been administered to a mammal and determined to increase a blood GLP-1 level in the mammal, wherein the ability of GPR119 agonist to increase a blood GLP-1 level is indicative of the agonist being a GLP-1 secretagogue, the method comprising formulating the GPR119 agonist with a pharmaceutically acceptable carrier into a pharmaceutical composition.
73. The method according to any one of claims 69 to 72, wherein the GPR119 agonist is an agonist of human GPR119.
74. The method according to any one of claims 69 to 73, wherein the GPR119 agonist is orally active.
75. The method according to any one of claims 69 to 74, wherein the GPR119 agonist is a selective GPR119 agonist.
76. The method according to claim 75, wherein the GPR119 agonist has a selectivity for GPR119 over corticotrophin releasing factor-1 (CRF-1) receptor of at least about 100-fold.
77. The method according to any one of claims 69 to 76, wherein the GPR119 agonist has an EC50 of less than about 10 µM.
78. The method according to claim 77, wherein the GPR119 agonist has an EC50 of less than about 1 µM.
79. The method according to claim 77, wherein the GPR119 agonist has an EC50 of less than about 100 nM.
80. The method according to any one of claims 69 to 79, wherein the GPR119 agonist is a small molecule.
81. The method according to any one of claims 69 to 80, wherein the enteroendocrine cell is a cell of a GLUTag cell line.
82. The method according to any one of claims 69 to 81, wherein the composition is in a dosage form.
83. The method according to claim 82, wherein the dosage form is in combination with a DPP-IV
inhibitor.
84. A GPR119 agonist for use in increasing blood GLP-1 level in a mammal to treat a myocardial infarction or a neurodegenerative disorder in a patient that is not diabetic.
85. A GPR119 agonist for use in increasing blood GLP-1 level in a mammal to treat a condition not associated with diabetes, wherein the condition is: excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-associated disease, stroke, motor-neuron disease, learning or memory impairment, traumatic brain injury, spinal cord injury, or peripheral neuropathy.
86. A GPR119 agonist for use in increasing blood GLP-1 level to promote satiety to regulate undesirable weight gain not associated with diabetes.
CA2654733A 2005-01-10 2006-01-09 Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level Expired - Fee Related CA2654733C (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US64308605P 2005-01-10 2005-01-10
US60/643,086 2005-01-10
US68317205P 2005-05-19 2005-05-19
US60/683,172 2005-05-19
US72688005P 2005-10-14 2005-10-14
US60/726,880 2005-10-14
CA2593427A CA2593427C (en) 2005-01-10 2006-01-09 Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CA2593427A Division CA2593427C (en) 2005-01-10 2006-01-09 Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level

Publications (2)

Publication Number Publication Date
CA2654733A1 CA2654733A1 (en) 2006-07-20
CA2654733C true CA2654733C (en) 2011-09-06

Family

ID=36570727

Family Applications (2)

Application Number Title Priority Date Filing Date
CA2593427A Expired - Fee Related CA2593427C (en) 2005-01-10 2006-01-09 Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level
CA2654733A Expired - Fee Related CA2654733C (en) 2005-01-10 2006-01-09 Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CA2593427A Expired - Fee Related CA2593427C (en) 2005-01-10 2006-01-09 Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level

Country Status (36)

Country Link
US (12) US20060154866A1 (en)
EP (9) EP1758565B2 (en)
JP (8) JP4118323B1 (en)
KR (5) KR20100129328A (en)
CN (2) CN103611161A (en)
AR (1) AR052082A1 (en)
AT (2) ATE431139T1 (en)
AU (3) AU2006205164B2 (en)
BR (1) BRPI0606727A (en)
CA (2) CA2593427C (en)
CL (1) CL2010000565A1 (en)
CR (1) CR9220A (en)
CY (2) CY1109260T1 (en)
DE (2) DE602006006765D1 (en)
DK (2) DK1758565T4 (en)
DO (2) DOP2006000008A (en)
EA (1) EA011883B1 (en)
ES (2) ES2327872T3 (en)
GT (1) GT200600004A (en)
HK (2) HK1100353A1 (en)
HN (1) HN2006000971A (en)
HR (2) HRP20090403T4 (en)
IL (1) IL184364A0 (en)
MX (1) MX2007008376A (en)
NI (1) NI200700174A (en)
NO (2) NO331089B1 (en)
NZ (4) NZ587368A (en)
PA (1) PA8659301A1 (en)
PE (2) PE20061116A1 (en)
PL (2) PL1808168T3 (en)
PT (2) PT1808168E (en)
RS (2) RS51174B (en)
SG (2) SG189762A1 (en)
SI (2) SI1808168T1 (en)
TW (1) TW200637534A (en)
WO (1) WO2006076231A2 (en)

Families Citing this family (92)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100408579C (en) * 2001-02-24 2008-08-06 贝林格尔英格海姆法玛两合公司 Xanthine derivative, production and use thereof as a medicament
EP1411968B1 (en) 2001-07-31 2008-09-17 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Glp-1 exendin-4 peptide analogs and uses thereof
US7407955B2 (en) 2002-08-21 2008-08-05 Boehringer Ingelheim Pharma Gmbh & Co., Kg 8-[3-amino-piperidin-1-yl]-xanthines, the preparation thereof and their use as pharmaceutical compositions
DE602004009295T2 (en) 2003-01-14 2008-07-03 Arena Pharmaceuticals, Inc., San Diego 1,2,3-TRISUBSTITUTED ARYL AND HETEROARYL DERIVATIVES AS MODULATORS OF METABOLISM FOR THE PREVENTION AND TREATMENT OF METABOLISM-CONDITIONAL DISEASES SUCH AS DIABETES OR HYPERGLYKEMIA
AR045047A1 (en) * 2003-07-11 2005-10-12 Arena Pharm Inc ARILO AND HETEROARILO DERIVATIVES TRISUSTITUIDOS AS MODULATORS OF METABOLISM AND PROFILAXIS AND TREATMENT OF DISORDERS RELATED TO THEMSELVES
CA2532971A1 (en) 2003-07-14 2005-01-27 Arena Pharmaceuticals, Inc. Fused-aryl and heteroaryl derivatives as modulators of metabolism and the prophylaxis and treatment of disorders related thereto
US7501426B2 (en) 2004-02-18 2009-03-10 Boehringer Ingelheim International Gmbh 8-[3-amino-piperidin-1-yl]-xanthines, their preparation and their use as pharmaceutical compositions
DE102004054054A1 (en) 2004-11-05 2006-05-11 Boehringer Ingelheim Pharma Gmbh & Co. Kg Process for preparing chiral 8- (3-amino-piperidin-1-yl) -xanthines
US20080312281A1 (en) * 2004-12-24 2008-12-18 Matthew Colin Thor Fyfe G-Protein Coupled Receptor (Gpr116) Agonists and Use Thereof for Treating Obesity and Diabetes
DOP2006000008A (en) * 2005-01-10 2006-08-31 Arena Pharm Inc COMBINED THERAPY FOR THE TREATMENT OF DIABETES AND RELATED AFFECTIONS AND FOR THE TREATMENT OF AFFECTIONS THAT IMPROVE THROUGH AN INCREASE IN THE BLOOD CONCENTRATION OF GLP-1
MY148521A (en) * 2005-01-10 2013-04-30 Arena Pharm Inc Substituted pyridinyl and pyrimidinyl derivatives as modulators of metabolism and the treatment of disorders related thereto
CN101166527A (en) 2005-04-27 2008-04-23 艾尼纳制药公司 Combination therapy for the treatment of obesity and diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood GLP-1 level
WO2007003962A2 (en) * 2005-06-30 2007-01-11 Prosidion Limited Gpcr agonists
DE102005035891A1 (en) 2005-07-30 2007-02-08 Boehringer Ingelheim Pharma Gmbh & Co. Kg 8- (3-amino-piperidin-1-yl) -xanthines, their preparation and their use as pharmaceuticals
US20070179123A1 (en) * 2005-11-08 2007-08-02 Chiang Peter K Methods and compositions for treating diseases associated with pathogenic proteins
DK1971862T3 (en) * 2006-04-11 2011-02-14 Arena Pharm Inc Methods of Using GPR119 Receptor to Identify Compounds Useful for Increasing Bone Mass in a Person
PE20071221A1 (en) * 2006-04-11 2007-12-14 Arena Pharm Inc GPR119 RECEPTOR AGONISTS IN METHODS TO INCREASE BONE MASS AND TO TREAT OSTEOPOROSIS AND OTHER CONDITIONS CHARACTERIZED BY LOW BONE MASS, AND COMBINED THERAPY RELATED TO THESE AGONISTS
EP1852108A1 (en) 2006-05-04 2007-11-07 Boehringer Ingelheim Pharma GmbH & Co.KG DPP IV inhibitor formulations
PE20080251A1 (en) 2006-05-04 2008-04-25 Boehringer Ingelheim Int USES OF DPP IV INHIBITORS
EA015687B1 (en) 2006-05-04 2011-10-31 Бёрингер Ингельхайм Интернациональ Гмбх Polymorphs
WO2008008895A1 (en) * 2006-07-13 2008-01-17 Smithkline Beecham Corporation Gpr119 agonists for the treatment of diabetes and related disorders
AU2007291252A1 (en) * 2006-08-30 2008-03-06 Inovacia Ab Pyridine compounds for treating GPR119 related disorders
WO2008076243A2 (en) * 2006-12-14 2008-06-26 Merck & Co., Inc. Acyl bipiperidinyl compounds, compositions containing such compounds and methods of treatment
US7638541B2 (en) 2006-12-28 2009-12-29 Metabolex Inc. 5-ethyl-2-{4-[4-(4-tetrazol-1-yl-phenoxymethyl)-thiazol-2-yl]-piperidin-1-yl}-pyrimidine
AR064736A1 (en) * 2007-01-04 2009-04-22 Prosidion Ltd GPCR AGONISTS
CL2008000018A1 (en) * 2007-01-04 2008-08-01 Prosidion Ltd COMPOUNDS DERIVED FROM NITROGEN AND OXYGEN HETEROCICLES, GPCR AGONISTS; PHARMACEUTICAL COMPOSITION THAT INCLUDES SUCH COMPOUND; AND USE OF THE COMPOUND FOR THE TREATMENT OF OBESITY, DIABETES, METABOLIC SYNDROME, HYPERLIPIDEMIA, TOLERANCE
CA2674348A1 (en) * 2007-01-04 2008-07-10 Prosidion Limited Piperidine gpcr agonists
WO2008141074A1 (en) * 2007-05-10 2008-11-20 Salk Institute For Biological Studies Identification of compounds that protect against amyloid diseases
US8183381B2 (en) 2007-07-19 2012-05-22 Metabolex Inc. N-linked heterocyclic receptor agonists for the treatment of diabetes and metabolic disorders
CL2008002427A1 (en) 2007-08-16 2009-09-11 Boehringer Ingelheim Int Pharmaceutical composition comprising 1-chloro-4- (bd-glucopyranos-1-yl) -2- [4 - ((s) -tetrahydrofuran-3-yloxy) benzyl] -benzene combined with 1 - [(4-methylquinazolin- 2-yl) methyl] -3-methyl-7- (2-butyn-1-yl) -8- (3- (r) -aminopiperidin-1-yl) xanthine; and its use to treat type 2 diabetes mellitus.
AU2008302570B2 (en) 2007-09-20 2012-05-31 Irm Llc Compounds and compositions as modulators of GPR119 activity
WO2009117421A2 (en) * 2008-03-17 2009-09-24 Kalypsys, Inc. Heterocyclic modulators of gpr119 for treatment of disease
DK2280704T3 (en) * 2008-03-31 2015-06-29 Cymabay Therapeutics Inc Oxymethylenarylforbindelser and uses thereof
AR071175A1 (en) 2008-04-03 2010-06-02 Boehringer Ingelheim Int PHARMACEUTICAL COMPOSITION THAT INCLUDES AN INHIBITOR OF DIPEPTIDIL-PEPTIDASA-4 (DPP4) AND A COMPARING PHARMACO
EP2146210A1 (en) * 2008-04-07 2010-01-20 Arena Pharmaceuticals, Inc. Methods of using A G protein-coupled receptor to identify peptide YY (PYY) secretagogues and compounds useful in the treatment of conditions modulated by PYY
WO2009143049A1 (en) * 2008-05-19 2009-11-26 Schering Corporation Bicyclic heterocycle derivatives and use thereof as gpr119 modulators
CN102089301A (en) * 2008-07-10 2011-06-08 普洛希典有限公司 Piperidine gpcr agonists
UY32030A (en) 2008-08-06 2010-03-26 Boehringer Ingelheim Int "TREATMENT FOR DIABETES IN INAPPROPRIATE PATIENTS FOR THERAPY WITH METFORMIN"
KR20190016601A (en) 2008-08-06 2019-02-18 베링거 인겔하임 인터내셔날 게엠베하 Treatment for diabetes in patients inappropriate for metformin therapy
CA2736421A1 (en) * 2008-09-10 2010-03-18 Boehringer Ingelheim International Gmbh Combination therapy for the treatment of diabetes and related conditions
US20200155558A1 (en) 2018-11-20 2020-05-21 Boehringer Ingelheim International Gmbh Treatment for diabetes in patients with insufficient glycemic control despite therapy with an oral antidiabetic drug
KR101054911B1 (en) 2008-10-17 2011-08-05 동아제약주식회사 Pharmaceutical composition for the prevention and treatment of diabetes or obesity containing a compound that inhibits the activity of dipeptidyl peptidase-IV and other anti-diabetic or anti-obesity drugs as an active ingredient
CN101723947B (en) * 2008-10-21 2012-05-30 山东轩竹医药科技有限公司 Dipeptidase-IV inhibitor compound
CN107011345A (en) 2008-12-23 2017-08-04 勃林格殷格翰国际有限公司 The salt form of organic compound
WO2010074271A1 (en) * 2008-12-26 2010-07-01 武田薬品工業株式会社 Therapeutic agent for diabetes
AR074990A1 (en) 2009-01-07 2011-03-02 Boehringer Ingelheim Int TREATMENT OF DIABETES IN PATIENTS WITH AN INAPPROPRIATE GLUCEMIC CONTROL THROUGH METFORMIN THERAPY
UY32441A (en) 2009-02-13 2010-09-30 Boehringer Ingelheim Int PHARMACEUTICAL COMPOSITION, TREATMENT METHODS AND ITS USES
WO2010114957A1 (en) 2009-04-03 2010-10-07 Schering Corporation Bicyclic piperidine and piperazine derivatives as gpcr modulators for the treatment of obesity, diabetes and other metabolic disorders
SG175995A1 (en) * 2009-06-05 2011-12-29 Pfizer L- ( piperidin-4-yl) -pyrazole derivatives as gpr 119 modulators
EP2445901A1 (en) 2009-06-24 2012-05-02 Boehringer Ingelheim International GmbH New compounds, pharmaceutical composition and methods relating thereto
US8293729B2 (en) 2009-06-24 2012-10-23 Boehringer Ingelheim International Gmbh Compounds, pharmaceutical composition and methods relating thereto
AR077642A1 (en) 2009-07-09 2011-09-14 Arena Pharm Inc METABOLISM MODULATORS AND THE TREATMENT OF DISORDERS RELATED TO THE SAME
HUE035862T2 (en) * 2009-09-28 2018-05-28 Intarcia Therapeutics Inc Rapid establishment and/or termination of substantial steady-state drug delivery
CN102666553B (en) 2009-10-01 2015-05-06 赛马拜制药公司 Substituted tetrazol-1-yl-phenoxymethyl-thiazol-2-yl-piperidinyl-pyrimidine salts
CA2779088A1 (en) 2009-11-16 2011-05-19 Mellitech [1,5]-diazocin derivatives
EA034869B1 (en) 2009-11-27 2020-03-31 Бёрингер Ингельхайм Интернациональ Гмбх Treatment of genotyped diabetic patients with dpp-4 inhibitors such as linagliptin
CN108558740B (en) 2010-01-27 2021-10-19 艾尼纳制药公司 S1P1 receptor modulators and salts thereof
US20120035103A1 (en) * 2010-01-29 2012-02-09 Pillion Dennis J Method for administration of insulin and pharmaceutical composition thereof
WO2011113947A1 (en) 2010-03-18 2011-09-22 Boehringer Ingelheim International Gmbh Combination of a gpr119 agonist and the dpp-iv inhibitor linagliptin for use in the treatment of diabetes and related conditions
JP2013523819A (en) 2010-04-06 2013-06-17 アリーナ ファーマシューティカルズ, インコーポレイテッド GPR119 receptor modulators and treatment of disorders related thereto
EP2566469B1 (en) 2010-05-05 2022-12-21 Boehringer Ingelheim International GmbH Combination therapy
CN103037843A (en) 2010-06-23 2013-04-10 麦它波莱克斯股份有限公司 Compositions of 5-ethyl-2-{4-[4-(4-tetrazol-1-Yl-phenoxymethyl)-thiazol-2-Yl]-piperidin-1-Yl}-pyrimidine
CN102971005A (en) 2010-06-24 2013-03-13 贝林格尔.英格海姆国际有限公司 Diabetes therapy
CA2812061A1 (en) 2010-09-22 2012-03-29 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
US9034883B2 (en) 2010-11-15 2015-05-19 Boehringer Ingelheim International Gmbh Vasoprotective and cardioprotective antidiabetic therapy
WO2014011926A1 (en) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comprising statins, biguanides and further agents for reducing cardiometabolic risk
AR085689A1 (en) 2011-03-07 2013-10-23 Boehringer Ingelheim Int PHARMACEUTICAL COMPOSITIONS OF METFORMIN, LINAGLIPTINE AND AN SGLT-2 INHIBITOR
WO2012135570A1 (en) 2011-04-01 2012-10-04 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
WO2012145361A1 (en) 2011-04-19 2012-10-26 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
WO2012145604A1 (en) 2011-04-22 2012-10-26 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
WO2012145603A1 (en) 2011-04-22 2012-10-26 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
WO2012170702A1 (en) 2011-06-08 2012-12-13 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
EP2731947B1 (en) 2011-07-15 2019-01-16 Boehringer Ingelheim International GmbH Substituted dimeric quinazoline derivative, its preparation and its use in pharmaceutical compositions for the treatment of type i and ii diabetes
WO2013055910A1 (en) 2011-10-12 2013-04-18 Arena Pharmaceuticals, Inc. Modulators of the gpr119 receptor and the treatment of disorders related thereto
US9555001B2 (en) 2012-03-07 2017-01-31 Boehringer Ingelheim International Gmbh Pharmaceutical composition and uses thereof
JP6224084B2 (en) 2012-05-14 2017-11-01 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング Xanthine derivatives as DPP-4 inhibitors for the treatment of glomerular epithelial cell related disorders and / or nephrotic syndrome
WO2013174767A1 (en) 2012-05-24 2013-11-28 Boehringer Ingelheim International Gmbh A xanthine derivative as dpp -4 inhibitor for use in modifying food intake and regulating food preference
WO2014074668A1 (en) 2012-11-08 2014-05-15 Arena Pharmaceuticals, Inc. Modulators of gpr119 and the treatment of disorders related thereto
CN103344773B (en) * 2013-06-19 2015-04-15 天津美德太平洋科技有限公司 Reagent, method and kit for detection of biological activity of glucagon-like peptide-1 (GLP-1)
WO2015016682A1 (en) 2013-08-01 2015-02-05 경희대학교 산학협력단 Pharmaceutical composition for preventing or treating diabetes mellitus, method for preventing or treating diabetes mellitus, and method for screening for diabetes mellitus therapeutic agent
CN105637363B (en) 2013-08-01 2017-06-27 庆熙大学校产学协力团 The method of prevention or the pharmaceutical composition for the treatment of diabetes, prevention or treatment diabetes, and the method for screening Remedies for diabetes
JP6615109B2 (en) 2014-02-28 2019-12-04 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング Medical use of DPP-4 inhibitors
AU2016205361C1 (en) 2015-01-06 2021-04-08 Arena Pharmaceuticals, Inc. Methods of treating conditions related to the S1P1 receptor
JP2018507914A (en) 2015-03-09 2018-03-22 インテクリン・セラピューティクス・インコーポレイテッド Method for the treatment of non-alcoholic fatty liver disease and / or lipodystrophy
BR112017027656B1 (en) 2015-06-22 2023-12-05 Arena Pharmaceuticals, Inc. CRYSTALLINE HABIT OF SALT-FREE PLATE OF ACID L-ARGININE (R)-2-(7-(4- CYCLOPENTYL-3-(TRIFLUOROMETHYL)BENZYLOXY)- 1,2,3,4-TETRA-HYDROCYCLO-PENTA[B ]INDOL-3- IL)ACETIC, PHARMACEUTICAL COMPOSITION THAT COMPRISES IT, ITS USES AND METHOD OF PREPARATION THEREOF
WO2017211979A1 (en) 2016-06-10 2017-12-14 Boehringer Ingelheim International Gmbh Combinations of linagliptin and metformin
JP2019527693A (en) 2016-08-03 2019-10-03 サイマベイ・セラピューティクス・インコーポレイテッドCymaBay Therapeutics,Inc. Oxymethylene aryl compounds for treating inflammatory gastrointestinal diseases or gastrointestinal conditions
JP2020507611A (en) 2017-02-16 2020-03-12 アリーナ ファーマシューティカルズ, インコーポレイテッド Compounds and methods for the treatment of primary biliary cholangitis
WO2018187350A1 (en) 2017-04-03 2018-10-11 Coherus Biosciences Inc. PPARγ AGONIST FOR TREATMENT OF PROGRESSIVE SUPRANUCLEAR PALSY
JP2020524181A (en) 2017-06-19 2020-08-13 アリーナ ファーマシューティカルズ, インコーポレイテッド Compounds and methods for the treatment of NAFLD and NASH
BR112021026809A2 (en) 2019-07-08 2022-02-22 Mankind Pharma Ltd Combination therapy of gpr119 agonists and dpp-4 inhibitors
EP4098262A4 (en) * 2020-03-11 2024-02-28 Dong A St Co Ltd Pharmaceutical composition for prevention or treatment of diabetes and metabolic diseases associated therewith

Family Cites Families (286)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US751426A (en) * 1904-02-02 Safety hair-pin
US747699A (en) * 1903-09-05 1903-12-22 Achilles C Gough Universal sanding-machine.
US4166452A (en) 1976-05-03 1979-09-04 Generales Constantine D J Jr Apparatus for testing human responses to stimuli
US4256108A (en) 1977-04-07 1981-03-17 Alza Corporation Microporous-semipermeable laminated osmotic system
US4704362A (en) * 1977-11-08 1987-11-03 Genentech, Inc. Recombinant cloning vehicle microbial polypeptide expression
US4265874A (en) 1980-04-25 1981-05-05 Alza Corporation Method of delivering drug with aid of effervescent activity generated in environment of use
DD296075A5 (en) 1989-08-07 1991-11-21 Martin-Luther-Universitaet Halle-Wittenberg,De PROCESS FOR THE PREPARATION OF NEW INHIBITORS OF DIPEPTIDYL PEPTIDASE IV
JPH05508624A (en) 1990-04-14 1993-12-02 ニュー イングランド メデカル センター ホスピタルズ インク Dipeptidyl-aminopeptidase type 4 inhibitor
US5462856A (en) 1990-07-19 1995-10-31 Bunsen Rush Laboratories, Inc. Methods for identifying chemicals that act as agonists or antagonists for receptors and other proteins involved in signal transduction via pathways that utilize G-proteins
EP1050540B1 (en) 1991-10-22 2006-12-27 New England Medical Center Hospitals, Inc. Inhibitors of dipeptidyl-aminopeptidase type IV
MX9206628A (en) 1991-11-22 1993-05-01 Boehringer Ingelheim Pharma PROLINABORONATE ESTER AND METHOD FOR ITS PREPARATION.
US6100042A (en) * 1993-03-31 2000-08-08 Cadus Pharmaceutical Corporation Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
IL111785A0 (en) 1993-12-03 1995-01-24 Ferring Bv Dp-iv inhibitors and pharmaceutical compositions containing them
US5543396A (en) 1994-04-28 1996-08-06 Georgia Tech Research Corp. Proline phosphonate derivatives
US20020006899A1 (en) * 1998-10-06 2002-01-17 Pospisilik Andrew J. Use of dipeptidyl peptidase IV effectors for lowering blood pressure in mammals
DE19616486C5 (en) 1996-04-25 2016-06-30 Royalty Pharma Collection Trust Method for lowering the blood glucose level in mammals
AU4721897A (en) 1996-10-25 1998-05-22 Tanabe Seiyaku Co., Ltd. Tetrahydroisoquinoline derivatives
TW492957B (en) 1996-11-07 2002-07-01 Novartis Ag N-substituted 2-cyanopyrrolidnes
US6100234A (en) 1997-05-07 2000-08-08 Tufts University Treatment of HIV
US6040145A (en) 1997-05-07 2000-03-21 Tufts University Potentiation of the immune response
US6183974B1 (en) * 1997-07-31 2001-02-06 The General Hospital Corporation Screening assays for G protein coupled receptor agonists and antagonists
CN1163594C (en) 1997-09-29 2004-08-25 尖端医疗有限公司 stimulation of hematopoietic cells in vitro
EP1043328B1 (en) 1997-11-18 2008-03-19 Zaidan Hojin Biseibutsu Kagaku Kenkyu Kai Novel physiologically active substance sulphostin, process for producing the same, and use thereof
JP2002501889A (en) * 1998-02-02 2002-01-22 トラスティーズ オブ タフツ カレッジ Methods for regulating glucose metabolism and reagents related thereto
US5922576A (en) * 1998-02-27 1999-07-13 The John Hopkins University Simplified system for generating recombinant adenoviruses
TWI252107B (en) 1998-05-04 2006-04-01 Piint Therapeutics Inc Pharmaceutical compositions and kits for hematopoietic usage
DE19823831A1 (en) * 1998-05-28 1999-12-02 Probiodrug Ges Fuer Arzneim New pharmaceutical use of isoleucyl thiazolidide and its salts
ATE231512T1 (en) 1998-06-05 2003-02-15 Point Therapeutics Inc CYCLIC BOROPROLINE COMPOUNDS
DE19828114A1 (en) * 1998-06-24 2000-01-27 Probiodrug Ges Fuer Arzneim Produgs of unstable inhibitors of dipeptidyl peptidase IV
DE19828113A1 (en) 1998-06-24 2000-01-05 Probiodrug Ges Fuer Arzneim Prodrugs of Dipeptidyl Peptidase IV Inhibitors
DE19834591A1 (en) 1998-07-31 2000-02-03 Probiodrug Ges Fuer Arzneim Use of substances that decrease the activity of dipeptidyl peptidase IV to increase blood sugar levels, e.g. for treating hypoglycemia
WO2000010549A1 (en) 1998-08-21 2000-03-02 Point Therapeutics, Inc. Regulation of substrate activity
AU6294899A (en) * 1998-10-07 2000-04-26 Medical College Of Georgia Research Institute, Inc. Glucose-dependent insulinotropic peptide for use as an osteotropic hormone
US6242422B1 (en) 1998-10-22 2001-06-05 Idun Pharmacueticals, Inc. (Substituted)Acyl dipeptidyl inhibitors of the ice/ced-3 family of cysteine proteases
NZ511087A (en) 1998-11-20 2004-01-30 Arena Pharm Inc Human orphan G protein-coupled receptors
CO5150173A1 (en) 1998-12-10 2002-04-29 Novartis Ag COMPOUNDS N- (REPLACED GLYCLE) -2-DIPEPTIDYL-IV PEPTIDASE INHIBITING CYANOPIRROLIDINS (DPP-IV) WHICH ARE EFFECTIVE IN THE TREATMENT OF CONDITIONS MEDIATED BY DPP-IV INHIBITION
JP2000191616A (en) 1998-12-24 2000-07-11 Senju Pharmaceut Co Ltd New peptidylaldehyde derivative and medicine containing the same
US20030125539A1 (en) * 1999-02-22 2003-07-03 Synaptic Pharmaceutical Corporation DNA encoding SNORF25 receptor
US6221660B1 (en) * 1999-02-22 2001-04-24 Synaptic Pharmaceutical Corporation DNA encoding SNORF25 receptor
WO2000053171A1 (en) * 1999-03-05 2000-09-14 Molteni L. E C. Dei Fratelli Alitti Societa' Di Esercizio S.P.A. Use of metformin in the preparation of pharmaceutical compositions capable of inhibiting the enzyme dipeptidyl peptidase iv
GB9906715D0 (en) 1999-03-23 1999-05-19 Ferring Bv Compositions for promoting growth
GB9906714D0 (en) 1999-03-23 1999-05-19 Ferring Bv Compositions for improving fertility
JP4121215B2 (en) 1999-05-17 2008-07-23 財団法人微生物化学研究会 Sulfostin analog, and method for producing sulfostine and its analog
EP1187619A1 (en) 1999-05-25 2002-03-20 Point Therapeutics, Inc. Anti-tumor agents comprising boroproline compounds
US6617340B1 (en) 1999-07-29 2003-09-09 Novartis Ag N-(substituted glycyl)-pyrrolidines, pharmaceutical compositions containing them and their use in inhibiting dipeptidyl peptidase-IV
DE19940130A1 (en) * 1999-08-24 2001-03-01 Probiodrug Ges Fuer Arzneim New effectors of Dipeptidyl Peptidase IV for topical use
US6653064B1 (en) 1999-09-23 2003-11-25 Boehringer Ingelheim International Gmbh Method for identifying compounds useful in the therapy of bone disorders
GB9923177D0 (en) 1999-09-30 1999-12-01 Pfizer Ltd Novel polypeptide
JP2003535034A (en) 1999-11-12 2003-11-25 ギルフォード ファーマシューティカルズ インコーポレイテッド Dipeptidyl peptidase IV inhibitors and methods for producing and using dipeptidyl peptidase IV inhibitors
US6380398B2 (en) 2000-01-04 2002-04-30 Novo Nordisk A/S Therapeutically active and selective heterocyclic compounds that are inhibitors of the enzyme DPP-IV
AU2001237321A1 (en) * 2000-01-21 2001-07-31 Novartis Ag Combinations comprising dipeptidylpeptidase - iv inhibitor
AU2001228309A1 (en) 2000-01-24 2001-08-07 Novo-Nordisk A/S N-substituted 2-cyanopyroles and -pyrrolines which are inhibitors of the enzyme dpp-iv
US6395767B2 (en) 2000-03-10 2002-05-28 Bristol-Myers Squibb Company Cyclopropyl-fused pyrrolidine-based inhibitors of dipeptidyl peptidase IV and method
US6608038B2 (en) * 2000-03-15 2003-08-19 Novartis Ag Methods and compositions for treatment of diabetes and related conditions via gene therapy
GB0010188D0 (en) 2000-04-26 2000-06-14 Ferring Bv Inhibitors of dipeptidyl peptidase IV
GB0010183D0 (en) 2000-04-26 2000-06-14 Ferring Bv Inhibitors of dipeptidyl peptidase IV
WO2001087929A2 (en) * 2000-05-18 2001-11-22 Bayer Aktiengesellschaft Regulation of human dopamine-like g protein-coupled receptor
ES2284655T3 (en) * 2000-06-13 2007-11-16 Glaxo Group Limited SELECTION OF HIGH PERFORMANCE OF COMPOUNDS FOR BIOLOGICAL ACTIVITY.
TW583185B (en) 2000-06-13 2004-04-11 Novartis Ag N-(substituted glycyl)-2-cyanopyrrolidines and pharmaceutical composition for inhibiting dipeptidyl peptidase-IV (DPP-IV) or for the prevention or treatment of diseases or conditions associated with elevated levels of DPP-IV comprising the same
US6432969B1 (en) 2000-06-13 2002-08-13 Novartis Ag N-(substituted glycyl)-2 cyanopyrrolidines, pharmaceutical compositions containing them and their use in inhibiting dipeptidyl peptidase-IV
GB0014969D0 (en) 2000-06-19 2000-08-09 Smithkline Beecham Plc Novel method of treatment
JP2004502690A (en) * 2000-07-04 2004-01-29 ノボ ノルディスク アクティーゼルスカブ Heterocyclic compounds that are inhibitors of the enzyme DPP-IV
ATE362468T1 (en) * 2000-07-25 2007-06-15 Merck & Co Inc N-SUBSTITUTED INDOLES WITH APPLICATION IN THE TREATMENT OF DIABETES
HU227882B1 (en) 2000-08-10 2012-05-29 Mitsubishi Tanabe Pharma Corp Proline derivatives and use thereof as drugs
CA2424600C (en) 2000-10-06 2008-12-02 Tanabe Seiyaku Co., Ltd. Aliphatic nitrogenous five-membered ring compounds
JP4329290B2 (en) 2000-10-06 2009-09-09 田辺三菱製薬株式会社 Aliphatic nitrogen-containing five-membered ring compounds
JP2004035574A (en) 2000-10-06 2004-02-05 Tanabe Seiyaku Co Ltd Aliphatic nitrogenous five-membered ring compound
JP4329291B2 (en) 2000-10-06 2009-09-09 田辺三菱製薬株式会社 Nitrogen-containing five-membered ring compounds
AUPR107800A0 (en) 2000-10-27 2000-11-23 University Of Sydney, The Peptide and nucleic acid molecule ii
TWI243162B (en) 2000-11-10 2005-11-11 Taisho Pharmaceutical Co Ltd Cyanopyrrolidine derivatives
CN1549858A (en) 2000-11-27 2004-11-24 阿伦纳药品公司 Endogenous and non-endogenous versions of human G protein-coupled receptors
JP3438186B2 (en) * 2000-12-01 2003-08-18 山之内製薬株式会社 Diabetes treatment screening method
EP1354882A1 (en) 2000-12-27 2003-10-22 Kyowa Hakko Kogyo Co., Ltd. Dipeptidyl peptidase iv inhibitor
CA2430967C (en) 2001-01-16 2009-06-23 Nippon Kayaku Kabushiki Kaisha Remedies for bone marrow suppression and infectious diseases and white blood cell count elevating agents
US6397767B1 (en) * 2001-02-01 2002-06-04 Case Corporation Knife applicator for applying liquid fertilizer in the ground
JP4213390B2 (en) 2001-02-02 2009-01-21 武田薬品工業株式会社 Fused heterocyclic compounds
CN1500080A (en) 2001-02-02 2004-05-26 ����ҩƷ��ҵ��ʽ���� Fused heterocyclic compounds
CN100408579C (en) 2001-02-24 2008-08-06 贝林格尔英格海姆法玛两合公司 Xanthine derivative, production and use thereof as a medicament
JP2002265439A (en) 2001-03-08 2002-09-18 Mitsubishi Pharma Corp Cyanopyrrolidine derivative and its use for medicine
CA2441092A1 (en) 2001-03-27 2002-10-03 Merck & Co., Inc. Dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
WO2002080860A2 (en) * 2001-03-27 2002-10-17 The Regents Of The University Of California Methods, compounds, and compositions for reducing body fat and modulating fatty acid metabolism
FR2822826B1 (en) 2001-03-28 2003-05-09 Servier Lab NOVEL ALPHA-AMINO ACID SULPHONYL DERIVATIVES, PROCESS FOR PREPARING THEM AND PHARMACEUTICAL COMPOSITIONS CONTAINING SAME
GB0109146D0 (en) 2001-04-11 2001-05-30 Ferring Bv Treatment of type 2 diabetes
US6573287B2 (en) 2001-04-12 2003-06-03 Bristo-Myers Squibb Company 2,1-oxazoline and 1,2-pyrazoline-based inhibitors of dipeptidyl peptidase IV and method
FR2824825B1 (en) 2001-05-15 2005-05-06 Servier Lab NOVEL ALPHA-AMINOACID DERIVATIVES, PROCESS FOR THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM
DE60224189T2 (en) 2001-06-20 2008-12-11 Merck & Co., Inc. DIPEPTIDYLPEPTIDASE INHIBITORS FOR THE TREATMENT OF DIABETES
CA2450475A1 (en) 2001-06-20 2003-01-03 Linda Brockunier Dipeptidyl peptidase inhibitors for the treatment of diabetes
GB0115517D0 (en) 2001-06-25 2001-08-15 Ferring Bv Novel antidiabetic agents
US20030130199A1 (en) * 2001-06-27 2003-07-10 Von Hoersten Stephan Dipeptidyl peptidase IV inhibitors and their uses as anti-cancer agents
DE10154689A1 (en) 2001-11-09 2003-05-22 Probiodrug Ag Substituted amino ketone compounds
JP4357293B2 (en) 2001-06-27 2009-11-04 スミスクライン ビーチャム コーポレーション Fluoropyrrolidines as dipeptidyl peptidase inhibitors
US7368421B2 (en) * 2001-06-27 2008-05-06 Probiodrug Ag Use of dipeptidyl peptidase IV inhibitors in the treatment of multiple sclerosis
AU2002316437A1 (en) 2001-06-27 2003-03-03 Smithkline Beecham Corporation Pyrrolidines as dipeptidyl peptidase inhibitors
ZA200300833B (en) 2001-06-27 2004-02-10 Probiodrug Ag Dipeptidyl peptidase IV inhibitors and their uses as anti-cancer agents.
JP2004534836A (en) 2001-06-27 2004-11-18 プロバイオドラッグ アーゲー Novel use of dipeptidyl peptidase IV inhibitors
PL367527A1 (en) 2001-06-27 2005-02-21 Smithkline Beecham Corporation Fluoropyrrolidines as dipeptidyl peptidase inhibitors
JP2005502624A (en) 2001-07-03 2005-01-27 ノボ ノルディスク アクティーゼルスカブ Purine derivatives inhibiting DPP-IV for the treatment of diabetes
US6869947B2 (en) * 2001-07-03 2005-03-22 Novo Nordisk A/S Heterocyclic compounds that are inhibitors of the enzyme DPP-IV
UA74912C2 (en) 2001-07-06 2006-02-15 Merck & Co Inc Beta-aminotetrahydroimidazo-(1,2-a)-pyrazines and tetratriazolo-(4,3-a)-pyrazines as inhibitors of dipeptylpeptidase for the treatment or prevention of diabetes
DE10143840A1 (en) 2001-09-06 2003-03-27 Probiodrug Ag New acylated hydroxamates useful for the treatment of e.g. wound healing
US6844316B2 (en) * 2001-09-06 2005-01-18 Probiodrug Ag Inhibitors of dipeptidyl peptidase I
JPWO2003026661A1 (en) 2001-09-14 2005-01-06 山之内製薬株式会社 Insulin secretion promoter and novel pyrimidine derivatives
EP1426366A4 (en) 2001-09-14 2004-12-08 Mitsubishi Pharma Corp Thiazolidine derivative and medicinal use thereof
AU2002331311A1 (en) 2001-09-19 2003-04-01 Novo Nordisk A/S Heterocyclic compounds that are inhibitors of the enzyme dpp-iv
CA2463908A1 (en) 2001-10-18 2003-04-24 Bristol-Myers Squibb Company Human glucagon-like-peptide-1 mimics and their use in the treatment of diabetes and related conditions
US7238671B2 (en) * 2001-10-18 2007-07-03 Bristol-Myers Squibb Company Human glucagon-like-peptide-1 mimics and their use in the treatment of diabetes and related conditions
GB0125445D0 (en) 2001-10-23 2001-12-12 Ferring Bv Protease Inhibitors
GB0125446D0 (en) 2001-10-23 2001-12-12 Ferring Bv Novel anti-diabetic agents
US6861440B2 (en) 2001-10-26 2005-03-01 Hoffmann-La Roche Inc. DPP IV inhibitors
CN1604968A (en) 2001-10-31 2005-04-06 诺瓦提斯公司 Methods to treat diabetes and related conditions based on polymorphisms in the TCF-1 gene
US20030125304A1 (en) * 2001-11-09 2003-07-03 Hans-Ulrich Demuth Substituted amino ketone compounds
EP1487471A4 (en) 2001-11-26 2010-03-10 Tufts College Methods for treating autoimmune disorders and reagents related thereto
US7727964B2 (en) 2001-11-26 2010-06-01 Trustees Of Tufts College Peptidomimetic inhibitors of post-proline cleaving enzymes
WO2003057144A2 (en) 2001-12-26 2003-07-17 Guilford Pharmaceuticals Change inhibitors of dipeptidyl peptidase iv
US6727261B2 (en) * 2001-12-27 2004-04-27 Hoffman-La Roche Inc. Pyrido[2,1-A]Isoquinoline derivatives
CA2475653A1 (en) 2002-02-08 2003-09-04 Idun Pharmaceuticals, Inc. (substituted)acyl dipeptidyl inhibitors of the ice/ced-3 family of cysteine proteases
RU2293731C2 (en) 2002-02-13 2007-02-20 Ф.Хоффманн-Ля Рош Аг Derivatives of pyridine and pyrimidine, methods for their preparing (variants), pharmaceutical composition and using
MXPA04007743A (en) 2002-02-13 2004-10-15 Hoffmann La Roche Novel pyridine- and quinoline-derivatives.
US6906074B2 (en) 2002-02-22 2005-06-14 Nippon Zoki Pharmaceutical Co., Ltd. 2-phenylpiperazine derivatives
EP1338595B1 (en) * 2002-02-25 2006-05-03 Eisai Co., Ltd. Xanthine derivatives as DPP-IV inhibitors
JP2004043429A (en) 2002-02-25 2004-02-12 Eisai Co Ltd New xanthine derivative and dppiv inhibitor
BR0215622A (en) 2002-02-28 2004-12-07 Prosidion Ltd Glutaminyl-based dpiv inhibitors
HUP0200849A2 (en) * 2002-03-06 2004-08-30 Sanofi-Synthelabo N-aminoacetyl-pyrrolidine-2-carbonitrile derivatives, pharmaceutical compositions containing them and process for producing them
US7307164B2 (en) 2002-03-25 2007-12-11 Merck & Co., Inc. β-amino heterocyclic dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
US7348318B2 (en) 2002-03-25 2008-03-25 Nippon Kayaku Kabushiki Kaisha α-Amino-N-(diaminophosphinyl)lactam derivatives
JP4329382B2 (en) 2002-04-04 2009-09-09 田辺三菱製薬株式会社 Pharmaceutical composition
JP4329381B2 (en) 2002-04-04 2009-09-09 田辺三菱製薬株式会社 Pharmaceutical composition
WO2003084940A1 (en) 2002-04-08 2003-10-16 Alangudi Sankaranarayanan Thiazolidine-4-carbonitriles and analogues and their use as dipeptidyl-peptidas inhibitors
JP2003300977A (en) 2002-04-10 2003-10-21 Sumitomo Pharmaceut Co Ltd Xanthine derivative
WO2003095425A1 (en) 2002-05-09 2003-11-20 Taisho Pharmaceutical Co.,Ltd. Cyanopyrrolidine derivatives
JP2004026820A (en) 2002-05-09 2004-01-29 Taisho Pharmaceut Co Ltd Dipeptidyl peptidase iv inhibitor
JP2003327532A (en) 2002-05-10 2003-11-19 Takeda Chem Ind Ltd Peptidase inhibitor
GB0212412D0 (en) 2002-05-29 2002-07-10 Novartis Ag Combination of organic compounds
RU2362555C2 (en) 2002-06-03 2009-07-27 Новартис Аг Application of substituted cyanopyrolidines and combined preparations containing them for treatment of lipidemia and associated diseases
AU2003233010A1 (en) 2002-06-04 2003-12-19 Pfizer Products Inc. Process for the preparation of 3,3,4,4-tetrafluoropyrrolidine and derivatives thereof
US6710040B1 (en) 2002-06-04 2004-03-23 Pfizer Inc. Fluorinated cyclic amides as dipeptidyl peptidase IV inhibitors
EP1513808A2 (en) 2002-06-04 2005-03-16 Pfizer Products Inc. Fluorinated cyclic amides as dipeptidyl peptidase iv inhibitors
KR100985160B1 (en) * 2002-06-06 2010-10-05 에자이 알앤드디 매니지먼트 가부시키가이샤 Novel condensed imidazole derivatives
HUP0202001A2 (en) 2002-06-14 2005-08-29 Sanofi-Aventis Azabicyclo-octane and nonane derivatives with ddp-iv inhibiting activity
JP2004026678A (en) 2002-06-24 2004-01-29 Microbial Chem Res Found Therapeutic agent for type 2 diabetes
IL166156A0 (en) 2002-07-09 2006-01-15 Point Therapeutics Inc Boroproline compound combination therapy
AU2003248259A1 (en) 2002-07-10 2004-02-02 Yamanouchi Pharmaceutical Co., Ltd. Novel azetidine derivative or salt thereof
AU2003251869A1 (en) 2002-07-15 2004-02-02 Merck & Co., Inc. Piperidino pyrimidine dipeptidyl peptidase inhibitors for the treatment of diabetes
TW200401635A (en) 2002-07-23 2004-02-01 Yamanouchi Pharma Co Ltd 2-Cyano-4-fluoropyrrolidine derivative or salt thereof
AU2003254852A1 (en) 2002-08-08 2004-02-25 Takeda Pharmaceutical Company Limited Fused heterocyclic compounds as peptidase inhibitors
JP4542757B2 (en) 2002-08-08 2010-09-15 武田薬品工業株式会社 Fused heterocyclic compounds
DE10236667B4 (en) * 2002-08-09 2007-06-06 J. Eberspächer GmbH & Co. KG Exhaust system for the internal combustion engine of a motor vehicle
WO2004034968A2 (en) * 2002-08-20 2004-04-29 The Regents Of The University Of California Combination therapy for controlling appetites
RS52142B (en) 2002-08-21 2012-08-31 Boehringer Ingelheim Pharma Gmbh & Co. Kg. 8-[3-amino-piperidin-1-yl]-xanthines, the production thereof and the use of the same as medicaments
US7407955B2 (en) * 2002-08-21 2008-08-05 Boehringer Ingelheim Pharma Gmbh & Co., Kg 8-[3-amino-piperidin-1-yl]-xanthines, the preparation thereof and their use as pharmaceutical compositions
DE10238243A1 (en) 2002-08-21 2004-03-04 Boehringer Ingelheim Pharma Gmbh & Co. Kg New 8-(3-amino-piperidin-1-yl)-xanthine derivatives are dipeptidylpeptidase-IV inhibitors useful for, e.g. treating diabetes mellitus, arthritis or obesity
DE10238477A1 (en) 2002-08-22 2004-03-04 Boehringer Ingelheim Pharma Gmbh & Co. Kg New purine derivatives, their production and their use as medicines
DE10238470A1 (en) 2002-08-22 2004-03-04 Boehringer Ingelheim Pharma Gmbh & Co. Kg New xanthine derivatives, their production and their use as medicines
CN1310885C (en) 2002-08-29 2007-04-18 大正制药株式会社 Benzenesulfonate of 4-fluoro-2-cyanopyrrolidine derivative
WO2004024184A1 (en) * 2002-09-11 2004-03-25 Takeda Pharmaceutical Company Limited Sustained release preparation
AU2003262042A1 (en) * 2002-09-11 2004-04-30 Yamanouchi Pharmaceutical Co., Ltd. Method of screening insulin content enhancer
WO2004032836A2 (en) 2002-10-07 2004-04-22 Merck & Co., Inc. Antidiabetic beta-amino heterocylcic dipeptidyl peptidase inhibitors
WO2004033455A2 (en) 2002-10-08 2004-04-22 Novo Nordisk A/S Hemisuccinate salts of heterocyclic dpp-iv inhibitors
AR041470A1 (en) * 2002-10-17 2005-05-18 Upjohn Co PIRROLO COMPOUNDS (1,2 - B) PIRIDAZINE AND ITS USES
WO2004037169A2 (en) 2002-10-18 2004-05-06 Merck & Co., Inc. Beta-amino heterocyclic dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
US6995180B2 (en) 2002-10-23 2006-02-07 Bristol Myers Squibb Company Glycinenitrile-based inhibitors of dipeptidyl peptidase IV and methods
AU2003286776A1 (en) 2002-10-30 2004-06-07 Guilford Pharmaceuticals Inc. Novel inhibitors of dipeptidyl peptidase iv
AU2003280680A1 (en) 2002-11-01 2004-06-18 Sumitomo Pharmaceuticals Co., Ltd. Xanthine compound
ATE350374T1 (en) 2002-11-07 2007-01-15 Merck & Co Inc PHENYLALANINE DERIVATIVES AS INHIBITORS OF DIPEPTIDYL PEPTIDASE FOR THE TREATMENT OR PREVENTION OF DIABETES
DE10251927A1 (en) 2002-11-08 2004-05-19 Boehringer Ingelheim Pharma Gmbh & Co. Kg New 1,7,8-trisubstituted xanthine derivatives, are dipeptidylpeptidase-IV inhibitors useful e.g. for treating diabetes mellitus type I or II, arthritis or obesity
US7482337B2 (en) * 2002-11-08 2009-01-27 Boehringer Ingelheim Pharma Gmbh & Co. Kg Xanthine derivatives, the preparation thereof and their use as pharmaceutical compositions
CA2502068A1 (en) * 2002-11-18 2004-06-03 Pfizer Products Inc. Dipeptidyl peptidase iv inhibiting fluorinated cyclic amides
DE10256264A1 (en) 2002-12-03 2004-06-24 Boehringer Ingelheim Pharma Gmbh & Co. Kg New trisubstituted dihydro-imidazo-pyridazinone or imidazo-pyridinone derivatives, useful as dipeptidylpeptidase-IV inhibitors for e.g. treating diabetes mellitus type I or II, arthritis or obesity
UY28103A1 (en) 2002-12-03 2004-06-30 Boehringer Ingelheim Pharma NEW IMIDAZO-PIRIDINONAS REPLACED, ITS PREPARATION AND ITS EMPLOYMENT AS MEDICATIONS
AU2003297564A1 (en) 2002-12-04 2004-06-23 Merck & Co., Inc. Phenylalanine derivatives as dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
US7420079B2 (en) 2002-12-09 2008-09-02 Bristol-Myers Squibb Company Methods and compounds for producing dipeptidyl peptidase IV inhibitors and intermediates thereof
JP2006512334A (en) 2002-12-10 2006-04-13 ノバルティス アクチエンゲゼルシャフト Combination of DPP-IV inhibitor and PPAR-alpha compound
WO2004058266A1 (en) 2002-12-20 2004-07-15 Merck & Co., Inc. 3-amino-4-phenylbutanoic acid derivatives as dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
US6982164B2 (en) * 2003-01-10 2006-01-03 Mgp Ingredients, Inc. Unhydrolyzed jojoba protein products having high simmondsin concentration
DE602004009295T2 (en) * 2003-01-14 2008-07-03 Arena Pharmaceuticals, Inc., San Diego 1,2,3-TRISUBSTITUTED ARYL AND HETEROARYL DERIVATIVES AS MODULATORS OF METABOLISM FOR THE PREVENTION AND TREATMENT OF METABOLISM-CONDITIONAL DISEASES SUCH AS DIABETES OR HYPERGLYKEMIA
JP4564952B2 (en) 2003-01-17 2010-10-20 メルク・シャープ・エンド・ドーム・コーポレイション 3-Amino-4-phenylbutanoic acid derivatives as dipeptidyl peptidase inhibitors for the treatment and prevention of diabetes
JP2004244412A (en) 2003-01-20 2004-09-02 Kotobuki Seiyaku Kk 2-cyanopyrrolidine derivative having substituent at 4-position, method for producing the same, and medicament containing the same
CA2513684A1 (en) * 2003-01-31 2004-08-19 Merck & Co., Inc. 3-amino-4-phenylbutanoic acid derivatives as dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
PT1595866T (en) 2003-01-31 2016-09-14 Sanwa Kagaku Kenkyusho Co Cyanopyrrolidines useful for the treatment of inter alia metabolic syndrome
WO2004071454A2 (en) 2003-02-13 2004-08-26 Guilford Pharmaceuticals Inc. Substituted azetidine compounds as inhibitors of dipeptidyl peptidase iv
ATE414076T1 (en) * 2003-02-24 2008-11-15 Arena Pharm Inc PHENYL AND PYRIDYLPIPERIDINE DERIVATIVES AS MODULATORS OF GLUCOSE METABOLISM
WO2004076434A1 (en) 2003-02-28 2004-09-10 Aic Dipeptidyl peptidase inhibitors
WO2004076433A1 (en) 2003-02-28 2004-09-10 Aic Dipeptidyl peptidase inhibitors
JP2004269468A (en) 2003-03-12 2004-09-30 Yamanouchi Pharmaceut Co Ltd Pyrimidine derivative or salt thereof
JP2004269469A (en) * 2003-03-12 2004-09-30 Yamanouchi Pharmaceut Co Ltd Pyrimidine derivative or salt thereof
AR043515A1 (en) 2003-03-19 2005-08-03 Merck & Co Inc PROCEDURE TO PREPARE CHIRAL DERIVATIVES BETA AMINO ACIDS BY ASYMMETRIC HYDROGENATION
WO2004085661A2 (en) 2003-03-24 2004-10-07 Merck & Co., Inc Process to chiral beta-amino acid derivatives
KR20050122220A (en) 2003-03-25 2005-12-28 다케다 샌디에고, 인코포레이티드 Dipeptidyl peptidase inhibitors
WO2004087650A2 (en) 2003-03-27 2004-10-14 Merck & Co. Inc. Process and intermediates for the preparation of beta-amino acid amide dipeptidyl peptidase-iv inhibitors
WO2004092128A1 (en) 2003-04-10 2004-10-28 Smithkline Beecham Corporation Anhydrous crystalline forms of (2s, 4s)-1-{(2r)-2-amino-3-‘4-methoxybenzyl)sulfonyl!-3-methylbutanoyl}-4-fluoropyrrolindine-2-carbonitrile
JPWO2004096806A1 (en) 2003-04-30 2006-07-13 大日本住友製薬株式会社 Condensed imidazole derivatives
DE602004026289D1 (en) * 2003-05-05 2010-05-12 Probiodrug Ag Glutaminyl INHIBITORS
EP1622870A2 (en) 2003-05-05 2006-02-08 Prosidion Ltd. Glutaminyl based dp iv-inhibitors
US7083933B1 (en) * 2003-05-09 2006-08-01 Prosidion Limited Methods for identification of modulators of OSGPR116 activity
CA2524531A1 (en) 2003-05-14 2004-12-02 Merck And Co., Inc. 3-amino-4-phenylbutanoic acid derivatives as dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
US7638638B2 (en) 2003-05-14 2009-12-29 Takeda San Diego, Inc. Dipeptidyl peptidase inhibitors
US20060293297A1 (en) 2003-05-15 2006-12-28 Hiroshi Fukushima Cyanofluoropyrrolidine derviative
WO2004104215A2 (en) 2003-05-21 2004-12-02 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with dipeptidylpeptidase 7 (dpp7)
WO2004104216A2 (en) 2003-05-21 2004-12-02 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with dipeptidylpeptidase iv (dpp4)
AU2003902828A0 (en) 2003-06-05 2003-06-26 Fujisawa Pharmaceutical Co., Ltd. Dpp-iv inhibitor
EP1635832A2 (en) 2003-06-06 2006-03-22 Merck & Co., Inc. Combination therapy for the treatment of diabetes
DE602004026440D1 (en) 2003-06-06 2010-05-20 Merck Sharp & Dohme CONDENSED INDOLE AS A DIPEPTIDYL-PEPTIDASE INHIBITOR FOR THE TREATMENT OR PREVENTION OF DIABETES
AU2003902946A0 (en) 2003-06-12 2003-06-26 Fujisawa Pharmaceutical Co., Ltd. Dpp-iv inhibitor
AU2004249163A1 (en) 2003-06-17 2004-12-29 Merck & Co., Inc. Cyclohexylglycine derivatives as dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
DE10327439A1 (en) 2003-06-18 2005-01-05 Boehringer Ingelheim Pharma Gmbh & Co. Kg Novel imidazopyridazinone and imidazopyridone derivatives, their production and their use as pharmaceuticals
RU2339636C2 (en) 2003-06-20 2008-11-27 Ф.Хоффманн-Ля Рош Аг Hexahydropyridoisoquinolines as dipeptidyl peptidase iv (dppiv) inhibitors
EA009591B1 (en) 2003-06-20 2008-02-28 Ф.Хоффманн-Ля Рош Аг Pyrido[2,1-a]-isoquinoline derivatives as dpp-iv inhibitors
JO2625B1 (en) 2003-06-24 2011-11-01 ميرك شارب اند دوم كوربوريشن Phosphoric acid salt of a dipeptidyl peptidase-IV inhibitor
JP2005023038A (en) 2003-07-04 2005-01-27 Taisho Pharmaceut Co Ltd Therapeutic agent for chronic renal disease
AR045047A1 (en) * 2003-07-11 2005-10-12 Arena Pharm Inc ARILO AND HETEROARILO DERIVATIVES TRISUSTITUIDOS AS MODULATORS OF METABOLISM AND PROFILAXIS AND TREATMENT OF DISORDERS RELATED TO THEMSELVES
CA2532971A1 (en) * 2003-07-14 2005-01-27 Arena Pharmaceuticals, Inc. Fused-aryl and heteroaryl derivatives as modulators of metabolism and the prophylaxis and treatment of disorders related thereto
KR20060037391A (en) 2003-07-21 2006-05-03 스미스클라인 비참 코포레이션 (2s,4s)-4-fluoro-1-[4-fluoro-beta-(4-fluorophenyl)-l-phenylalanyl]-2-pyrrolidinecarbonitrile p-toluenesulfonic acid salt and anhydrous crystalline forms thereof
PE20050249A1 (en) 2003-07-25 2005-06-01 Aventis Pharma Gmbh NEW CYANOPYRROLIDES AND PROCEDURE FOR THEIR PREPARATION AS MEDICINES
US7094800B2 (en) * 2003-07-25 2006-08-22 Sanofi-Aventis Deutschland Gmbh Cyanopyrrolidides, process for their preparation and their use as medicaments
DE10333935A1 (en) 2003-07-25 2005-02-24 Aventis Pharma Deutschland Gmbh New bicyclic cyano-heterocycles, process for their preparation and their use as pharmaceuticals
US7008957B2 (en) * 2003-07-25 2006-03-07 Sanofi-Aventis Deutschland Gmbh Bicyclic cyanoheterocycles, process for their preparation and their use as medicaments
ATE417832T1 (en) 2003-07-31 2009-01-15 Merck & Co Inc HEXAHYDRODIAZEPINONES AS INHIBITORS OF DIPEPTIDYLPEPTIDASE-IV FOR TREATMENT OR PREVENTION OF DIABETES
US6995183B2 (en) 2003-08-01 2006-02-07 Bristol Myers Squibb Company Adamantylglycine-based inhibitors of dipeptidyl peptidase IV and methods
WO2005019168A2 (en) 2003-08-20 2005-03-03 Pfizer Products Inc. Fluorinated lysine derivatives as dipeptidyl peptidase iv inhibitors
JPWO2005021550A1 (en) 2003-08-29 2006-10-26 大日本住友製薬株式会社 Bicyclic pyrazole derivatives
HU227684B1 (en) 2003-08-29 2011-11-28 Sanofi Aventis Adamantane and azabicyclo-octane and nonane derivatives and their use as dpp-iv inhibitors
CA2536251C (en) 2003-09-02 2009-08-04 Merck & Co., Inc. Novel crystalline forms of a phosphoric acid salt of a dipeptidyl peptidase-iv inhibitor
WO2005023762A1 (en) 2003-09-04 2005-03-17 Abbott Laboratories Pyrrolidine-2-carbonitrile derivatives and their use as inhibitors of dipeptidyl peptidase-iv (dpp-iv)
JP2007505121A (en) 2003-09-08 2007-03-08 武田薬品工業株式会社 Dipeptidyl peptidase inhibitor
WO2005030751A2 (en) 2003-09-08 2005-04-07 Takeda Pharmaceutical Company Limited Dipeptidyl peptidase inhibitors
WO2005025554A2 (en) 2003-09-09 2005-03-24 Japan Tobacco Inc. Dipeptidyl peptidase iv inhibitor
WO2005030127A2 (en) 2003-09-23 2005-04-07 Merck & Co., Inc. Novel crystalline form of a phosphoric acid salt of a dipeptidyl peptidase-iv inhibitor
WO2005033099A2 (en) 2003-10-03 2005-04-14 Glenmark Pharmaceuticals Ltd. Novel dipeptidyl peptidase iv inhibitors; processes for their preparation and compositions thereof
EP1671649B1 (en) 2003-10-03 2011-11-23 Takeda Pharmaceutical Company Limited Dipeptidyl peptidase IV inhibitors for treating diabetic patients with sulfonylurea secondary failure
DE10348044A1 (en) 2003-10-15 2005-05-19 Imtm Gmbh Dual alanyl aminopeptidase and dipeptidyl peptidase IV inhibitors for the functional influence of different cells and for the treatment of immunological, inflammatory, neuronal and other diseases
DE10348022A1 (en) 2003-10-15 2005-05-25 Imtm Gmbh New dipeptidyl peptidase IV inhibitors for the functional influence of different cells and for the treatment of immunological, inflammatory, neuronal and other diseases
GB0324236D0 (en) 2003-10-16 2003-11-19 Astrazeneca Ab Chemical compounds
TW200519105A (en) 2003-10-20 2005-06-16 Lg Life Science Ltd Novel inhibitors of DPP-IV, methods of preparing the same, and pharmaceutical compositions containing the same as an active agent
TW200523252A (en) 2003-10-31 2005-07-16 Takeda Pharmaceutical Pyridine compounds
CA2541212A1 (en) 2003-11-04 2005-05-19 Wallace T. Ashton Fused phenylalanine derivatives as dipeptidyl peptidase-iv inhibitors for the treatment or prevention of diabetes
KR100918322B1 (en) 2003-11-12 2009-09-22 페노믹스 코포레이션 Heterocyclic boronic acid compounds
KR20150028829A (en) 2003-11-17 2015-03-16 노파르티스 아게 Use of dipeptidyl peptidase iv inhibitors
DE10355304A1 (en) * 2003-11-27 2005-06-23 Boehringer Ingelheim Pharma Gmbh & Co. Kg Novel 8- (piperazin-1-yl) and 8 - ([1,4] diazepan-1-yl) xanthines, their preparation and their use as pharmaceuticals
WO2005058849A1 (en) 2003-12-15 2005-06-30 Glenmark Pharmaceuticals Ltd. New dipeptidyl peptidase in inhibitors; process for their preparation and compositions containing them
US7217711B2 (en) * 2003-12-17 2007-05-15 Boehringer Ingelheim International Gmbh Piperazin-1-yl and 2-([1,4]diazepan-1-yl)-imidazo[4,5-d]-pyridazin-4-ones, the preparation thereof and their use as pharmaceutical compositions
DE10360835A1 (en) 2003-12-23 2005-07-21 Boehringer Ingelheim Pharma Gmbh & Co. Kg New bicyclic imidazole derivatives are dipeptidylpeptidase-IV inhibitors useful to treat e.g. arthritis, obesity, allograft transplantation and calcitonin-induced osteoporosis
US8207147B2 (en) 2003-12-24 2012-06-26 Prosidion Limited Heterocyclic derivatives as GPCR receptor agonists
WO2005072530A1 (en) 2004-01-16 2005-08-11 Merck & Co., Inc. Novel crystalline salts of a dipeptidyl peptidase-iv inhibitor
WO2005075426A1 (en) 2004-02-03 2005-08-18 Glenmark Pharmaceuticals Ltd. Novel dipeptidyl peptidase iv inhibitors; processes for their preparation and compositions thereof
US7501426B2 (en) * 2004-02-18 2009-03-10 Boehringer Ingelheim International Gmbh 8-[3-amino-piperidin-1-yl]-xanthines, their preparation and their use as pharmaceutical compositions
KR20060124712A (en) 2004-02-20 2006-12-05 노파르티스 아게 Dpp-iv inhibitors for treating neurodegeneration and cognitive disorders
DE102004009039A1 (en) * 2004-02-23 2005-09-08 Boehringer Ingelheim Pharma Gmbh & Co. Kg 8- [3-Amino-piperidin-1-yl] xanthines, their preparation and use as pharmaceuticals
EP1729757A2 (en) 2004-02-23 2006-12-13 Trustees Of Tufts College Inhibitors of dipeptidylpeptidase iv for regulating glucose metabolism
WO2005082849A1 (en) 2004-02-23 2005-09-09 Trustees Of Tufts College Lactams as conformationally constrained peptidomimetic inhibitors
US7687504B2 (en) 2004-03-09 2010-03-30 National Health Research Institutes Pyrrolidine compounds
MXPA06014129A (en) * 2004-06-04 2007-03-07 Arena Pharm Inc Substituted aryl and heteroaryl derivatives as modulators of metabolism and the prophylaxis and treatment of disorders related thereto.
US20060024313A1 (en) * 2004-07-06 2006-02-02 Xin Chen Agents that disrupt dimer formation in DPP-IV family of prolyl dipeptidases
WO2006019965A2 (en) * 2004-07-16 2006-02-23 Takeda San Diego, Inc. Dipeptidyl peptidase inhibitors
DE102004037554A1 (en) 2004-08-03 2006-03-16 Sanofi-Aventis Deutschland Gmbh Substituted 8-aminoalkylthio-xanthines, process for their preparation and their use as medicaments
DE102004038268A1 (en) 2004-08-06 2006-03-16 Sanofi-Aventis Deutschland Gmbh Substituted, bicyclic 8-pyrrolidino-xanthines, process for their preparation and their use as medicaments
US20060046978A1 (en) * 2004-08-31 2006-03-02 Morphochem Ag Novel compounds that inhibit dipeptidyl peptidase (DPP-IV) and neprilysin (NEP) and/or angiotensin converting enzyme (ACE)
DE102004043944A1 (en) 2004-09-11 2006-03-30 Boehringer Ingelheim Pharma Gmbh & Co. Kg Novel 8- (3-amino-piperidin-1-yl) -7- (but-2-ynyl) -xanthines, their preparation and their use as pharmaceuticals
DE102004044221A1 (en) * 2004-09-14 2006-03-16 Boehringer Ingelheim Pharma Gmbh & Co. Kg New 3-methyl-7-butynyl xanthines, their preparation and their use as pharmaceuticals
US20080076805A1 (en) * 2004-10-07 2008-03-27 Lin Linus S Acyclic Hydrazides as Cannabinoid Receptor Modulators
US20090253752A1 (en) * 2004-10-25 2009-10-08 Bryan Burkey Combination of dpp-iv inhibitor, ppar antidiabetic and metmorfin
US7411093B2 (en) * 2004-12-20 2008-08-12 Hoffman-La Roche Inc. Aminocycloalkanes as DPP-IV inhibitors
JP2008524331A (en) * 2004-12-21 2008-07-10 武田薬品工業株式会社 Dipeptidyl peptidase inhibitor
RU2382786C2 (en) 2004-12-24 2010-02-27 ДАЙНИППОН СУМИТОМО ФАРМА Ко., ЛТД. Bicyclic pyrrole derivatives
US7589088B2 (en) * 2004-12-29 2009-09-15 Bristol-Myers Squibb Company Pyrimidine-based inhibitors of dipeptidyl peptidase IV and methods
DOP2006000008A (en) * 2005-01-10 2006-08-31 Arena Pharm Inc COMBINED THERAPY FOR THE TREATMENT OF DIABETES AND RELATED AFFECTIONS AND FOR THE TREATMENT OF AFFECTIONS THAT IMPROVE THROUGH AN INCREASE IN THE BLOOD CONCENTRATION OF GLP-1
MY148521A (en) * 2005-01-10 2013-04-30 Arena Pharm Inc Substituted pyridinyl and pyrimidinyl derivatives as modulators of metabolism and the treatment of disorders related thereto
WO2006086727A2 (en) * 2005-02-09 2006-08-17 Entelos, Inc. Treating diabetes with glucagon-like peptide-1 secretagogues
CN101166527A (en) * 2005-04-27 2008-04-23 艾尼纳制药公司 Combination therapy for the treatment of obesity and diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood GLP-1 level
JPWO2006132406A1 (en) 2005-06-09 2009-01-08 萬有製薬株式会社 NPYY2 agonist as a therapeutic agent for diseases associated with diarrhea
JP5114395B2 (en) * 2005-06-30 2013-01-09 プロシディオン・リミテッド GPCR agonist
EP1907384A2 (en) * 2005-06-30 2008-04-09 Prosidion Limited Gpcr agonists
WO2007003964A1 (en) * 2005-06-30 2007-01-11 Prosidion Limited G-protein coupled receptor agonists
US7708191B2 (en) * 2005-07-28 2010-05-04 Edwin Vega Telebanking apparatus for transferring money or cash value between two parties in the same country or across national borders, for paying bills and browsing the internet
JP4827483B2 (en) * 2005-10-04 2011-11-30 キヤノン株式会社 Nucleic acid sample processing equipment
DK1971862T3 (en) * 2006-04-11 2011-02-14 Arena Pharm Inc Methods of Using GPR119 Receptor to Identify Compounds Useful for Increasing Bone Mass in a Person
PE20071221A1 (en) * 2006-04-11 2007-12-14 Arena Pharm Inc GPR119 RECEPTOR AGONISTS IN METHODS TO INCREASE BONE MASS AND TO TREAT OSTEOPOROSIS AND OTHER CONDITIONS CHARACTERIZED BY LOW BONE MASS, AND COMBINED THERAPY RELATED TO THESE AGONISTS
WO2008008895A1 (en) * 2006-07-13 2008-01-17 Smithkline Beecham Corporation Gpr119 agonists for the treatment of diabetes and related disorders
AU2007291252A1 (en) * 2006-08-30 2008-03-06 Inovacia Ab Pyridine compounds for treating GPR119 related disorders
JP5330260B2 (en) * 2006-12-06 2013-10-30 スミスクライン ビーチャム コーポレーション Bicyclic compounds and use as antidiabetics
WO2008076243A2 (en) * 2006-12-14 2008-06-26 Merck & Co., Inc. Acyl bipiperidinyl compounds, compositions containing such compounds and methods of treatment
DK2280704T3 (en) * 2008-03-31 2015-06-29 Cymabay Therapeutics Inc Oxymethylenarylforbindelser and uses thereof
EP2146210A1 (en) * 2008-04-07 2010-01-20 Arena Pharmaceuticals, Inc. Methods of using A G protein-coupled receptor to identify peptide YY (PYY) secretagogues and compounds useful in the treatment of conditions modulated by PYY
WO2009150144A1 (en) * 2008-06-10 2009-12-17 Inovacia Ab New gpr119modulators
CA2736421A1 (en) * 2008-09-10 2010-03-18 Boehringer Ingelheim International Gmbh Combination therapy for the treatment of diabetes and related conditions
WO2010074271A1 (en) * 2008-12-26 2010-07-01 武田薬品工業株式会社 Therapeutic agent for diabetes
US20140193463A1 (en) * 2013-01-04 2014-07-10 China Medical University Peptide for inhibiting dipeptidyl-peptidase iv

Also Published As

Publication number Publication date
WO2006076231A3 (en) 2007-01-18
EP1808168B1 (en) 2009-06-03
CY1109321T1 (en) 2014-07-02
JP2008110964A (en) 2008-05-15
CA2593427C (en) 2011-11-29
BRPI0606727A (en) 2008-03-11
CN103611161A (en) 2014-03-05
PE20100398A1 (en) 2010-06-07
NO331089B1 (en) 2011-10-03
CY1109260T1 (en) 2014-07-02
US20100291589A1 (en) 2010-11-18
WO2006076231A2 (en) 2006-07-20
JP2008239623A (en) 2008-10-09
EP1997484A2 (en) 2008-12-03
KR20120139849A (en) 2012-12-27
CA2593427A1 (en) 2006-07-20
AU2009202900A1 (en) 2009-08-06
US20100285494A1 (en) 2010-11-11
US20100137293A1 (en) 2010-06-03
CN102218141A (en) 2011-10-19
EP2322157A1 (en) 2011-05-18
DOP2006000008A (en) 2006-08-31
SI1808168T1 (en) 2009-10-31
EP2322151A3 (en) 2012-01-18
KR20100129328A (en) 2010-12-08
AU2006205164A1 (en) 2006-07-20
PL1758565T5 (en) 2013-03-29
US7803753B2 (en) 2010-09-28
US20100285495A1 (en) 2010-11-11
MX2007008376A (en) 2008-01-11
ES2327872T3 (en) 2009-11-04
EA200701469A1 (en) 2008-02-28
EP1808168A1 (en) 2007-07-18
PL1758565T3 (en) 2009-10-30
JP2012017330A (en) 2012-01-26
RS51174B (en) 2010-10-31
JP4787804B2 (en) 2011-10-05
US8022034B2 (en) 2011-09-20
EP2322150A2 (en) 2011-05-18
EP1758565B2 (en) 2012-11-14
KR20100072085A (en) 2010-06-29
NZ587368A (en) 2011-01-28
HK1096537A1 (en) 2007-06-01
DK1758565T4 (en) 2013-02-04
NZ556219A (en) 2010-09-30
RS51127B (en) 2010-10-31
PT1758565E (en) 2009-08-19
JP4807887B2 (en) 2011-11-02
AU2009202898A1 (en) 2009-08-06
KR20070095400A (en) 2007-09-28
AU2009202900B8 (en) 2010-06-03
PA8659301A1 (en) 2008-12-18
EP2322150A3 (en) 2011-11-16
US20100286111A1 (en) 2010-11-11
US8198232B2 (en) 2012-06-12
PL1808168T3 (en) 2009-11-30
US20100286172A1 (en) 2010-11-11
US20100286153A1 (en) 2010-11-11
AU2009202900B2 (en) 2010-02-11
PE20061116A1 (en) 2006-10-12
JP4221444B2 (en) 2009-02-12
ES2327268T3 (en) 2009-10-27
US20060154866A1 (en) 2006-07-13
GT200600004A (en) 2006-09-11
JP2008526235A (en) 2008-07-24
US7803754B2 (en) 2010-09-28
JP2008220374A (en) 2008-09-25
US20070072804A1 (en) 2007-03-29
EP1758565B1 (en) 2009-05-13
ATE432693T1 (en) 2009-06-15
ATE431139T1 (en) 2009-05-15
JP2008195733A (en) 2008-08-28
EP1758565A2 (en) 2007-03-07
JP4912349B2 (en) 2012-04-11
US20100286168A1 (en) 2010-11-11
NI200700174A (en) 2008-05-09
WO2006076231A8 (en) 2006-09-21
DE602006006765D1 (en) 2009-06-25
CA2654733A1 (en) 2006-07-20
JP4118323B1 (en) 2008-07-16
US8030270B2 (en) 2011-10-04
NZ578504A (en) 2011-02-25
US8003597B2 (en) 2011-08-23
SI1758565T1 (en) 2009-10-31
NZ578502A (en) 2011-01-28
JP2011184458A (en) 2011-09-22
US20070072803A1 (en) 2007-03-29
ES2327268T9 (en) 2013-11-12
EP2322152A1 (en) 2011-05-18
HRP20090403T4 (en) 2012-12-31
DK1808168T3 (en) 2009-10-05
NO20101746L (en) 2007-09-27
TW200637534A (en) 2006-11-01
HN2006000971A (en) 2011-12-27
CL2010000565A1 (en) 2010-10-15
EP2116235A1 (en) 2009-11-11
JP2008220375A (en) 2008-09-25
NO20073816L (en) 2007-09-27
PT1808168E (en) 2009-08-25
EA011883B1 (en) 2009-06-30
CR9220A (en) 2009-07-31
EP1997484A3 (en) 2009-02-11
AU2006205164B2 (en) 2011-09-08
AU2009202898B2 (en) 2010-02-18
HRP20090403T1 (en) 2009-08-31
KR101016890B1 (en) 2011-02-22
HRP20090446T1 (en) 2009-09-30
DK1758565T3 (en) 2009-09-07
IL184364A0 (en) 2007-10-31
SG189762A1 (en) 2013-05-31
JP4237243B2 (en) 2009-03-11
HK1100353A1 (en) 2007-09-21
DOP2011000040A (en) 2011-09-30
DE602006007093D1 (en) 2009-07-16
AR052082A1 (en) 2007-02-28
SG158876A1 (en) 2010-02-26
US20100298333A1 (en) 2010-11-25
KR20130140226A (en) 2013-12-23
EP2322151A2 (en) 2011-05-18
ES2327268T5 (en) 2013-03-21
EP2322156A1 (en) 2011-05-18

Similar Documents

Publication Publication Date Title
CA2654733C (en) Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level
AU2011213703A1 (en) Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood GLP-1 level

Legal Events

Date Code Title Description
EEER Examination request
MKLA Lapsed

Effective date: 20170109