CA2465202A1 - Phytase-containing animal food and method - Google Patents

Abstract

A method is described for improving the nutritional value of a foodstuff comprising a source of myo-inositol hexakisphosphate by feeding the foodstuf f in combination with a phytase expressed in yeast. The method comprises the step of feeding the animal the foodstuff in combination with a phytase expressed in yeast wherein the phytase can be selected from the group consisting of AppA1, AppA2 and a site-directed mutant of AppA. The invention also enables reduction of the feed to weight gain ratio and an increase bone mass and mineral content of an animal. A foodstuff and a feed additive comprising AppA2 or a site-directed mutant of AppA are also described.</SDOA B>

Description

PHYTASE-CONTAINING ANIMAL FOOD AND METHOD
FIELD OF THE INVENTION
The present invention is related to a method of improving the nutritional value of a foodstuff and to an improved foodstuff. More particularly, the invention relates to a method of improving the nutritional value of a foodstuff comprising myo-inositol hexakisphosphate by feeding the foodstuff to an animal in combination with a phytase expressed in yeast.
BACKGROUND AND SUMMARY OF THE INVENTION
Phytases are myo-inositol hexakisphosphate phosphohydrolases that catalyze the stepwise removal of inorganic orthophosphate from phytate (myo-inositol hexakisphosphate). Phytate is the major storage form of phosphate in plant feeds, including cereals and legumes. Because monogastric animals such as pigs, poultry, and humans have little phytase in their gastrointestinal tracts nearly all of the ingested phytate phosphate is indigestible. Accordingly, these animals require supplementation of their diets with phytase or inorganic phosphate. In contrast, ruminants have microorganisms in the rumen that produce phytases and these animals do not require phytase supplementation of their diets.
The unutilized phytate phosphate in monogastric animals creates additional problems. The unutilized phytate phosphate is excreted in manure and pollutes the environment. Furthermore, in monogastric animals phytate passes largely intact through the upper gastrointestinal tract where it chelates essential minerals (e.g., calcium and zinc), binds amino acids and proteins, and inhibits enzyme activities. Accordingly, phytase supplementation of the diets of monogastric animals not only decreases requirements for supplementation with inorganic phosphate, but also reduces pollution of the environment caused by phytate, diminishes the antinutritional effects of phytate, and increases the nutritional value of the feed.
There are two types of phytases including a 3-phytase (EC.3.1.3.8) which removes phosphate groups at the 1 and 3 positions of the myo-inositol ring, and a 6-phytase (EC.3.1.3.6) which first frees the phosphate at the 6-position of the ring.
Plants usually contain 6-phytases and a broad range of microorganisms, including bacteria, filamentous fungi, and yeasts, produce 3-phytases. Two phytases, phyA and phyB from Aspergillus niger, have been cloned and sequenced. PhyA has been expressed in Aspergillus niger and the recombinant enzyme is available commercially for use in supplementing animal diets.
Phytase genes have also been isolated from Aspergillus terreus, Myceliophthora thermophila, Aspergillus fumigatus, Emericella nidulans, Talaromyces thermophilus, Escherichia coli (appA), and maize. Additionally, phytase enzymes have been isolated and/or purified from Bacillus sp., Enterobacter sp., Klebsiella terrigena, and Aspergillus ficum.
The high cost of phytase production has restricted the use of phytase in the livestock industry as phytase supplements are generally more expensive than the less environmentally desirable inorganic phosphorous supplements. The cost of phytase can be reduced by enhancing production efficiency and/or producing an enzyme with superior activity.
Yeast expression systems can be used to effectively produce enzymes, in part, because yeast are grown in simple and inexpensive media. Additionally, with a proper signal sequence, the expressed enzyme can be secreted into the culture medium for convenient isolation and purification. Some yeast expression systems are also accepted in the food industry as being safe for the production of food products unlike fungal expression systems which may in some cases be unsafe, for example, for human food manufacturing.
Thus, one aspect of this invention is a method of improving the nutritional value of a foodstuff by supplementing the foodstuff with a yeast-expressed phytase with superior capacity to release phosphate from phytate in foodstuffs. The invention is also directed to a foodstuff with improved nutritional value comprising the yeast-expressed phytase. The phytase can be efficiently and inexpensively produced because the yeast-expressed phytase of the present invention is suitable for commercial use in the feed and food industries with minimal processing.
In one embodiment, a method is provided of improving the nutritional value of a foodstuff consumed by a monogastric animal by increasing the bioavailability of phosphate from phytate wherein the foodstuff comprises myo-inositol hexakisphosphate.
The method comprises the step of feeding to the animal the foodstuff in combination with less than 1200 units of a phytase expressed in yeast per kilogram of the foodstuff, wherein the phytase is Escherichia coli-derived AppA2, and wherein the bioavailability of phosphate from phytate is increased by at least 2-fold compared to the bioavailability of phosphate from phytate obtained by feeding the foodstuff in combination with the same units of a phytase expressed in a non-yeast host cell.
In another embodiment, a method is provided of reducing the feed to weight gain ratio of a monogastric animal by feeding the animal a foodstuff wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the step of feeding to the animal the foodstuff in combination with a phytase expressed in yeast, wherein the phytase is selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA, and wherein the feed to weight gain ratio of the animal is reduced.
In an alternate embodiment, a method of improving the nutritional value of a foodstuff consumed by a monogastric animal by increasing the bone mass and mineral content of the animal wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the step of feeding to the animal the foodstuff in combination with a phytase expressed in yeast wherein the phytase is selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA, and wherein the bone mass and mineral content of the animal is increased.
In yet another embodiment, a feed additive composition for addition to an animal feed is provided. The feed additive composition comprises a yeast-expressed phytase and a carrier for the phytase wherein the concentration of the phytase in the feed additive composition is greater than the concentration of the phytase in the final feed mixture.
In still another embodiment, a foodstuff is provided. The foodstuff comprises the above-described feed additive composition wherein the concentration of the phytase in the final feed mixture is less than 1200 units of the phytase per kilogram of the final feed mixture.
In another embodiment, a method is provided of improving the nutritional value of a foodstuff consumed by a monogastric animal wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the steps of spray drying a phytase selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA, mixing the phytase with a carrier for the phytase and, optionally, other ingredients to produce a feed additive composition for supplementing a foodstuff with the phytase, mixing the feed additive composition with the foodstuff, and feeding the animal the foodstuff supplemented with the feed additive composition.
In an alternate embodiment, a method is provided of improving the nutritional value of a foodstuff consumed by an avian species by increasing the bioavailability of phosphate from phytate wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the step of feeding to the avian species the foodstuff in combination with less than 1200 units of a phytase expressed in yeast per kilogram of the foodstuff, wherein the bioavailability of phosphate from phytate is increased by at least 1.5-fold compared to the bioavailability of phosphate from phytate obtained by feeding to a non-avian species the foodstuff in combination with the phytase expressed in yeast.
In yet another embodiment, a method is provided of reducing the feed to weight gain ratio of an avian species by feeding the avian species a foodstuff wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the step of feeding to the avian species the foodstuff in combination with a phytase expressed in yeast wherein the feed to weight gain ratio of the animal is reduced.
In still another embodiment, a method is provided of improving the nutritional value of a foodstuff consumed by an avian species by increasing the bone mass and mineral content of the avian species wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the step of feeding to the avian species the foodstuff in combination with a phytase expressed in yeast wherein the bone mass and mineral content of the avian species is increased.
In another embodiment, a method is provided of improving the nutritional value of a foodstuff consumed by an avian species wherein the foodstuff comprises myo-inositol hexakisphosphate. The method comprises the step of feeding to the avian species the foodstuff in combination with a phytase expressed in yeast wherein the number of eggs laid and the weight of the eggs laid by the avian species is increased.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the amino acid and nucleotide sequences of AppA2.
Fig. 2 shows the amino acid and nucleotide sequences of Mutant U.

Fig. 3 shows the percent increase in bioavailable phosphate in vivo in chickens fed an animal feed supplemented with Natuphos~, Mutant U, AppA or AppA2.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a method of improving the nutritional value of a foodstuff consumed by an animal wherein the foodstuff comprises myo-inositol hexakisphosphate, the substrate for the phytase enzymes of the invention. The method comprises the step of feeding to an animal the foodstuff in combination with a phytase expressed in yeast wherein the bioavailability of phosphate from phytate is increased, the feed to weight gain ratio is reduced, the bone mass and mineral content of the animal is increased or, for avian species, additionally the egg weight or number of eggs laid is increased. The phytase can be selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli derived-AppA. In an alternative embodiment, for avian species, the phytase can be any phytase, including phytases selected from the group consisting of Escherichia coli-derived AppA, Escherichia coli-derived AppA2, and a site-directed mutant of Escherichia coli-derived AppA. In some embodiments, the bioavailability of phosphate from phytate, the feed to weight gain ratio, and bone mass and mineral content are improved by at least 2-fold, for example, in an avian species, such as poultry, compared to the improvement in nutritional value obtained by feeding the foodstuff in combination with the same weight percent of a phytase expressed in a non-yeast host cell. The bioavailability of phosphate from phytate is also increased by at least 1.5-fold in porcine species compared to the improvement in nutritional value obtained by feeding the foodstuff in combination with the same weight percent of a phytase expressed in a non-yeast host cell. Additionally, the bioavailability of phosphate from phytate and the bone mass and mineral content obtained by feeding an avian species the foodstuff in combination with the phytase expressed in yeast is increased by at least 1.5-fold compared to the bioavailability of phosphate from phytate and the bone mass and mineral content obtained by feeding a non-avian species the foodstuff in combination with the yeast-expressed phytase.
As used herein "improving nutritional value" or "increased nutritional value" means an improvement in the nutritional value of a foodstuff as reflected by an increase in the bioavailability of phosphate from phytate, a reduction in the feed to weight gain ratio, an increase in bone mass and mineral content, an increase in the bioavailability of inositol from phytate, an increase in the bioavailability from phytate of minerals such as magnesium, manganese, calcium, iron and zinc in an animal fed the foodstuff, or an increase in egg weight or number of eggs laid for an avian species fed the foodstuff (e.g., for laying hens in the first or subsequent round of laying eggs).
As used herein an increase in the "bioavailability of phosphate from phytate" means an increase in availability of phosphate from phytate as reflected by an increase in weight gain or bone ash weight.
As used herein the term "non-yeast host cell" includes a fungal cell.
As used herein, the term "phytase" means an enzyme capable of catalyzing the removal of inorganic phosphate from myo-inositol hexakisphosphate.
As used herein, the term "phytate" means a composition comprising myo-inositol hexakisphosphate.
In accordance with the invention, the feed to weight gain ratio is calculated 1 S by dividing weight gain by feed intake. An increase in bone mass or mineral content is reflected by an increase in the dry weight of tibia or fibula bones or by an increase in ash weight.
A variety of phytase genes may be expressed to produce phytase for use in accordance with the invention. Exemplary of genes that can be used in accordance with the invention are phytase genes derived from bacteria, filamentous fungi, plants, and yeast, such as the appA (Gene Bank accession number M58708) and appA2 (Gene Bank accession number 250016) genes derived from Escherichia coli (E. coli) and the phyA and phyB genes derived from the fungus Aspergillus niger, or any site-directed mutant of these genes that retains or has improved myo-inositol hexakisphosphate phosphohydrolase activity.
Phytase genes can be obtained from isolated microorganisms, such as bacteria, fungus, or yeast, that exhibit particularly high phytase activity.
As described below, the appA2 gene was cloned from such an E. coli isolate, and it is exemplary of such a phytase gene.
The expressed phytase gene can be a heterologous gene, or can be a homologous gene. A heterologous gene is defined herein as a gene originating from a different species than the species used for expression of the gene. For example, in the case _7_ of expression of a heterologous phytase gene, a phytase gene derived from E.
coli or another species of bacteria can be expressed in a yeast species such as Saccharomyces cerevisiae or Pichia pastoris. A homologous gene is described herein as a gene originating from the same species used for expression of the gene. In the case of expression of a homologous phytase gene, a phytase gene derived from Saccharomyces cerevisiae can be expressed, for example, in the same yeast species.
Exemplary genes for use in producing phytase for use in accordance with the invention are appA, appA2, and site-directed mutants of appA or appA2.
Substituted, deleted, and truncated phytase genes, wherein the resulting expressed phytase, or a fragment thereof, retains substantially the same phytase activity as the phytases specifically exemplified herein, are considered equivalents of the exemplified phytase genes and are within the scope of the present invention.
The appA gene was isolated from E. coli (see U.S. Patent No. 6,451,572, incorporated herein by reference). The appA2 gene was isolated from a bacterial colony that exhibited particularly high phytase activity obtained from the colon contents of crossbred Hampshire-Yorkshire-Duroc pigs (see U.S. Patent Application No.
09/540,149, incorporated herein by reference). The AppA2 protein product exhibits a pH
optimum between about 2.5 and about 3.5. The amino acid sequence of AppA2 is as shown in SEQ
ID Nos.: 2, 3, and 10. Fig. 1 shows the amino acid and nucleotide sequences of AppA2.
The untranslated region is indicated by lowercase letters. The underlined sequences are the primers used to amplify appA2 (Pfl: 1-22, and K2: 1468-1490), appA2 (E2: 243-252, and K2: 1468-1490). Potential N-glycosylation sites are boxed. The sequence of appA2 has been transmitted to Genebank data library with accession number 250016. The nucleotide sequence of AppA2 is as shown in SEQ ID No.: 1.
Several site-directed mutants of appA have been isolated (see PCT
Publication No. WO 01/36607 A1 (U.S. Patent Application No. 60/166,179, incorporated herein by reference)). These mutants were designed to enhance glycosylation of the AppA
enzyme. The mutants include A131N/V134N/D207N/S211N, C200N/D207N/S211N
(Mutant U), and A131N/V134N/C200N/D207N/S211N (see Rodriguez et al., Arch. of Biochem. and Bioph ~~s. 382: 105-112 (2000), incorporated herein by reference). Mutant U
has a higher specific activity than AppA, and, like AppA2, has a pH optimum of between about 2.5 and about 3.5. The C200N mutation in Mutant U is in a gapped region and C200 _g_ is involved with C210 in forming a unique disulfide bond in AppA. Fig. 2 shows the amino acid and nucleotide sequences of Mutant U. The amino acid sequence of Mutant U
is shown in SEQ ID No.: 5, and the nucleotide sequence of Mutant U is shown in SEQ ID
No.: 4.
Any yeast expression system or other eukaryotic expression system known to those skilled in the art can be used in accordance with the present invention. For example, various yeast expression systems are described in U.S. Patent Application No.
09/104,769 (now U.S. Patent No. 6,451,572), U.S. Patent Application No.
09/540,149, and in U.S. Patent Application No. 60/166,179 (PCT Publication No. WO 01/36607 A1), all incorporated herein by reference. Any of these yeast expression systems can be used.
Alternatively, other eukaryotic expression systems can be used such as an insect cell expression system (e.g., Sf9 cells), a fungal cell expression system (e.g., Trichoderma), or a mammalian cell expression system.
A yeast expression system can be used to produce a sufficient amount of the phytase being secreted from the yeast cells so that the phytase can be conveniently isolated and purified from the culture medium. Secretion into the culture medium is controlled by a signal peptide (e.g., the phyA signal peptide or yeast a-factor signal peptide) capable of directing the expressed phytase out of the yeast cell. Other signal peptides suitable for facilitating secretion of the phytase from yeast cells are known to those skilled in the art.
The signal peptide is typically cleaved from the phytase after secretion.
If a yeast expression system is used, any yeast species suitable for expression of a phytase gene can be used including such yeast species as Saccharomyces species (e.g., Saccharomyces cerevisiae), Kluyveromyces species, Torulaspora species, Schizosaccharomyces species, and methylotrophic yeast species such as Pichia species (e.g., Pichia pastoris), Hansenula species, Torulopsis species, Candida species, and Karwinskia species. In one embodiment the phytase gene is expressed in the methylotrophic yeast Pichia pastoris. Methylotrophic yeast are capable of utilizing methanol as a sole carbon source for the production of the energy resources necessary to maintain cellular function, and contain a gene encoding alcohol oxidase for methanol utilization.
Any host-vector system known to the skilled artisan (e.g., a system wherein the vector replicates autonomously or integrates into the host genome) and compatible with yeast or another eukaryotic cell expression system can be used. In one embodiment, the vector has restriction endonuclease cleavage sites for the insertion of DNA
fragments, and genetic markers for selection of transformants. The phytase gene can be functionally linked to a promoter capable of directing the expression of the phytase, for example, in yeast, and, in one embodiment, the phytase gene is spliced in frame with a transcriptional enhancer element and has a terminator sequence for transcription termination (e.g., HSP150 terminator). The promoter can be a constitutive (e.g., the 3-phospho-glycerate kinase promoter or the a factor promoter) or an inducible promoter (e.g., the ADH2, GAL-1-10, GAL 7, PHOS, T7, or metallothionine promoter). Various host-vector systems are described in U.S. Patent Application No. 09/104,769 (now U.S. Patent No.
6,451,572), U.S. Patent Application No. 09/540,149, and in U.S. Patent Application No.
60/166,179 (PCT Publication No. WO 01/36607 A1), all incorporated herein by reference.
Yeast cells are transformed with a gene-vector construct comprising a phytase gene operatively coupled to a yeast expression system using procedures known to those skilled in the art. Such transformation protocols include electroporation and protoplast transformation.
The transformed yeast cells may be grown by a variety of techniques including batch and continuous fermentation in a liquid medium or on a semi-solid medium. Culture media for yeast cells are known in the art and are typically supplemented with a carbon source (e.g., glucose). The transformed yeast cells can be grown aerobically at 30°C in a controlled pH environment (a pH of about 6) and with the carbon source (e.g., glucose) maintained continuously at a predetermined level known to support growth of the yeast cells to a desired density within a specific period of time.
The yeast-expressed phytase for use in accordance with the method of the present invention can be produced in purified form by conventional techniques (for example, at least about 60% pure, or at least about 70-80% pure). Typically, the phytase is secreted into the yeast culture medium and is collected from the culture medium. For purification from the culture medium the phytase can, for example, be subjected to ammonium sulfate precipitation followed by DEAE-Sepharose column chromatography.
Other conventional techniques known to those skilled in the art can be used such as gel filtration, ion exchange chromatography, DEAF-Sepharose column chromatography, affinity chromatography, solvent-solvent extraction, ultrafiltration, and HPLC.

Alternatively, purification steps may not be required because the phytase may be present in such high concentrations in the culture medium that the phytase is essentially pure in the culture medium (e.g., 70-80% pure).
In cases where the phytase is not secreted into the culture medium, the yeast cells can be lysed, for example, by sonication, heat, or chemical treatment, and the homogenate centrifuged to remove cell debris. The supernatant can then be subjected to ammonium sulfate precipitation, and additional fractionation techniques as required, such as gel filtration, ion exchange chromatography, DEAE-Sepharose column chromatography, affinity chromatography, solvent-solvent extraction, ultrafiltration, and HPLC
to purify the phytase. It should be understood that the purification methods described above for purification of phytases from the culture medium or from yeast cells are nonlimiting and any purification techniques known to those skilled in the art can be used to purify the yeast-expressed phytase if such techniques are required to obtain a substantially pure phytase.
In one embodiment, the phytase is collected from the culture medium 1 S without further purification steps by chilling the yeast culture (e.g., to about 8°C) and removing the yeast cells using such techniques as centrifugation, microfiltration, and rotary vacuum filtration. The phytase in the cell-free medium can be concentrated by such techniques as, for example, ultrafiltration and tangential flow filtration.
Various formulations of the purified phytase preparation may be prepared.
The phytase enzymes can be stabilized through the addition of other proteins (e.g., gelatin and skim milk powder), chemical agents (e.g., glycerol, polyethylene glycol, EDTA, potassium sorbate, sodium benzoate, and reducing agents and aldehydes), polysaccharides, monosaccharides, lipids (hydrogenated vegetable oils), sodium phytate, and other phytate-containing compounds, and the like. Phytase enzyme suspensions can also be dried (e.g., spray drying, drum drying, and lyophilization) and formulated as powders, granules, pills, mineral blocks, liquids, and gels through known processes. Gelling agents such as gelatin, alginate, collagen, agar, pectin and carrageenan can be used. The invention also extends to a feed innoculant preparation comprising lyophilized nonpathogenic yeast which can express the phytases of the present invention in the gastrointestinal tract of the animal when the animal is fed the preparation.
In one embodiment, the phytase in the cell-free culture medium is concentrated such as by ultrafiltration and spray drying of the ultrafiltration retentate. The spray dried powder can be blended directly with a foodstuff, or the spray dried powder can be blended with a carrier for use as a feed additive composition for supplementation of a foodstuff with phytase. In one embodiment, the phytase in the retentate is co-dried with a carrier and/or stabilizer. In another embodiment, the phytase is spray dried with an ingredient that helps the spray dried phytase to adhere to a earner, or, alternatively, the phytase can loosely associate with the carrier. The feed additive composition (i.e., the phytase/carrier composition and, optionally, other ingredients) can be used for blending with the foodstuff to achieve more even distribution of the phytase in the foodstuff.
Exemplary feed additive compositions (i.e., phytase/carner compositions and, optionally, other ingredients) can contain 600 units of phytase/gram of the carrier to 5000 units of phytase/gram of the carrier. These phytase/carrier compositions can contain additional ingredients. For example, the compositions can be formulated to contain rice hulls or wheat middlings as a carrier (25-80 weight percent), the phytase (0.5 to 20 weight percent), calcium carbonate (10 to 50 weight percent), and oils (1 to 3 weight percent).
Alternatively, the feed additive composition can include the phytase and the carrier and no additional ingredients. The feed additive composition may be mixed with the feed to obtain a final feed mixture with from about 50 to about 2000 units of phytase/kilogram of the feed.
Thus, a foodstuff comprising a source of myo-inositol hexakisphosphate, a yeast-expressed phytase, and a carrier is also provided in accordance with the invention.
Additionally, a method of improving the nutritional value of a foodstuff consumed by a monogastric animal wherein the foodstuff comprises myo-inositol hexakisphosphate is provided wherein the method comprises the steps of spray drying a phytase, including a phytase selected from the group consisting of Escherichia coli-derived AppA, Escherichia coli-derived AppA2, and a site-directed mutant of Escherichia coli-derived AppA, mixing the phytase with a carrier, and, optionally, other ingredients, to produce a feed additive composition for supplementing a foodstuff with the phytase, mixing the feed additive composition with the foodstuff, and feeding the animal the foodstuff supplemented with the feed additive composition.
In these embodiments, the carrier can be any suitable carrier for making a feed additive composition known in the art including, but not limited to, rice hulls, wheat middlings, a polysaccharide (e.g., specific starches), a monosaccharide, mineral oil, vegetable fat, hydrogenated lipids, calcium carbonate, gelatin, skim milk powder, phytate and other phytate-containing compounds, a base mix, and the like. A base mix typically comprises most of the ingredients, including vitamins and minerals, of a final feed mixture except for the feed blend (e.g., cornmeal and soybean meal). The phytase for use in the feed additive composition is preferably E. coli-derived AppA, E. coli-derived AppA2, or a site-directed mutant of E. coli-derived AppA.
The feed additive composition containing the spray dried phytase and a Garner and, optionally, other ingredients, is mixed with the final feed mixture to obtain a feed with a predetermined number of phytase units/kilogram of the feed (e.g., about 50 to about 2000 units phytase/kilogram of the feed). Before blending with the carrier, the spray dried phytase is assayed for phytase activity to determine the amount of dried powder to be blended with the carrier to obtain a feed additive composition with a predetermined number of phytase units/gram of the carrier. The phytase-containing carrier is then blended with the final feed mixture to obtain a final feed mixture with a predetermined number of phytase units/kilogram of the feed.
Accordingly, the phytase concentration in the feed additive composition is greater than the phytase concentration in the final feed mixture.
In accordance with one embodiment of the invention the foodstuff is fed in combination with the yeast-expressed phytase to any monogastric animal (i.e., an animal having a stomach with a single compartment). Monogastric animals that can be fed a foodstuff in combination with a yeast-expressed phytase include agricultural animals, such as porcine species (e.g., barrows (i.e., castrated male pigs), gilts (i.e., female pigs prior to first mating) and any other type of swine), chickens, turkeys (points (i.e., first several weeks post-hatching) and older animals), ducks, and pheasants, any other avian species, marine or fresh water aquatic species, animals held in captivity (e.g., zoo animals), or domestic animals (e.g., canine and feline).
Agricultural monogastric animals are typically fed animal feed compositions comprising plant products which contain phytate (e.g., cornmeal and soybean meal contain phytate (myo-inositol hexakisphosphate)) as the major storage form of phosphate, and, thus, it is advantageous to supplement the feed with phytase. Accordingly, the foodstuffs that can be supplemented with phytase in accordance with the invention include feed for agricultural animals such pig feed and poultry feed, and any foodstuff for avian species or marine or fresh water aquatic species (e.g., fish food). In addition, humans can be fed any foodstuff, such as a cereal product, containing phytate in combination with the yeast-expressed phytase of the present invention.
In the case of an animal feed fed to monogastric animals, any animal feed blend known in the art can be used in accordance with the present invention such as rapeseed meal, cottonseed meal, soybean meal, and cornmeal, but soybean meal and cornmeal are particularly preferred. The animal feed blend is supplemented with the yeast-expressed phytase, but other ingredients can optionally be added to the animal feed blend.
Optional ingredients of the animal feed blend include sugars and complex carbohydrates such as both water-soluble and water-insoluble monosaccharides, disaccharides and polysaccharides. Optional amino acid ingredients that can be added to the feed blend are arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, valine, tyrosine ethyl HCI, alanine, aspartic acid, sodium glutamate, glycine, proline, serine, cysteine ethyl HCl, and analogs, and salts thereof. Vitamins that can be 1 S optionally added are thiamine HCI, riboflavin, pyridoxine HCI, niacin, niacinamide, inositol, choline chloride, calcium pantothenate, biotin, folic acid, ascorbic acid, and vitamins A, B, K, D, E, and the like. Minerals, protein ingredients, including protein obtained from meat meal or fish meal, liquid or powdered egg, fish solubles, whey protein concentrate, oils (e.g., soybean oil), cornstarch, calcium, inorganic phosphate, copper sulfate, salt, and limestone can also be added. Any medicament ingredients known in the art can be added to the animal feed blend such as antibiotics.
The feed compositions can also contain enzymes other than the yeast-expressed phytase. Exemplary of such enzymes are proteases, cellulases, xylanases, and acid phosphatases. For example, complete dephosphorylation of phytate may not be achieved by the phytase alone and addition of an acid phosphatase may result in additional phosphate release. A protease (e.g., pepsin) can be added, for example, to cleave the yeast-expressed phytase to enhance the activity of the phytase. Such a protease-treated phytase may exhibit enhanced capacity to increase the bioavailability of phosphate from phytate, to reduce the feed to weight gain ratio, to increase bone mass and mineral content, and to increase the egg weight or number of eggs laid for an avian species compared to intact yeast-expressed phytase. Additionally, combinations of phytases can be used, such as any combinations that may act synergistically to increase the bioavailability of phosphate from phytate, or proteolytic fragments of phytases or combinations of proteolytic fragments can be used. In this regard, the phytase gene expressed in yeast could be used to produce a truncated product directly for use in the method of the present invention.
Antioxidants can also be added to the foodstuff, such as an animal feed composition, to prevent oxidation of the phytase protein used to supplement the foodstuff.
Oxidation can be prevented by the introduction of naturally-occurring antioxidants, such as beta-carotene, vitamin E, vitamin C, and tocopherol or of synthetic antioxidants such as butylated hydroxytoluene, butylated hydroxyanisole, tertiary-butylhydroquinone, propyl gallate or ethoxyquin to the foodstuff. Compounds which act synergistically with antioxidants can also be added such as ascorbic acid, citric acid, and phosphoric acid. The amount of antioxidants incorporated in this manner depends on requirements such as product formulation, shipping conditions, packaging methods, and desired shelf life.
In accordance with one method of the present invention, the foodstuff, such as an animal feed, is supplemented with amounts of the yeast-expressed phytase sufficient to increase the nutritional value of the foodstuff. For example, in one embodiment, the foodstuff is supplemented with less than 2000 units (U) of the phytase expressed in yeast per kilogram (kg) of the foodstuff. This amount of phytase is equivalent to adding about 34 mg of the phytase to one kg of the foodstuff (about .0034% w/w). In another embodiment, the foodstuff is supplemented with less than 1500 U of the phytase expressed in yeast per kg of the foodstuff. This amount of phytase is equivalent to adding about 26 mg of the phytase to one kg of the foodstuff (about .0026% w/w). In another embodiment, the foodstuff is supplemented with less than 1200 U of the phytase expressed in yeast per kg of the foodstuff. This amount of phytase is equivalent to adding about 17 mg of the phytase to one kg of the foodstuff (about .0017 % w/w). In another embodiment the foodstuff, such as an animal feed composition, is supplemented with about 50 U/kg to about 1000 U/kg of the yeast-expressed phytase (i.e., about 0.7 to about 14.3 mg/kg or about .00007 % to about .0014 % (w/w)). In yet another embodiment the foodstuff is supplemented with about 50 U/kg to about 700 U/kg of the yeast-expressed phytase (i.e., about 0.7 to about 10 mglkg or about .00007 % to about .001 % (w/w)). In still another embodiment the foodstuff is supplemented with about 50 U/kg to about 500 U/kg of the yeast-expressed phytase (i.e., about 0.7 to about 7 mg/kg or about 0.00007 %
to about .007 (w/w)). In yet another embodiment, the foodstuff is supplemented with about 50 U/kg to about 200 U/kg of the yeast-expressed phytase (i.e., about 0.7 to about 2.9 mg/kg or about .00007 % to about .0003 % (w/w)). In each of these embodiments it is to be understood that "kg" refers to kilograms of the foodstuff, such as the final feed composition in the case of an animal feed blend (i.e., the feed in the composition as a final mixture). In addition, one unit (U) of phytase activity is defined as the quantity of enzyme required to produce 1 p,mol of inorganic phosphate per minute from 1.5 mmol/L
of sodium phytate at 37°C and at a pH of 5.5.
The yeast-expressed phytase can be mixed with the foodstuff, such as an animal feed (i.e., the feed composition as a final mixture), prior to feeding the animal the foodstuff or the phytase can be fed to the animal with the foodstuff without prior mixing.
For example, the phytase can be added directly to an untreated, pelletized, or otherwise processed foodstuff, such as an animal feed, or the phytase can be provided separately from the foodstuff in, for example, a mineral block, a pill, a gel formulation, a liquid formulation, or in drinking water. In accordance with the invention, feeding the animal the foodstuff "in combination with" the phytase means feeding the foodstuff mixed with the phytase or feeding the foodstuff and phytase separately without prior mixing.
The yeast expressed-phytase can be in an unencapsulated or an encapsulated form for feeding to the animal or for mixture with an animal feed blend.
Encapsulation protects the phytase from breakdown and/or oxidation prior to ingestion by the animal (i.e., encapsulation increases the stability of the protein) and provides a dry product for easier feeding to the animal or for easier mixing with, for example, an animal feed blend. The yeast-expressed phytase can be protected in this manner, for example, by coating the phytase with another protein or any other substances known in the art to be effective encapsulating agents such as polymers, waxes, fats, and hydrogenated vegetable oils. For example, the phytase can be encapsulated using an art-recognized technique such as a Na2+-alginate encapsulation technique wherein the phytase is coated with Na2+-alginate followed by conversion to Ca2+-alginate in the presence of Ca2+ ions for encapsulation.
Alternatively, the phytase can be encapsulated by an art-recognized technique such as prilling (i.e., atomizing a molten liquid and cooling the droplets to form a bead). For example, the phytase can be prilled in hydrogenated cottonseed flakes or hydrogenated soy bean oil to produce a dry product. The phytase can be used in an entirely unencapsulated form, an entirely encapsulated form, or mixtures of unencapsulated and encapsulated phytase can be added to the foodstuff, such as an animal feed composition, or fed directly to the animal without prior mixing with the foodstuff. Any phytase for use in accordance with the method of the present invention can be similarly treated.
In accordance with the method of the present invention, the phytase-containing foodstuff can be administered to animals orally in a foodstuff, such as an animal feed, or in a mineral block or in drinking water, but any other effective method of administration known to those skilled in the art can be utilized (e.g., a pill form). The foodstuff containing yeast-expressed phytase can be administered to the animals for any time period that is effective to increase the bioavailability of phosphate from phytate, to reduce the feed to weight gain ratio, or to increase the bone mass and mineral content of the animal. For example, in the case of a feed composition fed to a monogastric animal, the feed composition containing yeast-expressed phytase can be fed to the animal daily for the lifetime of the animal. Alternatively, the phytase-containing feed composition can be fed to the animal for a shorter time period. The time periods for feeding the phytase-containing foodstuff to animals are nonlimiting and it should be appreciated that any time period determined to be effective to enhance animal nutrition by administering the phytase-containing foodstuff can be used.

ANIMAL FEED BLEND COMPOSITION
The composition of the animal feed blend for chicks and pigs (i. e., the feed composition without phytase) was as follows:
Table 1. Composition of the animal feed blend used in chick and pig assays.
Ingredient Chick Assays Pig Assay Cornstarch to 100.0 to 100.0 Corn 50.89 61.35 Soybean meal, dehulled 39.69 31.19 Soybean oil 5.00 3.00 Limestone, ground 1.67 1.06 Salt 0.40 --Chick vitamin mix 0.20 --Pig vitamin mix -- 0.20 Chick trace mineral 0.15 --mix Pig trace vitamin mix -- 0.35 Choline chloride (60%) 0.20 --Pig antibiotic premix -- 0.50 (CSP) Bacitracin premix 0.05 --Copper sulfate -- 0.08 L-Lysine HC1, feed grade-- 0.17 DL-Methionine, feed 0.20 0.05 grade PHYTASE PREPARATION
Yeast seed cultures were inoculated in growth medium with Pichia pastoris X33 transformed with either AOX 1-appA, pGAP-appA2, or AOX1-Mutant U. The seed cultures were grown at 30°C for about 24 hours until an OD6oo of about 50 was reached.

The seed cultures were then used to inoculate fermentors (batch process) containing sterile FM-22 growth medium containing 5% glucose. The 24-hour seed cultures were diluted about 1:25 to about 1:50 into the FM-22 growth medium.
The yeast cultures were incubated aerobically in the fermentors at 30°C
with pH control at 6.0 (using NHZOH) and with continuous glucose feed until the cultures reached an OD6oo of about 400 (about 36 hours).
To collect the phytases from the culture medium, the yeast cultures were rapidly chilled to 8°C. The cells were separated from the culture medium by centrifugation and by microfiltration. The phytases were 70-80% pure in the culture medium and were prepared for blending with a carrier as a feed additive as follows.
The cell-free media containing the secreted phytases were concentrated by ultrafiltration (10,000 MW exclusion limit). The ultrafiltration retentates (7-5% solids) were transferred to sterile containers for spray drying. The retentates were spray dried using standard techniques known in the art and the resulting powder was collected (4-6%
moisture).
Microbiological testing of the powder was performed and the powder was assayed for phytase activity. The phytase activity of the powder (units of phytase activity/mg of powder) was used to determine the amount of dried powder to be blended with wheat middlings (i.e., the carrier) to obtain a phytase/carrier mixture with a predetermined number of phytase units/gram of the carrier. The dried phytase powder was mixed with the wheat middlings and packaged in moisture-proof containers. The phytase-containing wheat middlings were mixed with an animal feed blend as needed to obtain a final feed mixture with a predetermined number of phytase units/kg of the feed (about 400 to about 1000 U/kg).

FEED ADDITIVE COMPOSITION
The following compositions are exemplary of feed additive compositions that may be mixed with an animal feed blend, such as the animal feed blend described in Example 1, to obtain a final feed mixture with, for example, about 50 U of phytase/kilogram of the final feed mixture to about 2000 U of phytase/kilogram of the feed.
The feed additive compositions described below are nonlimiting and it should be appreciated that any phytase-containing feed additive composition determined to be effective to enhance the nutritional value of animal feed may be used.
Exemplary feed additive compositions are shown for a feed additive composition containing 600 units of phytase/gram of the feed additive composition or 5000 units of phytase/gram of the feed additive composition.
600 phytase units/gram 5000 phytase units/gram (weight percent) (weight percent) Rice hulls 82.64 76.35 Calcium carbonate 15.00 15.00 Oil 1.5 1.5 Enzyme 0.86 7.15 600 phytase units/gram 5000 phytase units/gram (wei~percent) (wei ht percent) Wheat middlings 82.64 76.35 Calcium carbonate 15.00 15.00 Oil 1.5 1.5 Enzyme 0.86 7.15 FEEDING PROTOCOL
Chicks were fed using the protocol described in Biehl, et al. (J. Nutr.
125:2407-2416 (1995)). Briefly, assays were conducted with male and female chicks from the cross of New Hampshire males and Columbian females and were conducted in an environmentally controlled laboratory room with 24 hour fluorescent lighting.
From day 0 to day 7 posthatching, chicks were fed a basal diet of 23% crude protein, methionine-fortified corn-soybean meal as described above in Example 1. On day 8, chicks were weighed, wingbanded and assigned randomly to experimental treatments. Five pens of three or four chicks per pen received each dietary treatment for a 13-day experimental feeding period, and the chicks had an average initial weight of 80 to 100 grams.

Throughout the 13-day feeding period, chicks were confined in thermostatically controlled stainless-steel chick batteries, and stainless-steel feeders and waterers were also used. These steps were taken to avoid mineral contamination from the environment. Diets and distilled deionized water were freely available throughout the S feeding period.
Pigs were fasted for 12 hours before the beginning of each assay, were fed the experimental diets for 23 days, and were fasted for 12 hours after each assay was completed. Ten pigs were used per treatment group and the pigs averaged about 8-120 kg at the initiation of the assay. Pigs were housed in individual pens that contained a stainless-steel feeder, a stainless-steel waterer, and galvanized round-bar fencing.
All of the chicks in each treatment group and the five median-weight pigs of each treatment group were euthanized for testing. Body weight gain was measured and tibia (chicks) or fibula (pigs) bones were harvested for bone ash analysis as a reflection of bone mass and mineral content.

MEASUREMENT OF INORGANIC PHOSPHATE AND BIOAVAILABLE
PHOSPHATE
Total phosphate in the feed samples used to generate a standard curve was quantified colorimetrically according to AOAC (1984) as described in Biehl et al.
Monobasic potassium phosphate (KHZP04) served as the standard. A standard curve was generated by measuring inorganic phosphate levels in basal feed supplemented with KHzP04 (X-axis) and determining tibia ash weight (mg) or weight gain (g) (Y-axis) for animals fed basal feed supplemented with various levels of KHZPOa. The bioavailability of phosphate from phytate was then determined for animals fed basal feed supplemented with phytase by comparison of tibia ash weight and weight gain in these animals to the standard curve.

BONE ASH ANALYSIS
At the end of each experiment, chicks or pigs were euthanized, and right tibia or fibula bones were removed quantitatively from chicks or pigs, respectively. The bones were pooled by replicate pen and, after removal of adhering tissue, were dried for 24 hours at 100°C and were weighed. After weighing, the bones were dry ached for 24 hours at 600°C in a muffle furnace. Ash weight was expressed as a percentage of dry bone weight and also as ash weight per bone.

PHYTASE EXPRESSION IN YEAST
In accordance with the present invention, any phytase gene may be expressed in yeast, and any yeast expression system may be used according to methods known to those skilled in the art. Yeast expression systems are described for exemplary phytase genes, such as the E. coli-derived appA and appA2 genes, and for a site-directed mutant of E. coli-derived AppA, in U.S. Patent Application No. 09/104,769 (now U.S.
Patent No. 6,451,572), U.S. Patent Application No. 09/540,149, and in U.S.
Patent Application No. 60/166,179 (PCT Publication No. WO 01/36607 A1), all incorporated herein by reference. Exemplary yeast expression systems for expressing the AppA and AppA2 enzymes and a site-directed mutant of AppA are described briefly below.
Expression of the appA gene in Saccharomyces cerevisiae.
The appA gene was expressed in Saccharomyces cerevisiae linked to the signal peptide of the phyA gene (phytase gene from Aspergillus niger). The appA gene was obtained from the ATCC, P.O. Box 1549, Manassas, VA 20108, where it was deposited pursuant to the requirements of the Budapest Treaty, under ATCC accession number 87441. The appA gene (1.3 kb) was transformed into E. coli strain BL21 using the pappAl expression vector (Ostanin et al., J. Biol. Chem., 267:22830-36 (1992)). To prepare the appA phyA signal peptide construct, the polymerase chain reaction (PCR) was used. Two primers were synthesized and the 5' primer was 80 base pairs in length and contained the phyA signal peptide sequence, a KpnI restriction enzyme cut site, and sequence complementary to the template as follows: 5' GGG GTA CCA TGG GCG TCT CTG CTG
TTC TAC TTC CTT TGT ATC TCC TGT CTG GAG TCA CCT CCG GAC AGA GTG
AGC CGG AG 3' (SEQ. ID No.: 6). The 3' primer was 24 base pairs in length and contained an EcoRI site and sequence complementary to the template as follows:
5' GGG
AAT TCA TTA CAA ACT GCA GGC 3' (SEQ. ID No.: 7). The PCR reaction was run for 25 cycles with 1 minute of denaturation at 95°C, 1 minute of annealing at 58°C, and 1 minute of chain extension at 72°C.
A 1.3 kb fragment was amplified by PCR, and was digested with KpnI and EcoRI and ligated into pYES2, a vector for expression in Saccharomyces cerevisiae. The pYES2-appA phyA signal peptide construct was transformed into the yeast (INVScI, Invitrogen, San Diego, CA) by the lithium acetate method.
Selected transformants were inoculated into YEPD medium and expression was induced with galactose after an ODboo of 2 was reached. The cells were harvested 15-20 hours after induction. The AppA phytase enzyme was isolated from the culture supernatant and was the major protein present eliminating the need for a tedious purification.
Expression of the appA or appA2 gene in Pichia pastoris.
appA. The template for the PCR reaction was as described above. The 5' primer used for the PCR reaction was as follows: 5' GGA ATT CCA GAG TGA GCC
GGA 3' (SEQ ID No.: 8). The 3' primer was as follows: 5' GGG GTA CCT TAC AAA
CTG CAC G 3' (SEQ ID No.: 9). The amplification reaction included 1 cycle at 94°C (3 min.), 30 cycles at 94°C (0.8 min), 30 cycles at 54°C (1 min.), 30 cycles at 72°C (2 min.), and 1 cycle at 72°C (10 min). The product was first inserted into the pGEM T-easy vector (Promega), and E. coli strain TOPlOF' was used as the host to amplify the construct. The construct was then inserted into the yeast expression vector pPIcZaA
(Invitrogen) at the EcoRI site, and E. coli strain TOP10F' was again used as the host to amplify the construct.
The PIcZa vector containing appA was transformed into Pichia pastoris strain X33 by electroporation. The transformed cells were plated into YPD-Zeocin agar medium and positive colonics were incubated in minimal media with glycerol (BMGY) for 24 hours. When an OD6oo of 5 was reached, the cells were centrifuged and were resuspended in 0.5% methanol medium (BMMY) for induction. Methanol (100%) was added every 24 hours to maintain a concentration of 0.5-1%. The cells were harvested at 192 hours after induction and the AppA protein was purified by ammonium sulfate precipitation and DEAF-Sepharose column chromatography.
~pA2. The appA2 gene was isolated (see U.S. Patent Application No.
09/540,179) from a bacterial colony that exhibited particularly high phytase activity obtained from the colon contents of crossbred Hampshire-Yorkshire-Duroc pigs.
To isolate a bacterial colony exhibiting high phytase activity the colon contents sample was diluted in an anaerobic rumen fluid glucose medium, was shaken vigorously for 3 minutes, and was serially diluted. The diluted samples were cultured at 37°C for 3 days on a modified rumen fluid-glucose-cellobiose-Agar medium containing insoluble calcium phytate. Colonies with a clear zone were assayed for phytase activity using sodium phytate as a substrate. The colony identified as producing the highest phytase activity was identified as an E. coli strain. Accordingly, the appA2 gene was isolated using the primers as described above for appA expression in Pichia pastoris (SEQ. ID Nos. 8 and 9). The appA2 gene was cloned into the PIcZa vector and Pichia pastoris strain X33 was transformed with the PIcZa-appA2 construct as described above for appA
expression in Pichia pastoris. The AppA2 enzyme was expressed as described above for AppA, and the AppA2 protein was collected from the yeast culture supernatant.
AppA Site-Directed Mutants.
Site-directed mutants of appA were prepared as described in U.S. Patent Application No. 06/166,179 (PCT Publication No. WO 01/36607 A1), incorporated herein by reference. Briefly, the E. coli appA mutants were constructed using the megaprimer site-directed mutagenesis method (Seraphim B. et al., Nucleic Acids Res.
24:3276-77 (1996); Smith, A.M. et al., Biotechniques 22: 438-39 (1997), which are hereby incorporated by reference).
The template for mutagenesis was obtained from ATCC, and the gene (1.3 kb) was transformed into E. coli strain BL21 (No. 87441) using the pappAl expression vector (Ostanin et al., J. Biol. Chem., 267:22830-36 (1992)). The template was amplified as described above for appA expressed in Pichia pastoris using the primers used above for appA expression in Pichia pastoris (SEQ. ID Nos.: 8 and 9). The amplification reaction included 1 cycle at 94°C (3 min.), 30 cycles at 94°C (0.5 min), 30 cycles at 54°C (1 min.), cycles at 72°C (1.5 min.), and 1 cycle at 72°C (10 min).
The mutagenesis PCR reaction was performed as described above using the primers as follows:

5'CTGGGTATGGTTGGTTATATTACAGTCAGGT3' A131N
(SEQ ID No.: 10) V 134N
5'CAAACTTGAACCTTAAACGTGAG3' C200N
(SEQ ID No.: 11 ) 5'CCTGCGTTAAGTTACAGCTTTCATTCTGTTT3' D207N
(SEQ ID No.: 12) S211N
The mutagenic PCR reactions incorporated appropriate primers to make the A131N/V134N/D207N/S211N, C200N/D207N/S211N (Mutant U), and A131N/V134N/C200N/D207N/S211N mutants of appA. The first mutagenic PCR
reaction (100.1) was performed as described above, using 4 ~.1 of the intact appA PCR
reaction mixture and the appropriate modified primers listed above. All megaprimer PCR
products were resolved in a 1.5% low melting agarose gel. The expected fragments were excised and eluted with a GENECLEAN II kit. The final mutagenic PCR reaction (1001) was set up as described above, using 4 ~.1 of the appA PCR product and varying concentrations of the purified megaprimer (50 ng to 4~g), depending on its size. Five thermal cycles were set up at 94°C for 1 minute and 70°C for 2 minutes. While at 70°C, 1 ~,mol of forward primer and 2 U of AmpliTaq DNA polymerase were added and gently mixed with the reaction mixture, and thermal cycling continued for 25 cycles at 94°C
for 1 minute and 70°C for 1.5 minutes.
The genes encoding the site-directed mutants were expressed in Pichia pastoris as described above for the appA2 gene. The protein products were expressed as described above for AppA, and the site-directed mutants were purified from the yeast culture supernatant by ammonium sulfate precipitation and DEAE-Sepharose chromatography.

IN VIVO EFFECTS OF YEAST - EXPRESSED
PHYTASES FED TO CHICKS
To evaluate their potential as animal feed supplements, the yeast-expressed phytases AppA and AppA2, were dried and added to the animal feed blend (23%
crude protein) described above in Example 1 using wheat middlings as a carrier. Chicks (four chicks per pen; average initial weight of 97 grams) were fed phytase-supplemented feed compositions as described above in Example 4. The treatment groups included various level of KHZPOa to construct the standard curve, 500 U/kg of Natuphos~, a commercially available (Gist-Brocades) phytase expressed in the fungus Aspergillus niger, 500 U/kg of AppA expressed in Pichia pastoris or in E. coli, and various levels of AppA2/p (AppA2 expressed in Pichia pastoris using the constitutive pGAP
promoter for gene expression) as follows:
Treatment Groups:
1. Basal Diet (0.10% P, 0.75%
Ca) 2. Same as 1 + 0.05% P from 3. Same as 1 + 0.10% P from 4. Same as 1 + 0.15% P from 5. Same as 1 + 500 U/kg AppA
(yeast) 6. Same as 1 + 500 U/kg AppA
(E. coli) 7. Same as 1 + 500 U/kg AppA2/p 8. Same as 1 + 1000 U/kg AppA2/p 9. Same as 1 + 1500 U/kg AppA2/p 10. Same as 1 + 500 U/kg Natuphos~

For the various treatment groups weight gain, feed intake, the feed to weight gain ratio, dry tibia weight, tibia ash weight, tibia ash weight as a percent of dry tibia weight, and the percentage of bioavailable phosphate based on both tibia ash weight and weight gain were determined. The results are expressed below as a mean for the four chicks for each of the five pens (R1, R2, R3, R4, and R5), and the mean for the five pens was also calculated (labeled "mean" in the tables). The treatment groups are labeled T1-T10 in the tables, and "g/c/d" indicates weight gain or feed intake in grams/chick/day.

Weight gain (g/c) Mean 2198 283ef314 327b 317 2994 321b 335a 344a276f d c a c b g/c/d16.8 21.824.2 25.2 24.423.0 24.7 25.8 26.521.2 Pooled SEM = 6 LSD = 16 13-d Feed intake (g/c) Mean 331f 410e436 447ab432 4114439b 459a 467a399e d a c b g/c/d25.5 31.533.5 34.4 33.2 31.633.8 35.3 35.930.7 Pooled SEM = 7 LSD = 21 Gain/feed (g/kg) Mean 661 692b 720a731a 734a 727a731a 732a 737a691b Pooled SEM = 10 LSD = 28 Dry tibia weight (mg/c) Mean 6988 756f 8904967 8734 829e9094 1028 1096a 747f a b Pooled SEM = 16 LSD = 45 Tibia Ash (mg/c) Mean 237h 2998 413e490' 4284 381f4474 559b 616a 290 a Pooled SEM = 10 LSD = 28 Supplemental P Intake (g) Tl T2 T3 T4 R1 0 0.196 0.434 0.651 R2 0 0.231 0.448 0.680 R3 0 0.196 0.445 0.687 R4 0 0.208 0.432 0.636 R5 0 0.194 0.421 0.701 Mean Od 0.205e 0.436b 0.671a Pooled SEM = 0.007 LSD = 0.022 Tibia ash (%) R1 35.15 38.2246.0350.1248.64 43.7847.98 55.6455.7936.78 R2 32.86 40.9246.5351.8649.06 47.3148.07 54.6955.3540.15 R3 36.30 39.9646.2251.6148.31 46.6249.85 54.2356.6939.14 R4 32.01 40.0247.4749.9647.70 45.9649.19 54.4456.2336.68 RS 33.45 38.8245.7449.9551.40 46.1150.54 52.8656.7141.32 Mean33.95 39.59f46.40e50.7049.02445.96e49.13'4$4.37b$6.lSa38.81f Pooled SEM = 0.57 LSD = 1.62 S
Phosphorus Equivalency Estimates Tibia Ash Weight KHZP04 Standard Curve: Y = tibia ash (mg) X = supplemental or equivalent P intake (g) Y=232.0 + 389.9X
rz=0.97 For 500 U/kg Phytase activity (example calculations using tibia ash treatment means) Bioavailable P
AppA (yeast): (428 - 232.0)/389.9=0.503 g P from 432 g FI = 0.116%
AppA (E. coli): (381-232.0)/389.9=0.382 g P from 411 g FI = 0.093%
AppA2/p: (447-232.0)/389.9=0.551 g P from 439 g FI = 0.126%
Natuphos~: (290-232.0)/389.9=0.149 g P from 399 g FI = 0.037%
** Results from ANOVA (calculation performed for each pen of four birds;
treatment legend on previous page) Bioavailable P (%) R1 0.122 0.075 0.118 0.194 0.212 0.030 R2 0.127 0.121 0.113 0.179 0.200 0.047 R3 0.117 0.091 0.131 0.168 0.206 0.034 R4 0.095 0.085 0.129 0.198 0.219 0.023 R5 0.121 0.093 0.135 0.176 0.218 0.051 Mean 0.116 0.0934 0.125 0.183b 0.211a 0.037e Pooled SEM = 0.005 LSD = 0.016 Contrasts Significance (P-value) AppA (yeast) vs. AppA 0.006 (E. coli) AppA2/p linear 0.001 AppA2/p quadratic 0.039 Weight Gain KHzP04 Standard Curve: X = weight gain (g) Y = supplemental P intake (g) Y=234.1 + 157.2X
rZ=0.84 Results from ANOVA (calculation performed for each pen of four birds;
treatment legend on previous page) Bioavailable P (%) R1 0.119 0.082 0.141 0.158 0.137 0.056 R2 0.123 0.130 0.121 0.130 0.154 0.064 R3 0.124 0.117 0.125 0.124 0.148 0.053 R4 0.121 0.112 0.133 0.148 0.140 0.069 R5 0.123 0.055 0.111 0.141 0.167 0.091 Mean 0.122b 0.0994 0.126b 0.140ab 0.149a 0.0674 Pooled SEM = 0.007 LSD = 0.021 Contrasts Significance (P-value) AppA (yeast) vs. AppA (E. coli) 0.038 AppA2/p linear 0.036 AppA2/p quadratic 0.768 Supplementation of the animal feed blend with increasing amounts of KHZP04 resulted in linear (p<.001 ) increases in weight gain and tibia ash.
Supplementation of the animal feed blend with Natuphos~ resulted in linear increases (p<.001) in weight gain, tibia ash, and % bioavailable phosphate. At 500 U/kg the yeast-expressed enzymes (AppA and AppA2/p) were more effective than E. coli-expressed AppA or Natuphos~ at improving each of the in vivo responses tested, including the feed to weight gain ratio, tibia weight, and % bioavailable phosphate. In fact, AppA and AppA2/p were 2-6 times more effective at increasing the level of bioavailable phosphate than Natuphos~, depending on whether tibia ash weight or weight gain was used to calculate the percent of bioavailable phosphate.

IN VIVO EFFECTS OF YEAST-EXPRESSED
PHYTASES FED TO CHICKS
The procedure was as described in Example 8 except that the chicks had an average initial weight of 91 grams, and the treatment groups were as follows:
Treatment Groups:
1. Basal Diet (0.10% P, 0.75%
Ca) 2. Same as 1 + 0.05% P from KHZP04 3. Same as 1 + 0.10% P from KHZP04 4. Same as 1 + 300 U/kg Natuphos~
phytase 5. Same as 1 + 500 U/kg Natuphos~
phytase 6. Same as 1 + 700 U/kg Natuphos~
phytase 7. Same as 1 + 900 U/kg Natuphos~
phytase 8. Same as 1 + 1100 U/kg Natuphos~
phytase 9. Same as 1 + 1300 U/kg Natuphos~
phytase 10. Same as 1 + 1500 U/kg Natuphos~
phytase 11. Same as 1 + 500 U/kg Ronozyme~
phytase 12. Same as 1 + 300 U/kg Mutant U phytase 13. Same as 1 + 500 U/kg Mutant U phytase 14. Same as 1 + 500 U/kg AppA phytase 15. Same as 1 + 500 U/kg AppA2 phytase The Ronozyme~ (Roche) phytase is a phytase expressed in fungus. Mutant U is the site-directed mutant of AppA described above. The tables are labeled as described in Example 8. The in vivo effects of phytase supplementation described in Example 8 were measured and the results were as follows:

~M N ~O O --~~OO V7M O~~n.--~OvM ~O

_V ~'M M M M ~ rtO r.MC1 M M M M M M V'd'U 1!

N E.,~ ~ 1 1 ) M

G1vpcp d a1h ~; d'M G~O~O~OI~

--N Wit'N ~ N M r!00v'1NOWE 00 (~M M M M M M . v~~ ~ V

N E.~ ~ M
.

MO a1h GOCr1O~N Mh CO~VQWO G1 ~~ V M M N M ~ ~~ ~'~~ ~ G~vj (~M M M M M M N (~~ ulVV d'~'M

Nd'G1N O ~O~ '~ NO G1NCOM V

EM N M M M M N ~O d~'vNlVh~ ~V

M

.~~D.-~~ h 'd'~OO ~N V'hG1h et~

~"~~ M h ~ ~ ~ Q~ ~~N O~NM M N
(~N N N N N N . . O

.-.. E.,~ M ~~ ~ ~ M

Oh (~h O ~Oh ~ OO~O1V1v1N ~

r!r N N ~ O H ~j ~000000O v100 M M M M M M ' N ~~ ~ ~V

O G1N O Mv1V1O

N O o0O~O ~; U'G,00N v1~D~.j N N M E'"

M M M N ~ ~ ~~ ~ ~ M
U

v ppV'1v1p~ v1O ~!1~;'-' ~OvOvON M Ov0 ",O 01O G1h rn,~~ h ~O00~ N V7 M N M N N N E'' N~ ~ ~ ~~ ~ etM

C

h.-. 00 U N N ~~ r,~OO ~N h 00h ~

E"~~ M N N ~ M ~C7 '~-i~ h d'~DV V7 ' ' ' Ny ~ ~!rt~td ~

GT, .-.N h O O 00~ V1~ Nh 0000 N N N N N N ~ (~,M M NM M M
' '' V ~ ~~ V ~ M

00 O V7O ~O

E.,QvOv O 00O N N M O
N N N M N N (~

N d.d.~.~.d.~ M

G100~O v1N 00~ ~,00M Vco..-.h v~

E"N N N N N ~ E.aN V d'OvN N p N V'~'VM V V'M

'~ N ~ ~ N MO we~ON c0~O~' V M N ~V ~ N-~ h'0 7 (7M

NU1~ N N G1O h NO O~~~Dh M M

O

N N M N N N
M

,.Hh ~~CO ~O~ O~~~O M ~'v'1~O.-,C OO

N N N N ~ E~~ ~ ~~ M ~ O

N N ~

h C N

~ ~ ~ ~ N MetV7~ Vb CiG GOy , ~

O ~ O

G ~ it r~

~ c,r oo~o ~ G,~noo~n ~ M 00 ~

"~00V1N l~M In ~"'~N N N ~
E.1\D~D~D~O~O~D

1 G1N 01N O O o0I~,~l~
~ ~ l~l~V'N

~1~DO v0~nVr~ r1.~~ .~~ .~rH
~OI~~O~OVr~O

M G1N O ooM Go ~ ~ ooM N r-i M v0v7M I~t~N

r"G1t~00I~~Ot~ rl.-~N N N ~ N
E-Iv0~O~O~DvD~O

.~,-,.--n.-~,-rr-1 N COO~V1Q1M Q~ O ~ ~-'l0~DN
N ~ N ~ ~ G1 [~~ N M ~ co~ ~ ~ ~ ~ ~ ~ O
'pv0v0vD~ \O 'n -~ -~, ,- , -, ~ v~t~~ ~ G1t~ ~ ~ ooN O~t~00 O o0d'V1d'N ~ ~ N O .-~M N

O 0000M ~ 00\O
O -~l~l~O ~ G1 M l~M O O O

~1\O~D~O~O~O\O '"rr"O .
~

M G1l~G1c0.--~U N l~~ '~~DM

H 00~nM I~~ ~O~ Q~ \O
0 0 0 ~ 0 0 00~DG1V'00O~M ~ V~M ~ ~ M O

"~M N ~t~DM vt ~ G1Q~ ~D
vovovow o ~o' c~~,~ o ~ o ~

e~

~!1U1.-W v700~ I~M Q~M ~,rl O

-Id'~On M l~~ ~' ~ O O O O ~ O
~ ~D~D~ ~O~D

L

A

M ,-,00N N ~ ~ ~ l~d'~ G~

N N C~l~ ~DM ~ O O ~ ~ O
~Ol0~D~O~O~O ,_,~,G1Q\~ O~

vWO v0~nG1~O N t~N y 0 ~D

"iV~O~~DI~M \O InO M M O I~l~
~O~D~O~O~O~D ,~Q~C1~,G1G1 .~l~.-.~'r.d'~ N d'.~t~~ ~

N ~n~ ~'G1~ ~ v~l~00~n~ \O

'O~D~D~OV'~D O~G101C1O~G1 O ~OG1~ Ov01 vDv~l~V~00ef ~ M

~ O .~CWt M M ~ ~ ~ ~
\Ov0~Dl~~D~D

O_G1 N O O ~ ~

~O~O~O~O~O\O p 01G~
r, O N

~ N

O QvO .~d'I~II O O ~ O N O II

N M M M ~Or1 rll~N O G100 vD~D~O~J~n~D G1G1 0000G

~, ~

N ~
~O

~ ~ II ~
II

~ N M ~ ~ C rlN M ~ V7CC
e l~~O V1M M GO
' ~ c~ooM o ~n o 0od ~ t t n ~nt~v~,~~ ~ ~ ; ? ~ ~
~

~ d'V V ~ d W ooI~V oot~

M M M M M M

_ l~~'M O 0000 O N d'O O ~OO ,--~l~

'-'~Wt N ~ d'M G~G1v'100t~I~
~'~'~'~' ~

M M M M M M

_ M 00M O1~ V7 ~O t~N N

M N op~ O ~'~ M ~

V ~n~'~ "'~D0000G10000 M M M M M M

O ~OM 00.~OC
~nO vDdwn QWO ~OM 00N

V M d'~ M ~ '~V ~nV'1\OM V1 M M M M M M

M O t1'I~00 r" ~ M d'O1~O ,-,i M ~nI~I~4~
N 01~Dt~~O n ' N N N N N

N N N N N

G~vWO N o0~ .

0ov0N I~I~p M v'1~n~ V ~ O l~O~.-r.~~n ~ 01M M ~ 00M
O OO O O O ~ ~ ~ ~ O

p O ~ , M M ~'M M M N M tnM M M

M M M M M M

~nOM ~ N N O M ~nd'N G~

'-' N NN .~N N Ov~ 00~'N ~n~' G1 ' a)N N NN N N N M M M M M M <"~~nM < M M
'~

O OO O O v M M M M M M

p ~ ~ ~ ~

V'VW~ V'1~O~ ~ M O n I n ~ ~ ~ N '~~ M

00N N V'7 O N ~, pp , M M M M M M ~

M M M M M M

i'' CC
L' G

0 00 0 0 _ 0 ~n.~N M

00v0v0.~N t~
~ ~ N ~ ~ O

l~N M N 'd'O N ' l~N M ~ "'~
--i M M M M M M . ' . N
M M M M M M

00~O.-nQ
M O I~0000~n ~OO ~OOvO O ~ O N o0O O O
M M N N M M

M M N M M M

M O 00~ G1M ~ O~01I~O O
~ U1l~~--WO O

v7O O~l~--~l~O~ ~
M N N M N N

N M N M N M

O~00N ~ t~O~. ~n~ ,-~nM M
N ~ 00M ,-~O

V I~G1O 00c000 ~.O~O O G1O O
N N M N N N

N M M N M M

~nM O d'oo~h ~ '~O l~M p~

M M ~ O~Q~00~' ~,,~0000~'V'1~nl0 M M M

M M M M M M

M 00rr~nl~.-.. V I~00M ~D.~
G~QyO M I~N

N M .-.t~O N ~ N N O .-'N M N
M M N M M M

M M M M M M

O d.

~'O ~ ~ M ~ II ~ N O M ~nO II

00I~O~M V'l0 0100~OI~00 N N N N N N ~

N N N N N N , W ~ W
M

N W
--i 'a II ~ II

f~
O
A

W

M t~~t~Do et M M N O N N

-,_ _ ~ O O O O O O

~DV p W f~

M M O N ~ N

_ _ _ _ H

rrO O O O O O

l~V1O M 00O

_ d'v'1~_ON

.-~O O O O O O
O

O

U ~

y. Ovl~G1O 00 ., N O O O ~ O O

.~O O O O O O

O

~i N ~ ~Ol~~O

O N O O
O O O O

~ i ~ O O O O

~'0 0 0 0 O I~ .~ U O _ ~ ~ N

~ I~ a ~ I~O t~O 00 O

O O O O O O O
.--a .-~

O O O O d] ~I ~ O O O O O O
O

by O

_ _ O O O O O O

o ~ ?

Q~O O O O O O

O
O
' ~ I ~ II '-' ~ ~ o,o~v-,ooO
I I I II

1-I H1 ~

w wwww bn a4 cn ~
an on M V' O~ p.
l~ M

"'O l~N O ~

C3V ~' ~ V

0 0 0 0 ~ r o 0 0 0 0 0 s~ r~
y ~ s~ 7 t~cov,o 0 ~'O O N N ' y p o 0 0 0 0 0 o0 ~ N M O O
M

.~,~ O (~ \O cue, ~D

O

C II II II ' M N .--~V ~ N ~O
II

= ~ II O O O O O O

y Q
O O O O
O C

II I~ .," O ~ O O O O O O O

,.p ,~
~

'"N N N N ~ .-wto m n II
N

' _ eto O O O O
~

L ~ I~ l~ l~ U
t~ l~ ~

w~ ~j .~.N V1 ~ Vl N N N N
N II

~ o ~ ~ ~ ~ ? ~ ~
~

_ r" ' O x ~ 0.!~ ~

c~ ~ ~ G1 ~O ~O I . .r, Y. N M ~ z .i ~. ~-~-,y ~
a v ~

+ '~ a ~

_o~o E 4;
~ O ~ N

00 g N C," ~
~

~, N h ~ ~ ,N C
~ O C

.
.

ix ~ ~ t~;
~

~
N

d -, .

-~oo .-~ ,~ ,-~ O
,-, ~ V

00 o m o o t~
~

ON O O O O O
O

OO O O O O O
O

>=.

O

M

i ''' ~ ~ z ...

~ ~

00 ~ ~O
O o0 p~ ~ O ~ N ~1 N
N N

.~ 't7 + O
U

~
~

x m ~ .-. ~n ~ ~

cn~ ~ ~ ~ ~"' N

N ~ ' ~

~ h . o .D ~

Oc~C ~ ~, ~
~L ~. ~

'~ O
U

y ~ c ~ N ~' n Ov ~

~ ~ ~ .

r~ ~ O .

II
O II
II
II

~ p O O II II
~ O ~

O
O
O
O

~

~~~~
N N O ~" ~' ~' d R d V

~

z~.~, ~~~ ~, z ?oooo Y
M
~

~

~ r~ ""~- ''~ ~ ~ _ ~ Q' O
CO
l~
(~

OO O ~
J, +' .~
'~

. C~
~, ~ ~ ~ O
-~ O
~ O
~1. ~ O
S ~
~
wr C C7 + ~
C _cci c~ w O

~ '~ O v =

~zz~~~~ N ~ ~
U V;

~

x x ~ ~ x v m ~
>,~' ..

c~'O ry.'7- ~ ~ N ~'y r~ ~ rte- O p R
~
d' ~ II y p ~ 0 0 0 0 0 N

aa~~~m~~, At 500 U/kg, the yeast-expressed enzymes (Mutant U, AppA and AppA2) were more effective than Natuphos~ or Ronozyme~ (both enzymes are expressed in fungal expression systems) at improving the in vivo responses tested.
For example, Mutant U, AppA and AppA2 were four times more effective than Natuphos~ in releasing phosphate (see Fig. 3).

IN VIVO EFFECTS OF YEAST-EXPRESSED
PHYTASES FED TO PIGS
The procedure was as described in Example 8 except that pigs (average initial weight of 10 kg) were fed the phytase-supplemented feed composition.
The treatment groups were as follows:
Treatment Groups:
1) Basal diet (0.75 P; 0.60% Ca) 2) Same as 1 + 0.05% P from KHZPOq 3) Same as 1 + 0.10% P from KHZP04 4) Same as 1 + 0.15% P from KHZP04 5) Same as 1 + 400 U/kg phytase from Natuphos~

6) Same as 1 + 400 Ulkg phytase from Mutant U phytase 7) Same as 1 + 400 U/kg AppA phytase 8) Same as 1 + 400 U/kg AppA2 phytase For the various treatment groups weight gain, feed to weight gain ratio, fibula ash weight, fibula ash weight as a percentage of dry fibula weight, and the percentage of bioavailable phosphate based on fibula ash weight were determined.
The results were as follows:

x N

O
O

r pp U

3U~

Y

~
.

U ~
N

~
Y

H
0 00.-iM O d' M

p ~ '~ O N ~~ ~
N

O O O O O O
.

O
by N
+

C~

WO \O N N 01~ M c0 p ~D ~D I~ .~ 00\O O ~O r ~
~D t~ O ~ 00G1 ~ Qv O O U v v ~
p f M ~
i~

N ~
o r M N I~ I~v W~ ~D bU
cF., M 00 \O V7 M ~' G, d1 Q V7 U

G1 N ~O ~O d'V7 ~ ~ ~ ~ -d v N M M M M M M M z z p pr ~ t~

M ~O 00 O V'1~ ~O M O bO N
'-' M [~ .~ \O O V' O OO

, v~ ~n vo ~ w o ~ ~n p z o ~
., y , .~o U 'b ~
~

O"
O 'd C v~

U on v .u.~
o~ o ,~ N ~ U
~ O

d0 vD M ~ O ~O~ ~ ~f' ~ N

~
(Ii M ~' ~ V'7~'~ ~ ~' C/~z O N

O ~
r~

Q) Q~., O ryC

'L7 N c~C

N ~
p ~, ~ O .

N
i CG N ~ d N

N N N O ~ (~ I~ U

~ y v U ~
f -n ~ . y d ~ a.

o ~. ~

0 0 o z ~ d~ dp" ~'n '~ ~ ,~
' ~. ~.

C'~,CL C-'rx '~ ." ~~ ~ !3.O .~~
~ U

w w w \

~ '' o o ~ -. oo .-.o -v 0 . , ~ ~ ~ ~

+ + + + + + +

~

' ~-10 ~ ~ a ~ m ~
' a ~ ~ ~ ~ ~ ~ ~ ~ ~ ~.~ ~ 'a~~:

" ~ ~

F ~ ~a s U z ~

H a ~ ~ ~ ~ ~ ~ ~ ~.

At 400 U/kg, the yeast-expressed enzymes (Mutant U, AppA, and AppA2) were more effective than Natuphos~ (expressed in fungus) at improving the responses tested.

IN VIVO EFFECTS OF YEAST-EXPRESSED
PHYTASES IN CHICKS
The procedure was as described in Example 8 except that the chicks had an average initial weight of 83 grams, and the treatment groups were as follows:
TREATMENT GROUPS:
1. Basal Diet (0.10% P; 0.75% Ca) 2. Same as 1 + 0.05% P from KHZP04 3. Same as 1 + 0.10% P from KHZP04 4. Same as 1 + 0.15% P from KHZP04 5. Same as 1 + 500 U/kg Natuphos~ phytase (batch 1 ) 6. Same as 1 + 500 U/kg Natuphos~ phytase (batch 2) 7. Same as 1 + 1000 U/kg Natuphos~ phytase (batch 2) 8. Same as 1 + 500 U/kg Ronozyme~ phytase (batch 1) 9. Same as 1 + 500 U/kg Ronozyme~ phytase (batch 2) 10. Same as 1 + 1000 U/kg Ronozyme~ phytase (batch 2) 11. Same as 1 + 500 U/kg Mutant U phytase 12. Same as 1 + 500 U/kg AppA phytase 13. Same as 1 + 500 U/kg AppA2 phytase 14. Same as 1 + 500 U/kg AppA2 + novel promoter phytase (App A2/p) The tables are as labeled in Example 8. The in vivo effects of phytase supplementation described in Example 8 were measured and the results were as follows:

~'W O v~t~~ 00~ ~ ~I'u1N v1G1M
'~'~

O M ~ r1N N ~Vl~~ V'~
E"'~M M M M M M N E'~t1'~''c~'~'~

N

M N OvM O d'~ ~. M I~ l~O ~ O\I~
'~

N O .-1~ ~ .~N ' ~t N ~ N ~ M
M M M M M M N E'~~ ~ ~ 'C~'~'d' N o0v0G~00f~N M N 01 ~ O\M O et'-' ~~O .~O ~ O ~--iN ~ N ~hW I~N ~ M

L~M M M M M M N E'~V' ~''~d'~'!t' '~~nN ~'a1v0G~~ ''~V'1v~O~~ ~nG1O
~ "

'~N ~ N N O ~ N ' M O~M ~nN N ~
E"~M M M M M M N E'~~ M ~ ~ ~f'd'~

M ~oM o~~n'~ O .~ ootwO d'~
~ '~ N

E'~V1ctV N N !ft~ E'~N \O\OV~U1~G
N N N N N N .-~ M M M M M M

M

0ovwY Ov~ V' W o00od~~oM
v1 ,~,c~~,~.-i~ ~ oo N V N ~ N N

E~N N N ~--~N N .-~ E~N M M M M M

M l~U10000'~TO ~' 01 M O 00~D01 ~ N

N M .~N ~ N ~D~ [~~n ~OM U1M et N c~1N N N N ., M M M M M M

~DO o000V~~ ~' N N .~~ O M
~!1V'10000~Oo0f t~~ I~00O v1O~N
."

F~N N N N N N .~~ E~M M M ~ d'M
' W

V7O ~tO O ~D~ ~O O O O O M
M .~~n~nM M ~D ~ oo V O t~t~L~N

E'~N N N N N N ~ E"VM M ~ M M M

N ~OV'1N M 00~ (~ M Q1~OW -~I
' ~ ' N

E'~N O M ~ 01rlV1 E"'~~ M ~O~O~ V7 N N N .~N .~ M M M M M M

N

01N l~O ~OM ~ d' ~ N l~M V1N
O~M ~ M V~M M ~ N '~'l~N CO1nM

N N M M M M M N H V ~ d'd'd' v1O !~00~nM ~ ,-W~ O~O l~I~
M ~ O~G~00OvG1O M M O .-~O N ~ N

E'~N N N N N N N E'~~

N 00f~N I~M ~ M N V'~D~ N
N V7M N ~D~ In00 N l~ V'1l~00(~t~N O

E"~N N N N .NN ~ ~ E'~M M M M M M

N 01M ~OO ~O~ W G1 G1 v~~ N ~t00O W

O\Vf G1 ~ rl ~ t~ M G1GW' O N ~
N

~ ~ E~N M N N M M

O A O
A

O O C .O
a a ~a ~ ; ~

-42~
d'N h 00O~N 00 ~ ~ O ~ O O
~ N

~ d'~ O .~.-~O ~'O O N O r N h ~Dh h h h ~--i.-. ~-..~.-,-ii H

h ~ O h O ~
M G1N M I~O 00 V7Wit'M ~ M 00 N _ M O ~ M O O .-.O .~O
h h h h h I W --~.~~ .~.--n.~,~

--~N h v~d'~D
N o0vDM M N N ~t~ .~-i~D~100 ~ h h M O N O ~ O ~ O O
h h ~O~Oh (~W --~.-~.-. .~.-.~y h M ~ M d'00 ""~h O h G1~ V7 ~ V)~O~ e-i 01M N N e* ~ .~~ .~.-~O
(~h h h h h h rl.~.--..--~.-. ,-y O M O~~ h 00N ~ ~O ~ON N G1 '~

Q~~1h N v~00 O M .~ r.Iw0 h H h ~D~OVr~D~D .-io001 0000G100 ~V,~~D~'~'Wit' ~ ~O G1h V1~D
h v1N G1N M Qv~ Wit'O N N

W O ~O~Ov~~O~D Ovo0h o000rAO

V

M O h G1N ~ N ~ rhh 00N
CJJO ' ~ ~ ~O v N v1~ M d et N M 0 M
'~,'E~\OVOVD~D~D~D~ OOO000 oOC'Ah 00 bA

b~

d'N ~O.~.~V7~ N v0 h 00h 00 ~ ' ' c\ 0000V ~ d h .-~O M .~-WO O
H ~O~D1 h ~D\O h G1G1 C~0100Q\
~O

00v0v7h N N ~ O W N ~ v1O~
O ~ M h N M ~ V ~O ~ O ~

E"~~O~O~D~Dv0~D ~O00h Q1G10000 00h ~DN V'7O 01N ~ N M M
M ~D~DN .~~ ~tO G1N

E'~~O~O~D~O~ ~D ~ 01h 0000h O

N o0 ~ON ~DG1 V1N ~DM h rl O G1 Q1M ~Orl O ~1M N M M O N N N N N

H h h h h h r ~f~-00M ~D h rl ct Q~O O M ~ O M ~ M

M 00~ O N G1O O O O M O O
E'~~Dh h h ~Dh M ~~ ~ 01--~h~O~DO v1O ~O ~'.-~01M
N h h o0000000M 00~ 00.-.N O

E'~~D~O~Ov0v0~O'~ N o0i o0~ ~ OvN

d'M 00.~.-np~W h .~~ O 00M
"'~d'O~U1 v \ ~ M h M 0 h ~
I~

v1~nvWO 1 O ~ ~ 00 h 1 h M
O ~n1~ ~O h ~ 'I

C O C/~ G O

a~a ~ a.a ~ M ~t~O~ Cv ct00N ~ O t~
~OOvN I~00et rYM v101M O ~ f~N lrVrl~~D
~ M ~ d' M M M M M M

~ y t M o M o,00 M N M d'~ Qy0 O ~no0t~O GO
~ M M M d'M

M M M M M M

M O ~ O~N 00 N ~1v1O V~O M N O G1M O O O

00N f~v100O l~~O~OG1~OI
M ~ M ~'M 'd' ~

~-,~M M M M M

~nv~O ~OM ~' ~ ~ 01d'~Dl~N
d.V1I~~Ov-1 .--n~ ,~,~00O ~"'~t~~nvi~WO ~O
~hM ~ d'M ~

M M M M M M

a 0 ~ O~.-~~ N N O ~ ~D~nl~N V' ' Oy,--~M O~N V7 \p.--~00V ~ M '~N N N N N N ~
M ~ O 1 N

p . N N N N N N
p O O O O O

N

M O o0O N M ~ ~ M 00N
V o0O 0001 ~ l~ 01O l~~ C W1O N .~N N ~ oo~D~O~Ov0~G
N N N N N N

N N N N N N

,x o 0 0 0 0 0 ,-, U
G1N D N N l~o '-'~ v~~O~ t~

C ~ 00M V'M N O N ~ 00 ~
N N N N N N

~ N N N N N N

tCN ~ ~ ~ ~ ~ ~ ce ~ .-r~ON M 01 C." O O O O O p ~p~.~pN ~ N
00V I~ 00 ~ h d'~ I~l'A~O~O~ l~~ l ~

~O~OG1O O 00 N N N N N N ~ N N N M M N

O O O O O ~
O 00.-nN Q\~O M o0I~-..-n ~OM Q~~D~DN M ~ ~ v'1C~. h l~
N .-~N N N N G1 N N N N N N

C

~l ~ ~ W ~ ~ Q~COO ,-~~. O ,--y0 N '-.
~ v'1O d;~DN

--~r ~ ~ O~M N .-.N ~ N N N N
,~/ N ~ N N N N

N N

M ~ ~ ~ ~ I~00M N N N
~ '-'~ N O M

d'\OCOo0v100V'7 ~ ~Of~I~l~00l~
M d'~ d'~h'V' M M M M M M

.-r.--nf~~!1l~O
" M ~ V7v)l~ M N 0000N M

M o0V ~O~ M ~ M 'p~'~ M N
M M M M M M

M M M M M M

v1O~41l~~ N N N
~ W O N ,~O

N v~f~l~oo~Dl~ N ppi ,~.~00O
N N N N N N

N M M N M

N

O M ~ N
t~v,~ M M II coN ~.p ~ opII

.-w.~,-r H d'V1~ M

~ N N N N N W
N

N

M ~
r-i A

H:

00o M o a~;,~, M G1~tN M N

O O O O O p M .~~O~ M
N O .--n.~N ~

O O O O O p n O ' N M O V

O O O O O
~ O

O

O_ p M M 0101l~'Op M M N N
O ~ ,-~.-~,~.-a -p O O O O O p ~D
M

t~

M

N

N
M
N
N
N
N
.~
N
tip O O O O ~ ~ ~ ~ d7 ? O O O O O O O O

0 01N O O o0-M

O O O O O O
' ~ O O O O O

O
i-r rr b .,_, N
~ 00O~41l~V7 CC
~

II a.,p O O O O N
II
II
II
II
II
II
II
~
CG

w 0 0 0 0 0.0 ww~,wwww o ~

'i-~

a, a4 cn a4 cp cn an an c~

.-, M

l0 d' l~

p O
~n l~
~t N
N
~
M
~' --M
M
M
M
~
d d ~

~OooN ~

M M M N
' ~ O O O O p ~ ~

i 4~
V
C
G
4~
4~
4~
4~
~

O O O O O O p O
w d4 CD
bU
b4 GO
dp by b17 ~
~

N
N

O~
l~
~
N
b ~

N
a\

~' d' O
~D
'O

~r O
~
O
O
~
~
~
u'1 N

C N ~ ~ ~ M o0 O
O
O
O
O
O
O
O
~

II' r'0 0 0 0 0 0 II
Il II

ll II
II
O

M
M
M
M
M
M
M
M
Q

G
c~
cv av av a\
~
c~
c, II II m M M M
M M M M
C ~ w ~ w w w w w O

;o a c o 0 0 0 0 ~
'~

~, '" t~ ~ t~ 0000~ -~o0 t~ t~ I~ t~ N O ~ ~nN N
f~

' ~ 00 00 00 00 ~OO O O O O M

' ' ,~ .-n .-n ,-, . . O
~-, .~ ,~ .~ O O O O O
.-~
~

'~
~ ~ ~ ~ i n ~
~ ~ ~
?

~ ~ ~Y ~D I~
M ch M N Q1 N
d ~

d' ~O
N N
N~~' _~

~

~ ,7, ~ 00V'1N I~\pO
~ ' M N

"
M ~ o o O O C II
G G
~

N ~ ~ 0 . O O O p O

~"' ~ O O O
+ 'x ~

'" O W
O O
U
~
~

O~
"
~

I~
O
~
.~ .~.
N N

v'0.
~ C
~
~
~
'~' ~
C~ G
~
~ A
~

oII II o 5~ ee ~ ~ O
cs O O ~ C. v~
C, =. i ~
~

~~d~ wa ' z z~~
~N~.w .

At 500 U/kg, the yeast-expressed enzymes (Mutant U, AppA, AppA2, and AppA2/p) were more effective than Natuphos~ or Ronozyme~ at improving the in vivo responses tested including weight gain, feed to weight gain ratio, bone mass and mineral content, and percent bioavailable phosphate. The yeast-expressed enzymes were about four times more effective at increasing the level of bioavailable phosphate than either of the fungus-expressed enzymes.

IN VIVO EFFECTS OF YEAST-EXPRESSED
PHYTASES FED TO POST-MOLT LAYING HENS
The procedure was as described in Example 8 except post-molt laying hens were tested, egg production and egg weight was determined, and the treatment groups and basal diet were as follows:
Treatments:
1. P-deficient corn-soybean meal basal diet (0.10% Pa; 3.8% Ca; 17% CP) 2. As 1 + 0.10% Pi from KHzP04 3. As 1 + 150 U/kg r-AppA2 phytase 4. As 1 + 300 U/kg r-AppA2 phytase 5. As 1 + 10,000 U/kg r-AppA2 phytase Basal Diet:
Ingredient Corn 63.65 Soybean meal, dehulled 25.65 Limestone, ground 9.80 Salt 0.40 Mineral premix 0.20 Vitamin premix 0.15 DL-methionine, feed-grade 0.10 Choline chloride 0.05 **Note: Treatment 1 discontinued after week 4 due to egg production below 50%.
The following tables are labeled as described in Example 8 and some of the same responses as described in Example 8 were measured. The results show that AppA2 increases egg production and egg weight in post-molt laying hens.

Treatments:
1. P-deficient corn-soybean meal basal diet (0.10% pa; 3.8% Ca; 17%
CP) 2. As 1 + 0.10% Pi from KHZPO4 3. As 1 + 150 U/kg r-AppA2 phytase 4. As 1 + 300 U/kg r-AppA2 phytase 5. As 1 + 10,000 U/kg r-AppA2 phytase Initial body weights l~: mean of 12 hensl mean 1716 1725 1733 1798 1746 Pooled SEM = 26 LSD = 78 4-wk bodv weights (~: mean of 12 hens) T1 T2 T3 ~ T4 TS

Rl 1566 1802 1763 1769 1748 R3 1633 1707 1744 _ 1850 mean 1593 1748 1771 1806 1770 Pooled SEM = 21 LSD = 64 12-wk bodv weights (~: mean of 12 hens) mean -- 1830 1796 1833 1830 Pooled SEM = 24 LSD = 74 Treatments:
1. P-deficient corn-soybean meal basal diet (0.10% pa; 3.8% Ca; 17%
CP) 2. As 1 + 0.10% Pi from KHZPOa 3. As 1 + 150 U/kg r-AppA2 phytase 4. As 1 + 300U/kg r-AppA2 phytase 5. As 1 + 10,000 U/kg r-AppA2 phytase Feed intakel~/h/dl~

R4 94 123 119 115 123__ mean 91 121a 118a 117a 121a Pooled SEM = 2 LSD = 5 ~ Means are average daily feed intakes of hens for the first 4-wk period for treatment 1, and for the entire 12-wk period for treatments 2-5.
Egg Weights lgll R1 57.5 64.0 65.4 65.7 64.5 RZ 63.5 64.7 64.3 66.0 65.5 R3 60.3 64.3 64.6 64.8 65.6 R4 62.8 63.3 62.2 65.3 63.7 mean 61.0 64.1a 64.18 65.Sa 64.8a Pooled SEM = 0.7 LSD = 2.2 1 Means are average egg weights of hens for the first 4-wk period for treatment 1, and for the entire 12-wk period for treatments 2-5.

N ,00v0N N ~

riW~ l~I~l~M
l~l~00M e-d~p W
~

v~co0o p _ rl,O G1M ~O~ ~ CG

r~~ooI~f~I~M .-i y s~ O

d 00d;I~CJ1 ~ N

O ,01I~~ 00~

v-~!W~ l~l~l~~ ~ O C~G1v0M pp ~ .--iM

Q

O ~ O ~ ~ O .~ , l~ooO ~"'~ y , , C~i00I~l~00M
~

O
~ O

d C) o0N ~t ' G--~ ,r,G1I~00'~ M ~ ~''100l0~~ y W
~

U o 00i00l~l~I~~ ~ M 00d'O r--1O~ U O
l~I~ooD\00ppC

o ~
o ~, C

y.~ C
'~ U
it 4r ~ p ~DV~l~ F.
:

yD M ,~N N o G
r U ~ i00GO0000M

o p p ~ --a~ M V v1I~N Ovrl"w i ~ H ~ V'1I~O

D 00000000M O 0000000000~~~ CG O

' "W

o 4r ~ L
~

O ~ ~YM r,t~ O N O C
~'~ v as o coM N O ' W O v~
~' InI00000000M O
O

~

b ~ y 0 .~N O ~ pp'C ~ O.
a\co~ d-00 ~ O M N I~ O ~ GO
~ N ~ ~ ' ' " ' j a ~'NO o00 O M ~ V d V ~ ~GL~ ~ O
~ 0 O O
a .c n c n .9 ;~ ~ ~ do s. ~, 7, T

N

~1 ~~!M O\v0 y .p .. ~ "'"
N N N ts. ~

., ~

Q., [w00.--nM M ~C;
rl ~ x b O ~ ~ pp NO ~WO M N a~N y O p ~ ~

~ N ~nc~00000oM ~II ,~
ru an ~ '" O
r~ N

.i~',~'U ~ ~i.
U

OU ~ ~ ~ O M~'Vl\OV' ~ ~ ~ ~ ~ CGW C~ 1.r O ' Zf ~

O O ~ ~00d'lpN ~ ~"~tn it p 'a.' O

O O e-il~0000CO00M n ~ ~ y ~y .r ~O ~ A

O .~ .--i ,-, ~n N
.--~

~N M 'd'V7(,~

AA A A

~ N M d- v1 N

IN VIVO EFFECTS OF YEAST-EXPRESSED
PHYTASES FED TO FINISHING PIGS
The procedure was as described in Example 8 except finishing pigs (i.e., gilts and barrows) were tested and the basal diet and treatment groups were as follows:
Treatments:

1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHZP04 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Basal diets:
Wei ht ran a k In redient 50-80 80-120 Cornstarch to 100 to 100 Corn 78.42 83.85 Soybean meal, dehulled 18.08 12.65 Limestone, ground 1.06 1.07 Dicalcium phosphate 0.16 --Trace mineral premix 0.35 0.35 Vitamin premix 0.10 0.10 L-Lysine-HCI, feed-grade 0.16 0.11 L-threonine, feed-grade 0.02 --Antibiotic premix 0.75 0.75 Calculated composition (NRC, 1998) Crude protein, % 15.1 13.0 Lysine, total % 0.88 0.69 Calcium, % 0.50 0.45 Phosphorus, total % 0.38 0.32 Phosphorus, estimated bioavailable,0.09 0.05 %

ME, kcal/kg 3293 3295 The following tables are labeled as described in Example 8 and some of the responses described in Example 8 were measured. Gain/feed ratio is shown rather than a feed/gain ratio.
The results show that AppA2 was as effective as phosphate at increasing bone mass and mineral content, and at improving the gain/feed ratio.

Treatments:
1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHZP04 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Initial pig weights (kg) Barrows Gilts R1 52.2 52.853.051.852.051.8 51.250.852.2 52.251.352.4 R2 51.0 51.151.750.351.650.4 49.649.650.3 50.050.450.8 R3 48.2 49.649.849.650.149.2 48.149.647.9 47.148.848.4 R4 46.4 46.546.546.947.447.9 45.945.444.3 46.646.545.7 RS 52.0 44.151.052.446.450.7 43.443.944.0 43.144.144.0 mean50.0 48.850.450.249.550.0 47.647.947.7 47.848.248.3 Pooled SEM = 0.4 Phase-switch pig weights (kg) Barrows Gilts R1 78.8 83.085.076.079.679.2 79.780.188.6 84.183.189.6 R2 76.8 80.686.979.982.283.8 80.083.587.7 84.587.383.5 R3 73.7 79.877.179.179.075.9 77.177.681.3 79.982.682.4 R4 82.3 82.579.279.184.484.5 74.778.173.9 84.678.979.1 RS 84.5 78.584.783.285.385.2 83.380.584.4 87.281.782.5 mean79.2 80.982.679.582.181.7 78.979.983.2 83.482.783.4 Pooled SEM = 0.8 Final pig weights (kg) Barrows Gilts R1 111.3121.2121.9115.9112.9111.1105.9109.5119.9116.1105.4130.1 R2 111.5119.6132.7111.9121.3116.3105.8115.6118.3115.3123.3112.5 R3 115.9126.4117.1119.9114.0120.7104.9107.9123.6125.2127.1130.8 R4 116.6117.9110.0110.0119.7122.1120.2121.6117.9127.7109.3123.0 RS 118.3111.6122.3114.2123.0117.1115.2110.4119.2135.1119.1117.1 mean114.7119.3120.8114.4118.2117.5110.3113.0119.8123.9116.8122.7 Pooled SEM = 3.0 (Sex x Diet, P<0.10) Contrasts: Sex x Pi (2) vs Phytase (3-6), P<0.05.

Treatments:
1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHzP04 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Weight gain, initial-switch (g/d) Barrows Gi lts mean990 1094110710011103 1079857 882 974 976 950 968 Pooled SEM = 0.24 Contrasts: Barrows (Ba) vs Gilts (Gi), P<0.01; 1 vs 2-6, P<0.01 Weight gain, switch-final(g/d) Barrows Gilts mean896 972 968 881 918 901 673 723 790 857 734 853 Pooled SEM = 37 Contrasts: Ba vs Gi, P< 0.05 Weight gain, overall (g/d) Barrows Gi lts mean935 10231023929 993 974 752 790 872 909 828 902 Pooled SEM = 38 (Sex x diet, P<0.10) Contrasts: Sex x Pi (2) vs Phytase (3-6), P<0.05 Treatments:
1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHZP04 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Feed intake. initial-switch (g/dl Barrows Gilts mean25052496 262823522551 2371216519272337 218921072146 ~ ~ ~ ~ ~

Pooled SEM = 67 Contrasts: Ba vs Gi, P<0.01 Feed intake. switch-final (Q/dl Barrows Gilts Rl 31813427 355932702962 2918244326152890 265120943739 mean30823140 333229823126 2926248224142755 275425872895~
~

Pooled SEM =105 Contrasts: Ba vs Gi, P< 0.01 Feed intake, overall (~/dl Barrows Gilts mean28372861 302827122873 268423472197 2571250723782562 Pooled SEM = 81 Contrasts: Ba vs GI, P<0.01 Treatments:
1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHZPO4 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Gain/feed, initial-switch (g/kg) Barrows G ilts mean397 438 420 425 433 458 397 474 418 446 461 454 Pooled SEM =12 Contrasts: 1 vs. 2-6, P<0.01; 3 vs 4-6, P<0.10 Gain/feed, switch-final (g/d) Barrows Gilts _ _ __ mean291 310 291 296 293 310 269 298 289 312 _ 293 ~ ~ ~ 283 ~

Pooled SEM = 8 Gain/feed overall (g/d) Barrows lts Gi mean331 358 338 343 346 365 320 363 _ 363 __ 352 . j 341 ~ _ ( 349 ~

Pooled SEM = 8 Contrasts: 1 vs 2-6, P<0.01 Treatments:
1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHZP04 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Fibula Dry Weight (g) Barrows Gilts Rl 8.1810.9011.4512.1110.0812.087.5410.959.92 9.429.87 11.29 R2 8.8411.748.6610.9811.2111.667.968.81 9.33 11.4110.7012.73 R3 8.5411.299.8111.9010.1012.778.6210.259.94 10.5011.8612.46 R4 9.8210.699.0610.2211.0512.408.2611.619.67 10.9210.9110.49 RS 7.888.88 10.3310.5112.0111.267.689.51 11.1611.4810.1011.44 mean8.6510.709.8611.1410.8912.038.0110.2310.0010.7510.6911.68 Pooled SEM = 0.27 Contrasts: 1 vs 2-6, P<0.01; 3 vs 4-6, P<0.01 Fibula Ash Weight (g) Barrows Gilts R1 4.376.32 6.346.906.03 6.944.066.425.21 5.335.616.78 R2 4.267.05 5.126.496.24 6.804.365.185.51 6.256.217.16 R3 4.516.54 5.787.175.81 7.494.355.916.11 5.796.937.23 R4 5.346.35 5.195.906.73 7.334.287.135.66 6.356.566.22 R5 4.375.22 6.026.347.06 6.643.915.647.02 6.255.886.93 mean4.576.30 5.696.566.37 7.044.196.065.90 5.996.246.86 Pooled SEM = 0.17 Contrasts: Ba vs Gi, P< 0.10; 1 vs 2-6, P<0.01; 3 vs 4-6, P<0.01; 4 vs 5-6, P<0.10;
5 vs 6, P<0.01 Fibula Ash Percent (%) Barrows lts Gi R1 53.4257.9855.3756.9859.8257.4553.8558.6352.5256.5856.8460.05 R2 48.1960.0559.1259.1155.6658.3254.7758.8059.0654.7858.0456.25 R3 52.8157.9358.9260.2557.5258.6550.4657.6661.4755.1458.4358.03 R4 54.3859.4057.2857.7360.9059.1151.8261.4158.5358.1560.1359.29 RS 55.4658.7858.2860.3258.7858.9750.9159.3162.9054.4458.2260.58 mean52.8558.8357.7958.8858.5458.5052.3659.1658.9055.8258.3358.84 Pooled SEM = 0.65 Contrasts: 1 vs 2-6, P<0.01 Treatments:
1. P-deficient corn-soybean meal basal diet 2. As 1 + 0.10% Pi from KHZP04 3. As 1 + 250 FTU/kg r-AppA2 phytase 4. As 1 + 500 FTU/kg r-AppA2 phytase 5. As 1 + 1,000 FTU/kg r-AppA2 phytase 6. As 1 + 10,000 FTU/kg r-AppA2 phytase Metatarsal Drv Weight (~) Barrows Gilts R1 11.4214.0315.8415.3614.4313.8511.7715.9016.0015.4812.6515.05 R2 11.8914.5213.2714.2613.7315.0611.6613.7414.1414.1913.7514.87 R3 14.0114.4513.2013.9914.9117.4310.5212.2011.9516.3117.5317.13 R4 12.2514.3812.5415.9915.2617.0111.6813.4913.1614.2012.7714.23 R5 12.5513.3014.3014.3617.7914.2911.2612.7612.4716.9312.7813.10 mean12.4214.1413.8314.7915.2215.5311.3813.6213.5415.4213.9014.88 ~ ~ ~ ~ ~ ~

Pooled SEM = 0.44 Contrasts: 1 vs 2-6, P<0.01; 3 vs 4-6, P<0.05 Metatarsal Ash Weisht (s) Barrows Gilts R1 5.286.59 7.976.936.74 6.864.747.216.727.09 6.077.50 R2 6.817.10 5.946.746.32 7.444.846.286.406.55 6.717.07 R3 4.826.95 6.416.776.72 7.884.825.596.676.99 8.138.11 R4 4.836.81 6.267.737.88 7.484.867.275.927.15 6.977.13 R5 5.205.75 7.226.998.33 7.145.246.616.657.07 6.046.55 mean5.396.64 6.767.037.20 7.364.906.596.476.97 6.787.27 ~ ~ ~ ~

Pooled SEM = 0.18 Contrasts: 1 vs 2-6, P<0.01; 3 vs 4-6, P<0.05 Metatarsal Ash Percent (%) Barrows lts Gi R1 46.2546.9950.3145.1546.7549.5640.2245.3742.0145.8047.9649.84 R2 39.9048.9044.7547.1646.0249.3941.5045.7245.2746.1848.8047.55 R3 34.3848.1248.5948.3645.0945.1845.8445.7855.8442.8746.3947.35 R4 39.4447.2749.8948.3651.6543.9841.6353.9344.9750.3254.5950.11 R5 41.4443.2650.5048.6946.8149.9546.5051.8253.3341.74_47.2850.00 mean40.2846.9148.8147.5447.2647.6143.1448.5248.2845.3849.0048.97 Pooled SEM =1.05 Contrasts: 1 vs 2-6, P<0.01 IN VIVO EFFECTS OF YEAST-EXPRESSED PHYTASES FED TO PIGS
The procedure was as described in Example 8 except that the treatment groups were as follows:
28-da ~period 1. Basal - .08% available phosphorus 2. Basal + .OS phosphorus from monosodium phosphate 3. Basal + .10 phosphorus from monosodium phosphate 4. Basal + .1 S phosphorus from monosodium phosphate 5. Basal + 250 FTU/kg experimental phytase product 6. Basal + S00 FTU/kg experimental phytase product 7. Basal + 1,000 FTU/kg experimental phytase product 8. Basal + 2,000 FTU/kg experimental phytase product 9. Basal + Natuphos~ 500 FTU/kg The results are shown in the following table. The results show that AppA2 increases bone mass and mineral content and improves the gain/feed ratio as effectively as phosphate.

--~ l~ N M ct tzl l~ M M

0 0 0 0 0o O .-r .~

va o 0 0 0 o v o o w on CL U
N ~ 01 O ~ d' l~ l~

o d v oo ~; ~- oo ~t .~ "' ~n PaO O O O M M .--I +, O

H
~

_ O O~ v7 l~ l~ ~ O" >, i~ ~ ~' O d; 00 ~ 01 N ~ U
M ~O

N O O O O ~t ~O ~
N ~

.y cc3 U
N

w ~ Qr y' U
a~ w ~

O ,~ (~
I~ M I~ in ~

O ~t oo vI~CO ~ O U
M o0 ~

O O O O ~ ~n .~

4~
w w .$"-i a _ DO on N
N O ' ~ N N

\ o M N N
I~ ~n l~
N vD

~ ~ ~
d;

~n O O O O M M .~ , 0 O

bD

w w ~ 0 N
l O
O

~

~
-c N
n t~ ~ ~n M N
v0 ~

O

",-. O

'O 'D U b U CJ O
OWn oo Co ~ I 'a.:., N l~ U

p~ ~t oo ~n oo ~ ai 'b ~ c ; o~ N

O O O O O d' i ~ U ~~ O
--n 'b p" v~ vy O ~
j C~ w H _ _ U x ~ O p.., O ~O l~ I~ 00 ~ ~

0 0 0 0 o M I ~ ~ , o o '~ ~

~, o O ~;

~

s.. N '.~, .. ~ O O
U c t N ~-U cd x ~1. a~ t . ~ U c ~ ~:, ~
~n w o na an nn ca "" . .
on ~ U v~ ~_ O~ V7 M ~ O I
N d' O M l~ U1 ~O ~ ; O., ~,.,.rte, O
O~ M N O U

O O O O O M I O O ~
p O Y

~b Q>7 U7.~., CD w w t t M oO ~ ~ ~ ~1 ~
G C~ ~ ~

. p ~ r.U,,_ ~ ~ ~ vp ~ 00 ~ ~ p N I~

O O ~ U
M l ~ , ~

O O O O O M ~ ~ ,~ ~ O _~ ~
0 0 ~

P..U O O. ~ V
~ N

,0 '~ N,~.~O ~~.a'>,O

Q ~ o ~

i ~ on ~
~

~

_ o~

c'p p"' o~ o~u.w.~v u. .'bn ~s 3 0 _ ~ a. v~
x ~ as ~ .~ a, o a ~ a~
'-~ =~ ~ o ~ : ~ ~ ~ ,~ c~ ~n _GO ~

~ app ~ O ' ~

>1N ~ ~ ~ ~. a t7 ~' x ~n ~n ~ N ~
cC a5 ~p U w +
'-G ~

. , ~ v~
cue.c~ b-0 b w cG cC c~ G , rn ~ c~ ~ N ~ ~ N ~ ~
~n N

Q
~
c~

, ~ ~~~~
.

,?~a" ~ ~ ww~ ~v~~ ~ ~,w ., ~~ ~
~w ~ a Q ~' a ~ ~
~
~' wd ~1 ~..o ~ .
.

IN VIVO EFFECTS OF YEAST-EXPRESSED
PHYTASES FED TO CHICKS AND PIGS
The procedure for the studies summarized in the following tables was as described in Example 8. The treatment groups are shown in each table and the basal diet compositions are shown in the following table (see next page). The results show that AppA2 (ECP) is as effective as phosphate in improving the gain/feed ratio and in increasing bone mass and mineral content. The results also show that AppA2 is more effective than Natuphos~ and Ronozyme~ at increasing bioavailable phosphate. Furthermore, the results show that AppA2 increases egg weight and egg production in laying hens as effectively as phosphate.

Percentage composition of diets (as-fed basis).
Finishingpi~
assay Chick Young pig 50-80 80-120 Laying Ingredient assays assay kg kg hen assay Cornstarch to 100 to 100 to 100 to 100 -Corn 50.89 60.85 78.42 83.85 63.65 Soybean meal, dehulled39.69 31.19 18.08 12.65 25.65 Soybean oil 5.00 3.00 - - -Limestone, ground 1.67 1.06 1.06 1.07 9.80 Salt 0.40 - - - 0.40 Dicalcium phosphate - - 0.16 - -Trace mineral premix0.15a 0.35b 0.35b 0.35b 0.20a Vitamin premix 0.20' 0.204 O.lOa O.lOd 0.15' Choline Chloride 0.20 - - - 0.05 (60%) Antibiotic premix 0.05e I.OOf 0.758 0.758 -Copper sulfate - 0.08 - - -L-Lysine HCI, feed - 0.17 0.16 0.11 -grade L-Threonine, feed - - 0.02 - -grade DL-Methionine, feed 0.20 0.05 - - 0.10 grade Chemical composition Crude protein, °/ h 22.6 20.8 15.1 13.0 17.0 Total phosphorus, °/h 0.42 0.35 0.38 0.32 0.34 Available phosphorus, %' 0.10 0.075 0.09 0.05 0.07 Calcium, %' 0.75 0.60 0.50 0.45 3.8 ME, kcal/kg' 3123 3387 3293 3295 2758 aSupplied the following per kilogram of complete diet: Fe, 75mg (FeSOaHzO);
Zn, 100mg (Zn0); Mn, 75mg (Mn0); Cu, 8 mg (CuSOaHzO); I, 0.35 mg (CaIz); Se, 0.3 mg (NazSe03);
NaCL, 3 g.
bSupplied the following per kilogram of complete diet: Fe, 90 mg (FeS04H20);
Zn, 100 mg (Zn0); Mn, 20 mg (Mn0); Cu, 8 mg (CuS04H20); I, 0.35 mg (CaIz); Se,Ø3 mg (NazSe03);
NaCI, 3 g.
Supplied the following per kilogram of complete diet: retinyl acetate, 1,514 ~,g;
cholecalciferol, 25 ~.g; DL-a tocopheryl acetate, 11 mg; menadione sodium bisulfate complex, 2.3 mg; niacin, 22 mg; D-Ca-pantothenate, 10 mg; riboflavin, 4.4 mg;
vitamin Biz, 11 ~,g.
dSupplied the following per kilogram of complete diet; retinyl acetate, 2,273 ~.g;
cholecalciferol, 16.5 pg; DL-a-tocopheryl acetate, 88 mg; menadione, 4.4 mg (menadione sodium bisulfate complex); niacin, 33 mg; D-Ca-pantothenate, 24.2 mg;
riboflavin, 8.8 mg;
vitamin Biz, 35 p,g; choline chloride, 319 mg.
eProvided 50mg of bacitracin per kilogram of complete diet.
(Provided 55 mg of mecadox per kilogram of complete diet.
gProvided 38 mg of roxarsone per kilogram of complete diet.
hAnalyzed (AOAC, 1999).
'Calculated (NRC, 1994; NRC, 1998).

Assessment of relative phosphorus bioavailability in chicks as affected by two different phytase enzymes (Chick assay 1)a.
Weight Gain/feed,Tibia Bioavailable ash Diet gain, g/kg % mg P, g 1. Basal diet 259e 617 28.1 264 -2. As 1 + 0.05% P; (KHZP04)290 654 32.2 311 -a 3. As 1 + 0.10% P; (KHZP04)323 639 36.4 414 -4. As 1 + 500 FTU/kg 289 666 30.0 293' 0.027 Natu hos~

5. As 1 + 500 FTU/kg 346 656 37.8 448 0.124 ECP

Pooled SEM 6 10 0.5 10 0.006 aValues are means of five pens of four male chicks fed the experimental diets during the period 8 to 22 d post-hatching; average initial weight was 91 g.
bThe linear regression of tibia ash (mg) for Diets 1 to 3 as a function of supplemental P intake (g) was Y = 257.1 f 9.8 + 299.0 ~ 30.7X (rz = 0.88); Bioavailable P
concentrations (equivalent P yields) for Diets 4 and 5 were determined by calculating equivalent bioavailable P intake (g) from the standard curve, dividing that by the feed intake (g), and multiplying by 100.
',a,e,fMeans within a column with different superscripts are different, P
<0.05.

Relative phosphorus bioavailability in chicks fed different phytase enzymes (Chick assay 2)a.
Weight Gain/feed,Tibi a ash Bioavailable Diet gain, g/kg % mg P, g 1. Basal diet 176 569 24.9 183 -' ' ' ' 2. As 1 + 0.05% P; (KHZPOa)253 680 30.0 272 -' 3. As 1 + 0.10% P; (KHZP04)293 703 34.38 3478 -g 4. As 1 + 0.15% P; (KHzP04)333 73 le 37.3e 455e -5. As 1 + 500 FTU/kg Natuphos~'218' 620' 27.2' 224' 0.0268 6. As 1 + 500 FTU/kg Natuphos~236'' 632' 27.5''236'' 0.032 ~

7. As 1 + 1,000 FTU/kg 265' 6758 28.9 262 0.048 Natuphos~ ' ' 8. As 1 + 500 FTU/kg Ronozyme~219' 634' 26.9' 223' 0.0288 9. As 1 + 1,000 FTU/kg 245' 6828 27.5''242 0.038 Ronozyme~ '' g 10. As 1 + 500 FTU/kg ECP 318e 708 36.5e 409 0.125e ~

Pooled SEM 7 10 0.6 12 0.006 aValues are means of five pens of four male chicks fed the experimental diets during the period 8 to 22 d posthatching; average initial weight was 83 g.
bThe linear regression of tibia ash (mg) for Diets 1 to 4 as a function of supplemental P intake (g) was Y = 187.9 t 8.7 + 393.4 ~ 21.2X (r2 = 0.95); Bioavailable P
concentrations (equivalent P yields) for Diets 4-11 were determined by calculating equivalent bioavailable P
intake (g) from the standard curve, dividing that by the feed intake (g) of the pen, and multiplying by 100.
°Enzyme was from the same batch that was used for chick assay 1.
dEnzyme was from a different batch that was used for chick assay 1.
e,e,g,n.~,~,kMeans within a column with different superscripts are different, P <0.05.

The effect of activity level on the phosphorus-releasing efficacy of E. coli phytase in chicks (Chick assay 3)a.
Weight Gain/feed,Tibia Bioavailable ash Diet gain, g/kg mg P, /b g 1. Basal diet 219' 661 237' -2. As 1 + 0.05% P; (KHzP04)283 g 692 299 -3. As 1 + 0.10% P; (KHZPOa)314 720' 4138 -4. As 1 + 0.15% P; (KH2P04)327 731 490e 5. As 1 + 500 FTU/kg ECP 321 ~ 731 447 0.125 6. As 1 + 1,000 FTU/kg 335' 732' 559 0.183 ECP

7. As 1 + 1,500 FTU/kg 344' 737 616' 0.211 ECP

8. As 1 + 500 FTU/kg Natuphos~2768 691 290 0.037 Pooled SEM 6 10 12 0.005 aValues are means of five pens of four male chicks fed the experimental diets during the period 8 to 22 d post-hatching; average initial weight was 97 g.
bThe linear regression of tibia ash (mg) for Diets 1 to 4 as a function of supplemental P intake (g) was Y = 232.0 t 6.9 + 389.9 ~ 16.7X (rz = 0.97); Bioavailable P
concentrations (equivalent P yields) for Diets 5 to 8 were determined by calculating equivalent bioavailable P intake (g) from the standard curve, dividing that by the feed intake (g) of the pen, and multiplying by 100.
~,a,e,fg,n.~Means within a column with different superscripts are different, P
<0.05.

Combining 3- and 6-phytases does not produce synergistic effects on Pi-release in chicks fed a corn-soybean meal diet(Chick assay 4)a.
Weight Gain/feed,Tibi a ash Bioavailable Diet gain, g/kg % mg P, %b g 1. Basal diet 1378 6108 25.48 134 -2. As 1 + 0.05% P; (KHzP04)191e 678 29.0 198 -~

3. As 1 + 0.10% P; (KHZP04)225 712 32.8e 253e -4. As 1 + 0.15% P; (KHZP04276 762 36.3 339 -5. As 1 + 500 FTU/kg Natuphos~192e 624 28.0 1878 0.041K
g 6. As 1 + 500 FTU/kg Ronozyme~182 655 27.7 1888 0.047 g 7. As 1 + 500 FTU/kg ECP 272 760 37.0 343 0.153 8. As 5 + 6 211 693 28.3 212 0.064e a a ~

9. As 5 + 7 282 763 37.8 360d 0.162 10. As 1 + 1,000 FTU/k 217 703 29.0 217 0.067' Natuphos~

11. As 1 + 1,000 FTU/kg 201 666e 27.9 194 0.050e Ronozyme~ a ~ g 12. As 1 + 1,000 FTU/kg 292 758' 41.1 433' 0.206 ECP

Pooled SEM 9 15 0.6 10 0.007 aValues are means of five pens of four male chicks fed the experimental diets during the period 8 to 22 d post-hatching; average initial weight was 68 g.
bThe linear regression of tibia ash (mg) for Diets 1 to 4 as a function of supplemental P intake (g) was Y = 138.6 ~ 4.9 + 371.3 t 14.7X (rz = 0.97); Bioavailable P
concentrations (equivalent P yields) for Diets 5 to 8 were determined by calculating equivalent bioavailable P intake (g) from the standard curve, dividing that by the feed intake (g) of the pen, and multiplying by 100.
~,a,e,fgMeans within a column with different superscripts are different, P
<0.05.

Effect of E. coli phytase on performance of laying hens from week 1-4.0 Egg Egg Diet Initial 4-wk Feed production,weight, hen hen intake, orb g wei t, wei t, d g 1. P-deficient basal 1716 1593 90 54.0 61.0 diet 2. As 1+ 0.10% Pi 1725 1748 122 84.8 64.2 3. As 1 + 150 FTU/k 1733 1771 119 83.7 63.8 ECP

4. As 1 + 300 FTU/kg 1798 1806 119 82.3 65.4 ECP

5. As 1 + 10,000 FTU/k1746 1770 123 85.9 65.1 ECP

Pooled SEM 26 21 2' 1.6 0.7 OData are means of four replicates of 12 hens for the first 4 weeks of the study period.
bEgg production (%) analyzed using covariance; data presented are least-squares means.
Diet 1 vs diets 2-5, P <0.01.
Effect of E. coli phytase on performance of laying hens from week 5-120.
Egg Egg 4-wk hen Feed production, weight, Diet weight, g intake, g/d °~b g 2. As 1+ 0.10% Pi 1830 120 80.5 64.0 3. As 1 + 150 FTU/kg ECP 1796 118 80.6 64.1 4. As 1 + 300 FTU/kg ECP 1833 116 77.2 65.5 5. As 1 + 10,000 FTU/kg ECP 1830 120 81.2 64.8 Pooled SEM 24 2 2.5 0.5' OData are means of four replicates of 12 hens for weeks 5 through 12 of the study period.
Diet 1 was removed from study due to poor egg production.
bEgg production (%) analyzed using covariance; data presented are least-squares means.
'Diet 3 vs diets 4 and 5, P <0.01.
Effect of E. coli phytase on performance of laying hens from week 1-120.
Hen Feed Egg Egg weights intake,production,weight, Diet Initial4-wk 12-wk g/d ~~b g 1. P-deficient basal 1716 1593 - 90 53.8 61.0 diet 2. As 1 + 0.10% PI 1725 1748 1830 121 81.2 64.1 3. As 1 + 150 FTU/k ECP 1733 1771 1796 118 80.7 64.1 4. As 1 + 300 FTU/k ECP 1798 1806 1833 117 77.8 65.5 5. As 1 + 10,000 FTU/k 1746 1770 1830 121 82.9 64.8 ECP

Pooled SEM 26 21~ 24 2' 2.1' 0.7' OData are means of four replicates of 12 hens. Data are means for the first 4 weeks for diet 1, but for all 12 weeks for diets 2-5.
bEgg production (%) analyzed using covariance; data presented are least-squares means.
'Diet 1 vs diets 2-5, P <0.01.

Relative bioavailability of phosphorus in young pigs fed different phrase enzymes (Pig assay 1).
Weight Gain/feed,Fibula Bioavailable ash Diet gain, g/kga % mg P, %' g/da 1. Basal diet 3_69 533 29.3 666' -2. As 1 + 0.05% P; (KHzP04)435e 576e 32.8 766 ' 3. As 1 + 0.10% P; (KHZP04)476 a 618 a 36.6 972e -4. As 1 + 0.15% P; KHZPO4)509 660 36.6 1123 -5. AS 1 + 400 FTU/kg 460' 605 a 34.4 889 0.081 Natu hos~ a ~

6. As 1 + 400 FTU/kg 445e 565e 33.Se 8058 0.043 Ronozyme~

7. As 1 + 400 FTU/kg 443e 583e 35.0 968e 0.108 ECP a Pooled SEM 17 21 0.8 38 0.016 aData are means of 10 individually-fed pigs over a 23-d feeding period;
average initial weight was 8.4 kg.
bData are means of five individually-fed pigs, chosen from the median-weight blocks at the end of the 23-d feeding period.
°The linear regression of fibula ash (mg) for Diets 1 to 4 as a function of supplemental P
intake (g) was Y = 664.5 ~ 25.5 + 15.3 t 1.4X (rz = 0.87); Bioavailable P
concentrations (equivalent P yields) for Diets 5-7 were determined by calculating equivalent bioavailable P
intake (g) from the standard curve, dividing that by the feed intake (g) of the pig, and multiplying by 100.
d,e,r,g.n,~Means within a column with different superscripts are different, P
<0.05.

co ~ G, M
o W
o t"
o ~

o U ~

0W ~O m o N
o~

N ~ M M M

N

~r dw N O

O
p.., O
o M o0 o M oo I mo c~ t~
W

bD "~,G\ ~ l~ I~ N d' d' d' N

N M M M

N N

v~ ~' O
'W

Y

d ' w ~ a'' o o S-a G, O~ N l~ O M M M

~ N O ~ O ~ ~t ~J ~n d1 G1 I~ V7 \O M M M U

O ~ ~ N N N ;.d ~

i~ O

~O

P~

O

U
~ ~
~

N M N l 00 .~ O oo ,.~ G1 . .
W ~ ' r, N l~ ~ N l~ O M V M O

-I-O 00 G1 O N N M M M ~ ,-d ~

U

N

w o ~ -~
o a~ se ~ v M O l~ ,- f~ 01 00 M .-~V aj P-~

i . \ N G1 O v0 Ov N ~n ~J ~O ~ v ""' ~

0 0 1~ ov co .-~ ~n M M M ,., j O ,~ N N N b .

O ~ ~

U O , ~n ~
"~

bD w O

O b Q., ~

U w >C

4~ ~ _ Y

U v1 ~' I~ I~ N ~ O ~n ~ ~
;.dN ' ' U

M ~1 ~ M d G~ M N N v~

01 00 00 M V1 M M M .~
l~

N N N .
,-, rn ' Q, ~ '-o V

G~.
o p , y o ~

a y . .~
P.
'~

U _ O ' Op JaD x ~ ~"
~
~

N w cn G0 ~n _ ~ Y

_y I~ ~ -' N

.~ O O ~ O

O
(~

O

P~

V1 l~ O 00 G1 ~ ~O M ~ M
GO O M

o o0 0o t~ W o ~ oo t~
U 00 o, t~

o ~n n ~ ~t W ~m v a~

+
x d~

N

by w 3 -U

W ~ ~t ,~ >, ' V ~ M N M M ~ N O

M

+ 00 ~ ~O ~O ~O ~ I~ l~ .fl '~ 00 ~O

~' ~ G(7 a.p y . ~o c~
~ U

'n ~ a\ 00 00 W

+ ~ M v7 Ov N vo U1 O O ~' ~ ~ ~ O

O s~-~'.-, 00 ~O N ~O ~ ~ t~ t~
~ ~ t~

v~ .,~cn ~' O
~

4~

.y Y

b U

V + 00 M ~D 01 O 00 W o0 ~O ~,' ~ Ov O M v) 00 00 ~n vi 'n ~ y p vp ~ vp ,n d b + o vo 00 ~ o0 0.' Q. ~, CO O M O ~ OWn t~ ~O ~O v~ V
o N ~O

:" 00 Q WD v0 v0 ~O t1 ~D v0 ~ P-~ O
Ov o0 ~O

V1 ~!1 d' d' U r V1 ~' V ~ ~ O O

O
W ~ 'L~ OV
P-r 4"~ ~ b P.
N

v7 ~ O

O
J
U

4~ r... ~ ~
~ '-' 'C7 ~ w ~ ~ a.
~' A..

W ' G1 ~O ~ o, oo M I~ ~ ,~ ~, U ~ ~ .-. M .~ d1 ~

io N N ~' ~i' d' O ~ ~n ~ ~ ~' ~' N M ~ ~ cd rn V7 ~!1 V' ~ ~ ~n '.
V1 ~t 'C) N V
O .r Q, v~ ~ O
O, y N O
~

. O cC
O
~r O
w ~ V ~
~ o a~ '~ w "o ~ ,~
o ~ ~, ~
~ o ,-.

N ~
N C~ C~
~ V7 3 ~3 ~ 3 ~ 3 .a-~~aoon~
~

o ~so ~ o ~ ~ o ~ ~ o o .
~.

w o ~ ~
o ~ ~ C~l ~ ~ ~ G ~ ~ ~ ~ ~ ' ~
C7 C7 n C7 , u~. 0 l~

i:~ w ~ ~ ~~, ~~

834460-71726.txt SEQUENCE LISTING
<110> Phytex, L.L.C.
webel, Douglas M.
Orr, Donald E.
Ruch, Frank E.
<120> PHYTASE-CONTAINING ANIMAL FOOD AND METHOD
<130> 834460-71726 <150> uS 60/335,303 <151> 2001-10-31 <160> 14 <170> Patentln version 3.1 <210> 1 <211> 1489 <212> DNA
<213> Escherichia coli <220>
<221> primer_bind <222> (1)..(22) <223>
<220>
<221> primer_bind <222> (1468)..(1489) <223>

834460-71726.txt <220>
<221> CDS
<222> (16)..(108) <223>
<220>
<221> CDS
<222> (182)..(1480) <223>
<400> 1 taaggagcag atgtgg tatttcctttgg ttcgtcggc attttgttg 51 aaaca MetTrp TyrPheLeuTrp PheValG1y IleLeuLeu atgtgttcgctc tccacc cttgt9ttggta tggctggac ccgcgattg 99 MetCysSerLeu SerThr LeuValLeuVal TrpLeuAsp ProArgLeu aaaagttaacgaacgtaag ctgatccgg tcgatcaggc 148 c cgcattagcg Lysser aataatatcg gaaacatatcgatg aaagcgatc tta cca 202 gatatcaaag atc cg Met LysAlaIle LeuIlePro tttttatctctt ttgatt ccgttaaccccg caatctgca ttcgetcag 250 PheLeuSerLeu LeuIle ProLeuThrPro GlnSerAla PheAlaGln agtgagccggag ctgaag ctggaaagtgtg gtgattgtc agccgtcat 298 SerGluProGlu LeuLys LeuGluSerVa1 Va1IleVal SerArgHis ggtgtgcgtgcc ccaacc aaggccacgcaa ctgatgcag gatgtcacc 346 G1yVa1ArgAla ProThr LysAlaThrGln LeuMetGln AspValThr ccagacgcatgg ccaacc tggccggtaaaa ctgggttgg ctgacacca 394 ProAspAlaTrp ProThr TrpProValLys LeuG1yTrp LeuThrPro cgcggtggtgag ctaatc gcctatctcgga cattaccaa cgccagcgt 442 ArgG1yG1yGlu LeuIle AlaTyrLeuG1y HisTyrGln ArgGlnArg ctggtggccgac ggattg ctggcgaaaaag ggctgcccg cagcctggt 490 LeuVa1AlaAsp G1yLeu LeuAlaLysLys G1yCysPro GlnProG~Iy 834460-71726.txt caggtcgcgatt attgetgat gtcgacgagcgt acccgtaaa acag9c 538 GlnValAlaIle IleAlaAsp ValAspGluArg ThrArgLys ThrGly gaagccttcgcc gccg9gctg gcacctgactgt gcaataacc gtacat 586 GluAlaPheAla AlaGlyLeu AlaProAspCys AlaIleThr ValHis acccaggcagat acgtccagt cccgatccgtta tttaatcct ctaaaa 634 ThrGlnAlaAsp ThrSerSer ProAspProLeu PheAsnPro LeuLys actg9cgtttgc caactggat aacgcgaacgt actgacgcg atcctc 682 ~

ThrGlyValCys GlnLeuAsp AsnAlaAsnVa ThrAspAla IleLeu agcagggcag9a g9gtcaatt getgactttacc g9gcatcgg caaacg 730 l h h l i l h SerArgAlaGly GlySerIle A AspP T y H Arg G T
a e r G s n r gcgtttcgcgaa ctggaacgg gtgcttaatttt tcccaatta aacttg 778 AlaPheArgGlu LeuGluArg ValLeuAsnPhe SerGlnLeu AsnLeu tgccttaaccgt gagaaacag gacgaaagctgt tcattaacg caggca 826 CysLeuAsnArg GluLysGln AspGluSerCys SerLeuThr GlnAla ttaccatcggaa ctcaaggt9 agcgccgacaat gtttcatta accg9t 874 LeuProSerGlu LeuLysVal SerAlaAspAsn ValSerLeu ThrGly gcggtaagcctc gcatcaatg ctgacggaaata tttctcctg caacaa 922 AlaValSerLeu AlaSerMet LeuThrGluIle PheLeuLeu GlnGln gcacagggaatg ccggagccg gggtggggaagg atcactgat tcacac 970 AlaGlnGlyMet ProGluPro GlyTrpGlyArg IleThrAsp SerHis cagtggaacacc ttgctaagt ttgcataacgcg caattttat ttacta 1018 GlnTrpAsnThr LeuLeuSer LeuHisAsnAla GlnPheTyr LeuLeu caacgcacgcca gaggttgcc cgcagtcgcgcc accccgtta ttggat 1066 GlnArgThrPro GluValAla ArgSerArgAla ThrProLeu LeuAsp ttgatcatggca gcgttgacg ccccatccaccg caaaaacag gcgtat 1114 LeuIleMetAla AlaLeuThr ProHisProPro GlnLysGln AlaTyr gt gtgacatta cccacttca gtgctgtttatt gccggacac gatact 1162 G Va1ThrLeu ProThrSer Va1LeuPheIle AlaG1yHis AspThr 1y 345 350 355 .

aatctggcaaat ctcg9cg9c gcactggagctc aactggacg cttcca 1210 AsnLeuAlaAsn LeuGlyGly AlaLeuGluLeu AsnTrpThr LeuPro ggtcagccggat aacacgccg ccaggtggtgaa ctggtgttt gaacgc 1258 GlyGlnProAsp AsnThrPro ProG1yG1yGlu LeuVa1Phe GluArg 834460-71726.txt tggcgtcggctaagc gataac agccagtggatt caggtttcg ctggtc 1306 TrpArgArgLeuSer AspAsn SerGlnTrpIle GlnValSer LeuVal ttccagactttacag cagatg cgtgataaaacg ccgctatca ttaaat 1354 PheGlnThrLeuGln GlnMet ArgAspLysThr ProLeuSer LeuAsn acgccgcccggagag gtgaaa ctgaccctggca ggatgtgaa gagcga 1402 ThrProProG1yGlu Va1Lys LeuThrLeuAla G1yCysGlu GluArg aatgcgcagggcatg tgttcg ttggccggtttt acgcaaatc gtgaat 1450 AsnAlaGlnG1yMet CysSer LeuAlaG1yPhe ThrGlnIle Va1Asn gaagcgcgcataccg gcgtgc agtttgtaatggtacccc 1489 GluAlaArgIlePro AlaCys SerLeu <210> 2 <211> 30 <212> PRT
<213> Escherichia coli <400> 2 Met Trp Tyr Phe Leu Trp Phe Val Gly Ile Leu Leu Met Cys Ser Leu Ser Thr Leu Val Leu Val Trp Leu Asp Pro Arg Leu Lys Ser <210> 3 <211> 432 <212> PRT
<213> Escherichia coli <400> 3 Met Lys Ala Ile Leu Ile Pro Phe Leu Ser Leu Leu Ile Pro Leu Thr Pro Gln Ser Ala Phe Ala Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser 834460-71726.txt Val Val Ile Val Ser Arg His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Pro Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Ser Gln Leu Asn Leu Cys Leu Asn Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu Gln Arg Thr Pro Glu Val Ala Arg Ser 834460-71726.txt Arg Ala Thr Pro Leu Leu Asp Leu Ile Met Ala Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu <210> 4 <211> 1486 <212> DNA
<213> Escherichia coli <220>
<221> CDS
<222> (188)..(1483) <223>
<400> 4 taaggagcag aaacaatgtg gtatttactt tggttcgtcg gcattttgtt gatgtgttcg 60 ctctccaccc ttgtgttggt atggctggac ccgcgattga aaagttaacg aacgtaggcc 120 tgatgcggcg cattagcatc gcatcaggca atcaataatg tcagatatga aaagcggaaa 180 834460-71726.txt catatcg atgaaa gcgatctta atcccattttta tctctt ctgattccg 229 MetLys AlaIleLeu IleProPheLeu SerLeu LeuIlePro ttaaccccgcaa tctgcattc getcagagtgag ccggag ctgaagctg 277 LeuThrProGln SerAlaPhe AlaGlnSerGlu ProGlu LeuLysLeu gaaagtgtggtg attgtcagc cgtcatggtgtg cgtgcc ccaaccaag 325 GluSerVa1Va1 IleValSer ArgHisG1yVa1 ArgAla ProThrLys gccacgcaactg atgcaggat gtcaccccagac gcatgg ccaacctgg 373 AlaThrGlnLeu MetGlnAsp ValThrProAsp AlaTrp ProThrTrp ccggtaaaactg g9ttggctg acaccacgcg9t g9tgag ctaatcgcc 421 ProValLysLeu GlyTrpLeu ThrProArgGly GlyGlu LeuIleAla tatctcggacat taccaacgc cagcgtctggtg gccgac ggattgctg 469 TyrLeuG1yHis TyrGlnArg GlnArgLeuVa1 AlaAsp G1yLeuLeu gcgaaaaagggc tgcccgcag cctggtcaggtc gcgatt attgtcgat 517 AlaLysLysG1y CysProGln ProG1yGlnVal AlaIle IleValAsp gtcgacgagcgt acccgtaaa acaggcgaagcc ttcgcc gccgggctg 565 ValAspGluArg ThrArgLys ThrG1yGluAla PheAla AlaGlyLeu gcacctgactgt gcaataacc gtacatacccag gcagat acgtccagt 613 AlaProAspCys AlaIleThr ValHisThrGln AlaAsp ThrSerSer cccgatccgtta tttattcct ctaaaaactg9c gtttgc caactggat 661 ProAspProLeu PheIlePro LeuLysThrGly ValCys GlnLeuAsp aacgcgaacgt9 actgacgcg atcctcagcagg gcag9a g9gtcaatt 709 AsnAlaAsnVal ThrAspAla IleLeuSerArg AlaGly GlySerIle getgactttacc gggcatcgg caaacggcgttt cgcgaa ctggaacgg 757 AlaAspPheThr G1yHisArg GlnThrAlaPhe ArgGlu LeuGluArg gt9cttaatttt ccgcaatca aacttgaacctt aaacgt gagaaacag 805 ValLeuAsnPhe ProGlnSer AsnLeuAsnLeu LysArg GluLysGln aatgaaagctgt aacttaacg caggcattacca tcggaa ctcaaggt9 853 AsnGluSerCys AsnLeuThr GlnAlaLeuPro SerGlu LeuLysVal agcgccgacaat gtttcatta accggtgcggta agcctc gcatcaatg 901 SerAlaAspAsn ValSerLeu ThrGlyAlaVal SerLeu AlaSerMet ctgacggaaata tttctcctg caacaagcacag ggaatg ccggagccg 949 LeuThrGluIle PheLeuLeu GlnGlnAlaGln G1yMet ProGluPro 834460-71726.txt gggtggggaaggatc actgat tcacaccagtgg aacaccttg ctaagt 997 GlyTrpGlyArgIle ThrAsp SerHisGlnTrp AsnThrLeu LeuSer ttgcataacgcgcaa ttttat ttactacaacgc acgccagag gttgcc 1045 LeuHisAsnAlaGln PheTyr LeuLeuGlnArg ThrProGlu ValAla cgcagtcgcgccacc ccgtta ttggatttgatc aagacagcg ttgacg 1093 ArgSerArgAlaThr ProLeu LeuAspLeuIle LysThrAla LeuThr ccccatccaccgcaa aaacag gcgtatg9tgt9 acattaccc acttca 1141 ProHisProProGln LysGln AlaTyrGlyVal ThrLeuPro ThrSer gt9ctgtttattgcc g9acac gatactaatctg gcaaatctc g9cg9c 1189 ValLeuPheIleAla GlyHis AspThrAsnLeu AlaAsnLeu GlyGly gcactggagctcaac tggacg cttccaggtcag ccggataac acgccg 1237 AlaLeuGluLeuAsn TrpThr LeuProG1yGln ProAspAsn ThrPro ccaggtggtgaactg gtgttt gaacgctggcgt cggctaagc gataac 1285 ProGlyGlyGluLeu ValPhe GluArgTrpArg ArgLeuSer AspAsn agccagtggattcag gtttcg ctggtcttccag actttacag cagatg 1333 SerGlnTrpIleGln ValSer LeuValPheGln ThrLeuGln GlnMet cgtgataaaacgccg ctatca ttaaatacgccg cccg9agag gt9aaa 1381 ArgAspLysThrPro LeuSer LeuAsnThrPro ProGlyGlu ValLys ctgaccctggcag9a tgtgaa gagcgaaatgcg cagg9catg tgttcg 1429 LeuThrLeuAlaGly CysGlu GluArgAsnAla GlnGlyMet CysSer ttggccggttttacg caaatc gtgaatgaagcg cgcataccg gcgtgc 1477 LeuAlaG1yPheThr GlnIle ValAsnGluAla ArgIlePro AlaCys agtttgtaa 1486 SerLeu <210> 5 <211> 432 <212> PRT
<213> Escherichia coli <400> 5 834460-71726.txt Met Lys Ala Ile Leu Ile Pro Phe Leu Ser Leu Leu Ile Pro Leu Thr Pro Gln Ser Ala Phe Ala Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Pro Gly Gln Val Ala Ile Ile Val Asp Val Asp Glu Arg Thr Arg Lys Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Ile Pro Leu Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln Thr Ala Phe Arg Glu Leu Glu Arg Val Leu Asn Phe Pro Gln Ser Asn Leu Asn Leu Lys Arg Glu Lys Gln Asn Glu Ser Cys Asn Leu Thr Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln Gln Ala Gln Gly Met Pro Glu Pro Gly Trp 834460-71726.txt Gly Arg Ile Thr Asp Ser His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp Leu Ile Lys Thr Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu <210> 6 <211> 80 <212> DNA
<213> Artificial sequence <220>
<223> Primer for amplifying appA gene.
<400> 6 ggggtaccat gggcgtctct gctgttctac ttcctttgta tctcctgtct ggagtcacct 60 ccggacagag tgagccggag 80 834460-71726.txt <210> 7 <211> 24 <212> DNA
<213> Artificial sequence <220>
<223> Primer for amplifying appA gene.
<400> 7 gggaattcat tacaaactgc aggc 24 <210> 8 <211> 21 <212> DNA
<213> Artificial sequence <220>
<223> Primer for amplifying appA gene.
<400> 8 ggaattccag agtgagccgg a 21 <210> 9 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Primer for amplifying appA gene.
<400> 9 ggggtacctt acaaactgca cg 22 <210> 10 <211> 31 <212> DNA
<213> Artificial Sequence 834460-71726.txt <220>
<223> Primer for amplifying appA mutagenesis PCR amplification.
<400> 10 ctgggtatgg ttggttatat tacagtcagg t 31 <210> 11 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Primer for amplifying appA mutagenesis PCR amplification.
<400> 11 caaacttgaa ccttaaacgt gag 23 <210> 12 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Primer for amplifying appA mutagenesis PCR amplification.
<400> 12 cctgcgttaa gttacagctt tcattctgtt t 31 <210> 13 <211> 30 <212> PRT
<213> Escherichia coli <400> 13 Met Trp Tyr Phe Leu Trp Phe Val Gly Ile Leu Leu Met Cys Ser Leu 834460-71726.txt Ser Thr Leu Val Leu Val Trp Leu Asp Pro Arg Leu Lys Ser <210> 14 <211> 432 <212> PRT
<213> Escherichia coli <400> 14 Met Lys Ala Ile Leu Ile Pro Phe Leu Ser Leu Leu Ile Pro Leu Thr Pro Gln Ser Ala Phe Ala Gln Ser Glu Pro Glu Leu Lys Leu Glu Ser Val Val Ile Val Ser Arg His Gly Val Arg Ala Pro Thr Lys Ala Thr Gln Leu Met Gln Asp Val Thr Pro Asp Ala Trp Pro Thr Trp Pro Val Lys Leu Gly Trp Leu Thr Pro Arg Gly Gly Glu Leu Ile Ala Tyr Leu Gly His Tyr Gln Arg Gln Arg Leu Val Ala Asp Gly Leu Leu Ala Lys Lys Gly Cys Pro Gln Pro Gly Gln Val Ala Ile Ile Ala Asp Val Asp Glu Arg Thr Arg Lys Thr Gly Glu Ala Phe Ala Ala Gly Leu Ala Pro Asp Cys Ala Ile Thr Val His Thr Gln Ala Asp Thr Ser Ser Pro Asp Pro Leu Phe Asn Pro Leu Lys Thr Gly Val Cys Gln Leu Asp Asn Ala Asn Val Thr Asp Ala Ile Leu Ser Arg Ala Gly Gly Ser Ile Ala Asp Phe Thr Gly His Arg Gln Thr Ala Phe Arg Glu Leu Glu Arg Val Leu 834460-71726.txt Asn Phe Ser Gln Leu Asn Leu Cys Leu Asn Arg Glu Lys Gln Asp Glu Ser Cys Ser Leu Thr Gln Ala Leu Pro Ser Glu Leu Lys Val Ser Ala Asp Asn Val Ser Leu Thr Gly Ala Val Ser Leu Ala Ser Met Leu Thr Glu Ile Phe Leu Leu Gln Gln Ala Gln Gly Met Pro Glu Pro Gly Trp Gly Arg Ile Thr Asp Ser His Gln Trp Asn Thr Leu Leu Ser Leu His Asn Ala Gln Phe Tyr Leu Leu Gln Arg Thr Pro Glu Val Ala Arg Ser Arg Ala Thr Pro Leu Leu Asp Leu Ile Met Ala Ala Leu Thr Pro His Pro Pro Gln Lys Gln Ala Tyr Gly Val Thr Leu Pro Thr Ser Val Leu Phe Ile Ala Gly His Asp Thr Asn Leu Ala Asn Leu Gly Gly Ala Leu Glu Leu Asn Trp Thr Leu Pro Gly Gln Pro Asp Asn Thr Pro Pro Gly Gly Glu Leu Val Phe Glu Arg Trp Arg Arg Leu Ser Asp Asn Ser Gln Trp Ile Gln Val Ser Leu Val Phe Gln Thr Leu Gln Gln Met Arg Asp Lys Thr Pro Leu Ser Leu Asn Thr Pro Pro Gly Glu Val Lys Leu Thr Leu Ala Gly Cys Glu Glu Arg Asn Ala Gln Gly Met Cys Ser Leu Ala Gly Phe Thr Gln Ile Val Asn Glu Ala Arg Ile Pro Ala Cys Ser Leu

Claims (96)

1. A method of improving the nutritional value of a foodstuff consumed by a monogastric animal by increasing the bioavailability of phosphate from phytate wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the animal the foodstuff in combination with less than 1200 units of a phytase expressed in yeast per kilogram of the foodstuff, wherein the phytase is Escherichia coli-derived AppA2; and wherein the bioavailability of phosphate from phytate is increased by at least 2-fold compared to the bioavailability of phosphate from phytate obtained by feeding the foodstuff in combination with the same units of a phytase expressed in a non-yeast host cell.

2. The method of claim 1 wherein the animal is an avian species.

3. The method of claim 2 wherein the avian species is selected from the group consisting of a chicken, a turkey, a duck, and a pheasant.

4. The method of claim 1 wherein the animal a porcine species.

5. The method of claim 1 wherein the animal is a marine or a fresh water aquatic species.

6. The method of claim 1 wherein the animal is a domestic animal.

7. The method of claim 6 wherein the domestic animal is a canine species.

8. The method of claim 6 wherein the domestic animal is a feline species.

9. The method of claim 1 wherein the animal is a human.

10 The method of claim 4 wherein the foodstuff is pig feed.

11. The method of claim 3 wherein the foodstuff is poultry feed.

12. The method of claim 1 wherein the yeast is selected from the group consisting of Saccharomyces species, Pichia species, Kluyveromyces species, Hansenula species, and Candida species.

13. The method of claim 12 wherein the yeast is Saccharomyces cerevisiae.

14. The method of claim 12 wherein the yeast is Pichia pastoris.

15. The method of claim 1 wherein the animal is fed the foodstuff in combination with from about 50 to about 1000 units of the phytase expressed in yeast per kilogram of the foodstuff.

16. The method of claim 1 wherein the animal is fed the foodstuff in combination with from about 50 to about 700 units of the phytase expressed in yeast per kilogram of the foodstuff.

17. The method of claim 1 wherein the animal is fed the foodstuff in combination with from about 50 to about 500 units of the phytase expressed in yeast per kilogram of the foodstuff.

18. The method of claim 1 wherein the animal is fed the foodstuff in combination with from about 50 to about 200 units of the phytase expressed in yeast per kilogram of the foodstuff.

19. The method of claim 1 wherein the phytase has an optimal activity at a pH of less than about 4.

20. The method of claim 1 wherein the phytase expressed in yeast is cleaved with a protease to enhance the capacity of the phytase to increase the bioavailability of phosphate from phytate compared to intact yeast-expressed phytase.

21. A method of reducing the feed to weight gain ratio of a monogastric animal by feeding the animal a foodstuff wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the animal the foodstuff in combination with a phytase expressed in yeast, wherein the phytase is selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA; and wherein the feed to weight gain ratio of the animal is reduced.

22. The method of claim 21 wherein the animal is an avian species.

23. The method of claim 22 wherein the avian species is selected from the group consisting of a chicken, a turkey, a duck, and a pheasant.

24. The method of claim 21 wherein the animal is a pig.

25. The method of claim 21 wherein the animal is a marine or a fresh water aquatic species.

26. The method of claim 21 wherein the animal is a domestic animal.

27. The method of claim 26 wherein the domestic animal is a canine species.

28. The method of claim 26 wherein the domestic animal is a feline species.

29. The method of claim 21 wherein the animal is a human.

30. The method of claim 24 wherein the foodstuff is pig feed.

31. The method of claim 23 wherein the foodstuff is poultry feed.

32. The method of claim 21 wherein the yeast is selected from the group consisting of Saccharomyces species, Pichia species, Kluyveromyces species, Hansenula species, and Candida species.

33. The method of claim 32 wherein the yeast is Saccharomyces cerevisiae.

34. The method of claim 32 wherein the yeast is Pichia pastoris.

35. The method of claim 21 wherein the animal is fed the foodstuff in combination with less than 1200 units of the phytase expressed in yeast per kilogram of the foodstuff.

36. The method of claim 21 wherein the animal is fed the foodstuff in combination with from about SO to about 1000 units of the phytase expressed in yeast per kilogram of the foodstuff.

37. The method of claim 21 wherein the animal is fed the foodstuff in combination with from about 50 to about 700 units of the phytase expressed in yeast per kilogram of the foodstuff.

38. The method of claim 21 wherein the animal is fed the foodstuff in combination with from about 50 to about 500 units of the phytase expressed in yeast per kilogram of the foodstuff.

39. The method of claim 21 wherein the animal is fed the foodstuff in combination with from about 50 to about 200 units of the phytase expressed in yeast per kilogram of the foodstuff.

40. The method of claim 21 wherein the site-directed mutant has an amino acid sequence as specified in SEQ ID No.: 5.

41. The method of claim 40 wherein the site-directed mutant differs from wild type AppA by at least one amino acid substitution which disrupts disulfide bond formation between cysteine residues at positions 100 and 210.

42. The method of claim 21 wherein the phytase has an optimal activity at a pH of less than about 4.

43. The method of claim 21 wherein the phytase expressed in yeast is cleaved with a protease to enhance the capacity of the phytase to reduce the feed to weight gain ratio of the animal compared to intact yeast-expressed phytase.

44. A method of improving the nutritional value of a foodstuff consumed by a monogastric animal by increasing the bone mass and mineral content of the animal wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the animal the foodstuff in combination with a phytase expressed in yeast wherein the phytase is selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA; and wherein the bone mass and mineral content of the animal is increased.

45. The method of claim 44 wherein the animal is an avian species.

46. The method of claim 45 wherein the avian species is selected from the group consisting of a chicken, a turkey, a duck, and a pheasant.

47. The method of claim 44 wherein the animal is a pig.

48. The method of claim 44 wherein the animal is a marine or a fresh water aquatic species.

49. The method of claim 44 wherein the animal is a domestic animal.

50. The method of claim 49 wherein the domestic animal is a canine species.

51. The method of claim 49 wherein the domestic animal is a feline species.

52. The method of claim 44 wherein the animal is a human.

53. The method of claim 47 wherein the foodstuff is pig feed.

54. The method of claim 46 wherein the foodstuff is poultry feed.

55. The method of claim 44 wherein the yeast is selected from the group consisting of Saccharomyces species, Pichia species, Kluyveromyces species, Hansenula species, and Candida species.

56. The method of claim 55 wherein the yeast is Saccharomyces cerevisiae.

57. The method of claim 55 wherein the yeast is Pichia pastoris.

58. The method of claim 44 wherein the animal is fed the foodstuff in combination with less than 1200 units of the phytase expressed in yeast per kilogram of the foodstuff.

59. The method of claim 44 wherein the animal is fed the foodstuff in combination with from about 50 to about 1000 units of the phytase expressed in yeast per kilogram of the foodstuff.

60. The method of claim 44 wherein the animal is fed the foodstuff in combination with from about SO to about 700 units of the phytase expressed in yeast per kilogram of the foodstuff.

61. The method of claim 44 wherein the animal is fed the foodstuff in combination with from about 50 to about 500 units of the phytase expressed in yeast per kilogram of the foodstuff.

62. The method of claim 44 wherein the animal is fed the foodstuff in combination with from about 50 to about 200 units of the phytase expressed in yeast per kilogram of the foodstuff.

63. The method of claim 44 wherein the site-directed mutant has an amino acid sequence as specified in SEQ ID No.: 5.

64. The method of claim 63 wherein the site-directed mutant differs from wild type AppA by at least one amino acid substitution which disrupts disulfide bond formation between cysteine residues at positions 100 and 210.

65. The method of claim 44 wherein the phytase has an optimal activity at a pH of less than about 4.

66. The method of claim 44 wherein the phytase expressed in yeast is cleaved with a protease to enhance the capacity of the phytase to increase the bone mass and mineral content of the animal compared to intact yeast-expressed phytase.

67. A feed additive composition for addition to an animal feed comprising a yeast-expressed phytase and a carrier for the phytase wherein the concentration of the phytase in the feed additive composition is greater than the concentration of the phytase in the final feed mixture.

68. The feed additive composition of claim 67 wherein the phytase is spray dried.

69. The feed additive composition of claim 67 wherein the phytase is selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA.

70. The feed additive composition of claim 67 wherein the carrier is selected from the group consisting of rice hulls, wheat middlings, vegetable fat, a hydrogenated lipid, a polysaccharide, a monosaccharide, mineral oil, calcium carbonate, gelatin, milk powder, phytate and other phytate-containing compounds, and a base mix.

71. The feed additive composition of claim 70 wherein the base mix comprises vitamins and minerals.

72. A foodstuff comprising the feed additive composition of claim 67 wherein the concentration of the phytase in the final feed mixture is less than 1200 units of the phytase per kilogram of the final feed mixture.

73. The foodstuff of claim 72 wherein the final feed mixture comprises from about 50 to about 1000 units of the phytase expressed in yeast per kilogram of the final feed mixture.

74. The foodstuff of claim 72 wherein the final feed mixture comprises from about 50 to about 700 units of the phytase expressed in yeast per kilogram of the final feed mixture.

75. The foodstuff of claim 72 wherein the final feed mixture comprises from about 50 to about 500 units of the phytase expressed in yeast per kilogram of the final feed mixture.

76. The foodstuff of claim 72 wherein the final feed mixture comprises from about 50 to about 200 units of the phytase expressed in yeast per kilogram of the final feed mixture.

77. The foodstuff of claim 72 wherein the final feed mixture further comprises 0.1 % exogenously added inorganic phosphate or less.

78. The foodstuff of claim 72 wherein the foodstuff exhibits increased nutritional value compared to the nutritional value of a foodstuff containing the same units of a phytase expressed in a non-yeast host cell.

79. A method of improving the nutritional value of a foodstuff consumed by a monogastric animal wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the steps of:
spray drying a phytase selected from the group consisting of Escherichia coli-derived AppA2 and a site-directed mutant of Escherichia coli-derived AppA;
mixing the phytase with a carrier for the phytase and, optionally, other ingredients to produce a feed additive composition for supplementing a foodstuff with the phytase;
mixing the feed additive composition with the foodstuff; and feeding the animal the foodstuff supplemented with the feed additive composition.

80. A method of improving the nutritional value of a foodstuff consumed by an avian species by increasing the bioavailability of phosphate from phytate wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the avian species the foodstuff in combination with less than 1200 units of a phytase expressed in yeast per kilogram of the foodstuff, wherein the bioavailability of phosphate from phytate is increased by at least 1.5-fold compared to the bioavailability of phosphate from phytate obtained by feeding to a non-avian species the foodstuff in combination with the phytase expressed in yeast.

81. The method of claim 80 wherein the avian species is selected from the group consisting of a chicken, a turkey, a duck, and a pheasant.

82. The method of claim 80 wherein the foodstuff is poultry feed.

83. The method of claim 80 wherein the yeast is selected from the group consisting of Saccharomyces species, Pichia species, Kluyveromyces species, Hansenula species, and Candida species.

84. The method of claim 80 wherein the animal is fed the foodstuff in combination with 2000 units or less of the phytase expressed in yeast per kilogram of the foodstuff.

85. The method of claim 80 wherein the animal is fed the foodstuff in combination with 1500 units or less of the phytase expressed in yeast per kilogram of the foodstuff.

86. The method of claim 80 wherein the phytase has an optimal activity at a pH of less than about 4.

87. The method of claim 80 wherein the animal is fed the foodstuff in combination with from about 50 to about 1000 units of the phytase expressed in yeast per kilogram of the foodstuff.

88. The method of claim 80 wherein the animal is fed the foodstuff in combination with from about 50 to about 700 units of the phytase expressed in yeast per kilogram of the foodstuff.

89. The method of claim 80 wherein the animal is fed the foodstuff in combination with from about 50 to about 500 units of the phytase expressed in yeast per kilogram of the foodstuff.

90. The method of claim 80 wherein the animal is fed the foodstuff in combination with from about 50 to about 200 units of the phytase expressed in yeast per kilogram of the foodstuff.

91. The method of claim 80 wherein the phytase expressed in yeast is cleaved with a protease to enhance the capacity of the phytase to increase the bioavailability of phosphate from phytate compared to intact yeast-expressed phytase.

92. The method of claim 80 wherein the bioavailability of phosphate from phytate obtained by feeding the foodstuff in combination with the phytase expressed in yeast is increased by at least 2-fold compared to the bioavailability of phosphate from phytate obtained by feeding the foodstuff in combination with the same units of a phytase expressed in a non-yeast host cell.

93. A method of reducing the feed to weight gain ratio of an avian species by feeding the avian species a foodstuff wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the avian species the foodstuff in combination with a phytase expressed in yeast wherein the feed to weight gain ratio of the animal is reduced.

94. A method of improving the nutritional value of a foodstuff consumed by an avian species by increasing the bone mass and mineral content of the avian species wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the avian species the foodstuff in combination with a phytase expressed in yeast wherein the bone mass and mineral content of the avian species is increased.

95. The method of claim 94 wherein the bone mass and mineral content of the avian species obtained by feeding to the avian species the foodstuff in combination with the phytase expressed in yeast is increased by at least 1.5-fold compared to the bone mass and mineral content obtained by feeding to a non-avian species the foodstuff in combination with the phytase expressed in yeast.

96. A method of improving the nutritional value of a foodstuff consumed by an avian species wherein the foodstuff comprises myo-inositol hexakisphosphate, the method comprising the step of feeding to the avian species the foodstuff in combination with a phytase expressed in yeast wherein the number of eggs laid and the weight of the eggs laid by the avian species is increased.