CA2176942C - Bmp-12, bmp-13 and tendon-inducing compositions thereof - Google Patents

Bmp-12, bmp-13 and tendon-inducing compositions thereof Download PDF

Info

Publication number
CA2176942C
CA2176942C CA2176942A CA2176942A CA2176942C CA 2176942 C CA2176942 C CA 2176942C CA 2176942 A CA2176942 A CA 2176942A CA 2176942 A CA2176942 A CA 2176942A CA 2176942 C CA2176942 C CA 2176942C
Authority
CA
Canada
Prior art keywords
seq
ala
leu
bmp
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CA2176942A
Other languages
French (fr)
Other versions
CA2176942A1 (en
Inventor
Anthony J. Celeste
John M. Wozney
Vicki A. Rosen
Neil M. Wolfman
Gerald H. Thomsen
Douglas A. Melton
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard College
Genetics Institute LLC
Original Assignee
Harvard College
Genetics Institute LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/333,576 external-priority patent/US6027919A/en
Application filed by Harvard College, Genetics Institute LLC filed Critical Harvard College
Publication of CA2176942A1 publication Critical patent/CA2176942A1/en
Application granted granted Critical
Publication of CA2176942C publication Critical patent/CA2176942C/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • A61K38/1875Bone morphogenic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/14Macromolecular materials
    • A61L27/22Polypeptides or derivatives thereof, e.g. degradation products
    • A61L27/227Other specific proteins or polypeptides not covered by A61L27/222, A61L27/225 or A61L27/24
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/36Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
    • A61L27/38Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
    • A61L27/3839Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by the site of application in the body
    • A61L27/3843Connective tissue
    • A61L27/386Ligaments, tendons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/54Biologically active materials, e.g. therapeutic substances
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/04Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Abstract

Bone morphogenetic proteins BMP-12 and BMP-13 have been cloned. Compositions of these proteins with tendon/ligament-like tissue inducing activity are disclosed. The compositions are useful in the treatment of tendinitis and tendon or ligament defects and in related tissue repair.

Description

TITLE OF THE INVENTION

BMP-12, BMP- 13 AND TENDON-INDUCING COMPOSITIONS THMEOF
RELATED APPLICATIONS
The present invention is a continuation-in-part of application serial number 08/217,780, filed March 25, 1994, 08/164,103, filed on December 7, 1993 and 08\333,576, filed on November 2, 1994.
FIELD OF THE I N
The present invention relates to a novel family of purified proteins, and compositions containing such proteins, which compositions are useful for the induction of tendon/ligament-like tissue formation, wound healing and ligament and other tissue repair. These proteins may also be used in compositions for augmenting the activity of bone morphogenetic proteins.
BACKGROUND OF THE NTI N
The search for the molecule or molecules responsible for formation of bone, cartilage, tendon and other tissues present in bone and other tissue extracts has led to the discovery of a novel set of molecules called the Bone Morphogenetic Proteins (BMPs). The structures of several proteins, designated BMP-1 through BMP-11, have previously been elucidated. The unique inductive activities of these proteins, along with their presence in bone, suggests that they are important regulators of bone repair processes, and may be involved in the normal maintenance of bone tissue.
There is a need to identify additional proteins which play a role in forming other vital tissues. The present invention relates to the identification of a family of proteins, which have tendon/ligament-like tissue inducing activity, and which are useful in compositions for the induction of tendon/ligament-like tissue formation and repair.
S Y OF NTI N
In one embodiment,. the present invention comprises DNA molecules encoding a tendon/ligament-like inducing protein which the inventors have named V1-1. This novel protein is now called BMP-12. The present invention also includes DNA molecules encoding BMP-12 related proteins.

BMP-12 related proteins are a subset of the EMP/TGF-,6/Vg- i family of proteins, including BMP-12 and VL-1, which are defined as tendon/ligament-like tissue inducing proteins encoded by DNA sequences which are cloned and identified, e.g., using PCR, using BMP-12 specific primers, such as primers #6 and #7 described below, with reduced stringency conditions. It is preferred that the DNA
sequences encoding BMP-12 related proteins share at least about 80% homology at the amino acid level from amino acids with amino acids #3 to #103 of SEQ ID
NO:1.
The DNA molecules preferably have a DNA sequence encoding the BMP-12 protein, the sequence of which is provided in SEQ ID NO: 1, or a EMP-12 related protein as further described herein. Both the BMP-12 protein and BMP-12 related proteins are characterized by the ability to induce the formation of tendon/ligament-like tissue in the assay described in the examples.
The DNA molecules of the invention preferably comprise a DNA sequence, as described in SEQUENCE ID NO: 1; more preferably nucleotides #496 to #882, #571 to #882 or #577 to #882 of SEQ ID NO: 1; or DNA sequences which hybridize to the above under stringent hybridization conditions and encode a protein which exhibits the ability to form tendon/ligament-like tissue. The DNA molecules of the invention may also comprise a DNA sequence as described in SEQ ID NO:25; more preferably nucleotides #604 or #658 to #964 of SEQ ID N :25.
The DNA molecules of the invention also include DNA molecules comprising a DNA sequence encoding a BMP-12 related protein with the amino acid sequence shown in SEQ ID N :2 or SEQ ID N :26, as well as naturally occurring allelic sequences and equivalent degenerative codon sequences of SEQ ID NO:2 or SEQ
ID N :26. Preferably, the DNA sequence of the present invention encodes amino acids #-25 to # 104, #1 to # 104 or #3 to #103 of SEQ ID NO:2; or amino acids #1 to #120 or #19 to #120 of SEQ ID N :26. The DNA sequence may comprise, in a 5' to 3' direction, nucleotides encoding a propeptide, and nucleotides encoding for amino acids #-25 to #104, #1 to #104 or #3 to #103 of SEQ ID N :2; or amino acids #1 to #120 or #19 'to #120 of SEQ ID N :26. The propeptide useful in the above embodiment is preferably selected from the group consisting of native propeptide and a protein propeptide from a different member of the TGF-B

.... ._._ ,.

superfamily or BMP family. The invention further comprises DNA sequences which hybridize to the above DNA sequences under stringent hybridization conditions and encode a BMP-12 related protein which exhibits the ability to induce formation of tendon/ligament-like tissue.
In other embodiments, the present invention comprises host cells and vectors which comprise a DNA molecule encoding the EMP-12 protein, or a EMP-12 related protein. The host cells and vectors may further comprise the coding sequence in operative association with an expression control sequence therefor.
In another embodiment, the present invention comprises a method for producing a purified BMP-12 related protein, said method comprising the steps of culturing a host cell transformed with the above DNA molecule or vector comprising a nucleotide sequence encoding a BMP-12 related protein; and (b) recovering and purifying said BMP-12 related protein from the culture medium. In a preferred embodiment, the method comprises (a) culturing a cell transformed with a DNA
molecule comprising the nucleotide sequence from nucleotide #496, #571 or #577 to #879 or #882 as shown in SEQ ID NO: 1; or the nucleotide sequence from #604 or #658 to #963 of SEQ ID N :25; and (b) recovering and purifying from said culture medium a protein comprising the amino acid sequence from amino acid #-25, #1 or #3 to amino acid #103 or #104 as shown in SEQ ID N :2; or from amino acid #1 or #19 to amino acid #120 as shown in SEQ ID N :26. The present invention also includes a purified protein produced by the above methods.
The present invention further comprises purified BMP-12 related protein characterized by the ability to induce the formation of tendon/ligament-like tissue.
The BMP-12 related polypeptides preferably comprise an amino acid sequence as shown in SEQ ID N :2. The polypeptide more preferably comprise amino acids #-25, #1 or #3 to #103 or #104 as set forth in SEQ ID NO:2; or amino acids #1 or #19 to #120 as set forth in SEQ ID N :26. In a preferred embodiment, the purified polypeptide may be in the form of a dimer comprised of two subunits, each with the amino acid.sequence of SEQ ID N :2.

In another embodiment, the present invention comprises compositions comprising an effective amount of the above-described BMP-12 related proteins.

WO 95/16035 217694 t2 PCIIIUS94/14030 In the compositions, the protein may be admixed with a pharmaceutically acceptable vehicle.
The invention also includes methods for tendon/ligament-like tissue healing and tissue repair, for treating tendinitis, or other tendon or ligament defects, and for inducing tendon/ligament-like tissue formation in a patient in need of same, comprising administering to said patient an effective amount of the above composition.
Other embodiments include chimeric DNA molecules comprising a DNA
sequence encoding a propeptide from a member of the TOF-$ superfamily of proteins linked in correct reading frame to a DNA sequence encoding a BMP-12 related polypeptide. One suitable propeptide is the propeptide from BMP-2. The invention also includes heterodimeric protein molecules comprising one monomer having the amino acid sequence shown in SEQ ID NO:2, and one monomer having the amino acid sequence of another protein of the TOE-Q subfamily.

Finally, the present invention comprises methods for inducing tendon/ligament-like tissue formation in a patient in need of same comprising administering to said patient an effective amount of a composition comprising a protein which exhibits the ability to induce formation of tendon/ligament-like tissue, said protein having an amino acid sequence shown in SEQ ID NO:2 or SEQ ID
NO:4 or SEQ ID NO:26. The amino acid sequences are more preferably one of the following: (a) amino acids #-25, #1 or #3 to #103 or #104 of SEQ ID NO:2; (b) amino acids #1 or #19 to #119 or #120 of SEQ ID NO:4; (c) amino acids #1 or #19.
to #119 or #120 of SEQ ID NO:26; (d) mutants and/or variants of (a), (b) or (c) which exhibit the ability to form tendon and/or ligament. In other embodiments of the above method, the protein is encoded by a DNA sequence of SEQ ID NO: 1, SEQ ID NO:3 or SEQ ID NO:25, more preferably one of the following: (a) nucleotides #496, #571 or #577 to #879 or #882 of SEQ ID NO:1; (b) nucleotides #845 or #899 to #1201 or #1204 of SEQ ID NO:3; (c) nucleotides #605 or #659 to #961 or #964 of SEQ ID NO:25; and (d) sequences which hybridize to (a) or (b) under stringent hybridization conditions and encode a protein which exhibits the ability to form tendon/ligament-like tissue.
Description of the Sequences '0 95/16035 2176942 PCTIUS94/14030 SEQ ID NO: 1 is the nucleotide sequence encoding the human BMP-12.
SEQ ID NO:2 is the amino acid sequence comprising the mature human BMP-12 polypeptide.
SEQ ID NO:3 is the nucleotide sequence encoding the protein MP52.
SEQ ID NO:4 is the amino acid sequence comprising the mature MP52 polypeptide.
SEQ ID NO:5 is the nucleotide sequence of a specifically amplified portion of the human BIM-12 encoding sequence.
SEQ ID NO:6 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:5.
SEQ ID NO:7 is the nucleotide sequence of a specifically amplified portion of the human VL-1 encoding sequence.
SEQ ID NO:8 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:7.
SEQ ID NO:9 is the nucleotide sequence of the plasmid pALV1-781, used for expression of BMP-12 in E. coli.
SEQ ID NO: 10 is the nucleotide sequence of a fragment of the murine clone, mV 1.
SEQ ID NO: 11 is the amino acid sequence of a fragment of the murine protein encoded by mV l .
SEQ ID NO: 12 is the nucleotide sequence of a fragment of the murine clone, mV2.
SEQ ID NO: 13 is the amino acid sequence of a fragment of the murine protein encoded by mV2.
SEQ ID NO: 14 is the nucleotide sequence of a fragment of the murine clone, mV9.
SEQ ID NO: 15 is the amino acid sequence of a fragment of the murine protein encoded by mV9.
SEQ ID NO: 16 is the amino acid sequence of a BM.P/TGE-(3/Vg-1 protein consensus sequence. The first Xaa represents either Gin or Asn; the second Xaa represents either Val or Ile.
SEQ ID NO: 17 is the nucleotide sequence of oligonucleotide #1.
S*

'PEAiu-S 7 APR'9 SEQ ID NO: 18 is the amino acid sequence of a BMP/TGF-,6/Vg-1 protein consensus sequence. The Xaa represents either Val or Leu.
SEQ ID NO: 19 is the nucleotide sequenc of oligonucleotide #2.
SEQ ID NO:20 is the nucleotide sequence of oligonucleotide #3.
SEQ ID NO:21 is the nucleotide sequence of oligonucleotide #4.
SEQ ID NO:22 is the nucleotide sequence of oligonucleotide #5 SEQ ID NO:23 is the nucleotide sequence of oligonucleotide #6.
SEQ ID NO:24 is the nucleotide sequence of oligonucleotide #7.
SEQ ID NO:25 is the nucleotide sequence of the human VL-1 (BMP-13) encoding sequence.
SEQ ID NO:26 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:25.
SEQ ID NO:27 is the nucleotide sequence encoding a fusion of BMP-2 propeptide and the mature coding sequence of BMP-12.
SEQ ID NO:28 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:27.
SEQ ID NO:29 is the nucleotide sequence encoding the murine mV I protein. The first Xaa is Val, Ala, Glu or Gly; the second Xaa is Ser, Pro Thr or Ala; the third Xaa is Ser or Arg; the fourth Xaa is Leu, Pro, Gln or Arg; the fifth Xaa is Cys or Trp; the sixth Xaa is Val, Ala, Asp or Gly; the seventh Xaa is Val, Ala, Glu or Gly;
the eighth Xaa is Gln, Lys or Glu.
SEQ ID NO:30 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:29. The first Xaa through the eighth Xaa are the same as in SEQ
ID
NO: 29.
SEQ ID NO:31 is the nucleotide sequence encoding the murine mV2 protein. The first Xaa is Pro or Thr; the second Xaa is Val.
SEQ ID NO:32 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:31. The first Xaa and the second Xaa are the same as in SEQ ID
NO:31.
SEQ ID NO:33 is the nucleotide sequence encoding human BMP-12 protein.
SEQ ID NO:34 is the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:33.
SEQ ID NO:35 is the nucleotide sequence of oligonucleotide #8.
Brief Description of the Figures Figure 1 is a comparison of the human BMP-12 and human MP52 sequences.
!WTET

'0 95/16035 217 6 9 4 2 PCTIUS94/14030 Detailed Description of the Invention The DNA sequences of the present invention are useful for producing proteins which induce the formation of tendon/ ligament-like tissue, as described further below. The DNA sequences of the present invention are further useful for isolating and cloning further DNA sequences encoding BMP-12 related proteins with similar activity. These BMP-12 related proteins may be homologues from other species, or may be related proteins within the same species.
Still, a further aspect of the invention are DNA sequences coding for expression of a tendon/ligament-like tissue inducing protein. Such sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in SEQ ID NO:
1 or SEQ ID N :25, DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence SEQ ID NO: 1 or 25, and encode the protein of SEQ ID N :2 or 26. Further included in the present invention are DNA sequences which hybridize under stringent conditions with the DNA sequence of SEQ ID NO:

or 25 and encode a protein having the ability to induce the formation of tendon or ligament. Preferred DNA sequences include those which hybridize under stringent conditions as described in Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389. Finally, allelic or other variations of the sequences of SEQ ID NO:1 or 25, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has tendon/ligament-like tissue inducing activity, are also included in the present invention.
The human BMP-12 DNA sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID N :2) are set forth in the Sequence Listings. Another protein that is useful for the compositions and methods of the present invention is VL- 1. VL- 1 is a BMP-12 related protein which was cloned using sequences from BMP-12. The inventors have now designated VL- 1 as BMP- 13. A partial DNA sequence of VL- 1 (SEQ ID
N :7) and the encoded amino acid sequence (SEQ ID N :8); as well as a DNA
sequence encoding the mature VL-1 (SEQ ID N :25) and the, encoded amino acid sequence (SEQ ID N :26) are set forth in the Sequence Listings. Although further descriptions are made with reference to the BMP-12 sequence of SEQ ID NO: 1 and 2, it will be recognized that the invention includes similar modifications and improvements which may be made to other BMP-12 related sequences, such as the VL-1 sequence shown in SEQ ID NO:25 and 26.
The sequence of BMP-12 shown in SEQ ID NO. 1 includes the entire mature sequence and approximately 190 amino acids of the propeptide. The coding sequence of the mature human BMP-12 protein appears to begin at nucleotide #496 or #571 and continues through nucleotide #882 of SEQ ID NO: 1. The first cysteine in the seven cysteine structure characteristic of TGF-0 proteins begins at nucleotide #577. The last cysteine ends at #879. Thus, it is expected that DNA sequences encoding active BMP-12 species will comprise nucleotides #577 to #879 of SEQ
ID
NO:1.

It is expected that BMP-12, as expressed by mammalian cells such as CIAO
cells, exists as a heterogeneous population of active species of EMP-12 protein with varying N-termini. It is expected that all active species will contain the amino acid sequence beginning with the cysteine residue at amino acid #3 of SEQ ID NO:2 and continue through at least the cysteine residue at amino acid 103 or until the stop codon after amino acid 104. Other active species contain additional amino acid sequence in the N-terminal direction. As described further herein, the N-termini of active species produced by mammalian cells are expected to begin after the occurrence of a consensus cleavage site, encoding a peptide sequence Arg-X-X-Arg.
Thus, it is expected that DNA sequences encoding active BMP-12 proteins will have a nucleotide sequence comprising the nucleotide sequence beginning at any of nucleotides #196, 199, 208, 217, 361, 388, 493, 496 or 571 to nucleotide #879 or 882 of SEQ ID NO:1.

The N-terminus of one active species of human BMP-12 has been experimentally determined by expression in E. coli to be as follows:
[M]S S LHVDF, wherein X designates an amino acid residue with no clear signal, which is consistent with a cysteine residue at that location. Thus, it appears that the N-terminus of this species of BMP-12 is at amino acid #1 of SEQ ID
NO: 1, and a DNA sequence encoding said species of BMP-12 would start at nucleotide #571 of SEQ ID NO: 1. The apparent molecular weight of this species of human BMP-12 direr was determined by SIBS-PAGE to be approximately 20-22 fled on a '0 95/16035 PC [US94114030 Novex 16% tricine gel. The human BMP-12 protein exists as a clear, colorless solution in 0.1 % trifluoroacetic acid.
As described earlier, BMP-12 related proteins are a subset of the EMP/TGF-(3/Vg-1 family of proteins, including BMP-12 and VL-1, which can be defined as tendon/ligament-like tissue inducing proteins encoded by DNA sequences which can be cloned and identified, e.g., using PCR, using BMP-12 specific primers, such as primers #6 and #7 described below, with reduced stringency conditions. It is preferred that DNA sequences of the present invention share at least about 80%
homology at the amino acid level from amino acids with the DNA encoding amino acids #3 to #103 of SEQ ID NO: 1. For the purposes of the present invention, the term BMP-12 related proteins does not include the human MP52 protein. Using the sequence information of SEQ ID NO:1 and SEQ ID NO:3, and the comparison provided in Figure 1, it is within the skill of the art to design primers to the BMP-12 sequence which will allow for the cloning of genes encoding BMP-12 related proteins.
One example of the EMP-12-related proteins of the present invention is VL- 1, presently referred to as EMP-13. The sequence of the full mature BMP-13 sequence and at least a part of the propeptide of BMP-13 is given in SEQ ID NO:25. Like BMP-12, it is expected that BMP-13, as expressed by mammalian cells such as CHO
cells, exists as a heterogeneous population of active species of BMP-13 protein with varying N-termini. It is expected that all active species will contain the amino acid sequence beginning with the cysteine residue at amino acid #19 of SEQ ID NO:26 and continue through at least the cysteine residue at amino acid 119 or until the stop codon after amino acid 120. Other active species contain additional amino acid sequence in the N-terminal direction. As described further herein, the N-termini of active species produced by mammalian cells are expected to begin after the occurrence of a consensus cleavage site, encoding a peptide sequence Arg-X-X-Arg.
Thus, it is expected that DNA sequences encoding active BMP-13 proteins will have a nucleotide sequence comprising the nucleotide sequence beginning at any of nucleotides #410, 458, '602, 605 or 659, to nucleotide #961 or 964 of SEQ ID
NO:25.

WO 95/16035 PCr/US94/14030 In order to produce the purified tendon/ligament-like tissue inducing proteins useful for the present invention, a method is employed comprising culturing a host cell transformed with a DNA sequence comprising a suitable coding sequence, particularly the DNA coding sequence from nucleotide #496, #571 or # 577 to #879 or #882 of SEQ ID NO: 1; and recovering and purifying from the culture medium a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acids #-25, #1 or #3 to #103 or #104 of SEQ
ID
NO:2. In another embodiment, the method employed comprises culturing a host cell transformed with a DNA sequence comprising a suitable coding sequence, particularly the DNA coding sequence from nucleotide #605 or # 659 to #961 or #964 of SEQ ID NO:25; and recovering and purifying from the culture medium a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acids #1 or #19 to #119 or #120 of SEQ ID
NO:26.

The human MP52 DNA is descnbed in W093/16099. However, this document does not disclose the ability of the protein to form tendon/ligament-like tissue, or its use in compositions for induction of tendon/ligament-like tissue. Human MP52 was originally isolated using RNA from human embryo tissue. The human MP52 nucleotide sequence (SEQ
ID NO:3) and the encoded amino acid sequences (SEQ ID NO:4) are set forth in the Sequence Listings herein. The MP52 protein appears to begin at nucleotide #845 of SEQ ID NO:3 and continues through nucleotide #1204 of SEQ ID NO:3. The first cysteine of the seven cysteine structure characteristic of TGF-fl proteins begins at nucleotide #899. The last cysteine ends at #1201. Other active species of protein may have additional nucleotides at the N-terminal direction from nucleotide #845 of SEQ ID NO:3.

Purified human MP52 proteins of the present invention may be produced by culturing a host cell transformed with a DNA sequence comprising the DNA
coding sequence of SEQ ID NO:3 from nucleotide #845 to #1204, and recovering and purifying from the culture medium a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acids #1 to #120 of SEQ ID NO:4. It is also expected that the amino acid sequence from amino acids /o WO 95/16035 PCr/US94/14030 #17 or #19 to #119 or #120 of SEQ ID NO:4 will retain activity. Thus, the DNA
sequence from nucleotides #845, #893 or #899 to #1201 or #1204 are expected to encode active proteins.
For expression of the protein in mammalian host cells, the host cell is transformed with a coding sequence encoding a propeptide suitable for the secretion of proteins by the host cell is linked in proper reading frame to the coding sequence for the mature protein. For example, see United States Patent 5,168,050, in which a DNA encoding a precursor portion of a mammalian protein other than BMP-2 is fused to the DNA
encoding a mature BMP-2 protein. Thus, the present invention includes chimeric DNA molecules comprising a DNA sequence encoding a propeptide from a member of the TGF-i3 superfamily of proteins, is linked in correct reading frame to a DNA
sequence encoding a tendon/ligament-like tissue inducing polypeptide. The term "chimeric" is used to signify that the propeptide originates from a different polypeptide than the encoded mature polypeptide. Of course, the host cell may be transformed with a DNA sequence coding sequence encoding the native propeptide linked in correct reading frame to a coding sequence encoding the mature protein shown in SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:26. The full sequence of the native propeptide may be determined through methods known in the art using the sequences disclosed in SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:25 to design a suitable probe for identifying and isolating the entire clone.
The present invention also encompasses the novel DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and coding for expression of tendon/ligament-like tissue inducing proteins. These DNA
sequences include those depicted in SEQ ID NO:1 in a 5' to 3' direction and those sequences which hybridize thereto under stringent hybridization conditions [for example, 0.1X SSC, 0.1 % SDS at 65 C; see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389]
and encode a protein having tendon/ligament-like tissue inducing activity.
Similarly, DNA sequences which code for proteins coded for by the sequences of SEQ ID NO:1 or SEQ ID NO:25, or proteins which comprise the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:26, but which differ in codon WO 95/16035 2 176942 PCT/US94i/14030 sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the tendon/ligament-like tissue inducing proteins described herein. Variations in the DNA sequences of SEQ ED NO:1 or SEQ 1D
N :25 which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the invention.
Another aspect of the present invention provides a novel method for producing tendon/ligament-like tissue inducing proteins. The method of the present invention involves culturing a suitable cell line, which has been transformed with a DNA sequence encoding a protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the proteins recovered and purified from the culture medium. The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.
Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO). As described above, expression of protein in mammalian cells requires an appropriate propeptide to assure secretion of the protein. The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art.
See, e.g., Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively, ufman et al, Idol. Cell. Biol., 5(7):1750-1759 (1985) or Howley et al, U. S.
Patent 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. Themammalian cell CV-1 may also be suitable.
Bacterial cells may also be suitable hosts. For example, the various strains of E. coli (e.g., HB101, MC1061) are well-known as host cells in the field of biotechnology. Various strains of B. subtilis, Pseudomonas, other bacilli and the like may also be employed in this method. For expression of the protein in bacterial cells, DNA encoding a propeptide is not necessary.
Bacterial expression of mammalian proteins, including members of the TGF-0 family is known to produce the proteins in a non-glycosylated form, and in the form s;

WO 95/16035 PCr/US94/14030 of insoluble pellets, known as inclusion bodies. Techniques have been described in the art for solubilizing these inclusion bodies, denaturing the protein using a chaotropic agent, and refolding the protein sufficiently correctly to allow for their production in a soluble form. For example, see EP 0433225.

Alternatively, methods have been devised which circumvent inclusion body formation, such as expression of gene fusion proteins, wherein the desired protein is expressed as a fusion protein with a fusion partner. The fusion protein is later subjected to cleavage to produce the desired protein. One example of such a gene fusion expression system for E. coli is based on use of the E. coli thioredoxin gene as a fusion partner, LaVallie et al., Bio/Technology, 11:187-193 (1993).
Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention.
Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Engineering, 8:277-(Plenum Press 1986) and references cited therein.
Another aspect of the present invention provides vectors for use in the method of expression of these tendon/ligament-like tissue inducing proteins.
Preferably the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention. Additionally, the vectors contain appropriate expression control sequences permitting expression of the protein sequences.
Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention. Additionally, the sequence of SEQ ID NO:

or SEQ ID NO:3 or SEQ ID NO:25 could be manipulated to express a mature protein by deleting propeptide sequences and replacing them with sequences encoding the complete propeptides of BMP proteins or members of the TGF-fl superfamily.
Thus, the present invention includes chimeric DNA molecules encoding a propeptide from a member of the TGF-fi superfamily linked in correct reading frame to a DNA
sequence encoding a protein having the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:26. The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing the replication and expression thereof in selected host cells.
Regulatory sequences for such vectors are known to those skilled in the art and may be selected depending upon the host cells. Such selection is routine and does not form part of the present invention.
A protein of the present invention, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals. Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. Ike novo tendon/ligament-like tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments.
The compositions of the invention may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects. The compositions of the present invention can also be used in other indications wherein it is desirable to heal or regenerate tendon and/or ligament tissue. Such indications include, without limitation, regeneration or repair of injuries to the periodontal ligament, such as occurs in tendonitis, and regeneration or repair of the tendon-to-bone attachment.
The compositions of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells or induce differentiation of progenitors of tendon- or ligament-forming cells.
The BMP-12 related proteins may be recovered from the culture medium and purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present. The proteins of the present invention are capable of inducing the formation of tendon/ligament-like tissue.
These proteins may be further characterized by the ability to demonstrate tendon/ligament-like tissue formation activity in the rat ectopic implant assay WO 95/16035 17 b 9 " 2 PCT/US94/14030 described below. It is contemplated that these proteins may have ability to induce the formation of other types of tissue, such as ligaments, as well.
The tendon/ ligament-like tissue inducing proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO:1 or SEQ ID
NO:25, but into which modifications are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ
ID NO:2. These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with tendon/ligament-like tissue growth factor polypeptides of SEQ ID NO:2 may possess tendon/ligament-like or other tissue growth factor biological properties in common therewith. Thus, they may be employed as biologically active substitutes for naturally-occurring tendon/ligament-like tissue inducing polypeptides in therapeutic compositions and processes.

Other specific mutations of the sequences of tendon/ligament-like tissue inducing proteins described herein involve modifications of glycosylation sites.
These modifications may involve O-linked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences may be asparagine-X-threonine, asparagine-X-serine or asparagine-X-cysteine, where X is usually any amino acid except proline.
A variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. Additionally, bacterial expression of protein will also result in production of a non-glycosylated protein, even if the glycosylation sites are left unmodified.
The compositions of the present invention comprise a purified BMP-12 related protein which may be produced by culturing a cell transformed with the DNA
sequence of SEQ ID NO: 1 or SEQ ID NO:25 and recovering and purifying protein having the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:26 from the culture medium. The purified expressed protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other contaminants. The recovered purified protein is contemplated to . exhibit tendon/ligament-like tissue formation activity, and other tissue growth activity, such as ligament regeneration. The proteins of the invention may be further characterized by the ability to demonstrate tendon/ligament-like tissue formation activity in the rat assay described below.
The compositions for inducing tendon/ligament-like tissue formation of the present invention may comprise an effective amount of a tendon/ligament-like tissue inducing protein, wherein said protein comprises the amino acid sequence of SEQ
ID NO:2, preferably amino acids #-25, #1 or #3 to #103 or #104 of SEQ ID NO:2;
or amino acids #1 or #19 to #120 of SEQ ID NO:26; as well as mutants and/or variants of SEQ ID NO:2 or SEQ ID NO:26, which exhibit the ability to form tendon and/or ligament like tissue.
Compositions of the present invention may further comprise additional proteins, such as additional members of the TGF-a superfamily of proteins, such as activins. Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of a tendon/ ligament-inducing protein, such as BMP-12 or VL-1, in a pharmaceutically acceptable vehicle or carrier.
These compositions may be used to induce the formation of tendon/ligament-like tissue or other tissue. It is contemplated that such compositions may also be used for tendon and ligament repair, wound healing and other tissue repair, such as skin repair. It is further contemplated that proteins of the invention may increase neuronal survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival. Compositions of the invention may further include at least one other therapeutically useful agent, such as the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076;
and 5,141,905; BMP-8, disclosed in PCT publication W091/18098; BMP-9, disclosed in PCT publication W093/00432; and BMP-10 or BMP-1 1.

/( The compositions of the invention may comprise, in addition to a tendon/ligament-inducing protein such as BMP-12 or VL-1 (BMP-13), other therapeutically useful agents including MP52, epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-/3), and fibroblast growth factor-4 (FGF-4), parathyroid hormone (PTH), leukemia inhibitory factor (LIF/HILDA/DIA), insulin-like growth factors (IGF-I and IGF-II). Portions of these agents may also be used in compositions of the present invention. For example, a composition comprising both BMP-2 and BMP-12 implanted together gives rise to both bone and tendon/ligament-like tissue. Such a composition may be useful for treating defects of the embryonic joint where tendon, ligaments, and bone form simultaneously at contiguous anatomical locations, and may be useful for regenerating tissue at the site of tendon attachment to bone. It is contemplated that the compositions of the invention may also be used in wound healing, such as skin healing and related tissue repair. The types of wounds include, but are not limited to burns, incisions and ulcers. (See, e.g. PCT Publication W084/01106 for discussion of wound healing and related tissue repair).

It is expected that the proteins of the invention may act in concert with or perhaps synergistically with other related proteins and growth factors.
Further therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one protein of the invention with a therapeutic amount of at least one of the BMP proteins described above. Such compositions may comprise separate molecules of the BMP proteins or heteromolecules comprised of different BMP moieties. For example, a method and composition of the invention may comprise a disulfide linked dimer comprising a BMP-12 related protein subunit and a subunit from one of the 'BMP" proteins described above. Thus, the present invention includes compositions' comprising a purified BMP-12 related polypeptide which is a heterodimer wherein one subunit comprises the amino acid sequence from amino acid #1 to amino acid #104 of SEQ ID NO:2, and one subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group /'7 consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8, BMP-9, BMP- 10 and EMP-11. A further embodiment may comprise a heterodimer of disulfide bonded tendon/ligament-like tissue inducing moieties such as BMP-12, VL-1 (BMP-13) or MP52. For example the heterodimer may comprise one subunit comprising an amino acid sequence from #1 to # 104 of SEQ III NO:2 and the other subunit may comprise an amino acid sequence from #1 to #120 of SEQ ID NO:4 or #1 to #120 of SEQ ID N :26. Further, compositions of the present invention may be combined with other agents beneficial to the treatment of the defect, wound, or tissue in question.

The preparation and formulation of such physiologically acceptable protein compositions, having due regard to pH, isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently valuable for veterinary applications due to the lack of species specificity in TGF-O
proteins.
Particularly domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment with the compositions of the present invention.
The therapeutic method includes administering the composition topically, systemically, or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than the proteins which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the methods of the invention, The compositions may also include an appropriate matrix and/or sequestering agent as a carrier. For instance, the matrix may support the composition or provide a surface for tendon/ligament-like tissue formation and/or other tissue formation.
The matrix may provide slow release of the protein and/or the appropriate environment for presentation thereof. The sequestering agent may be a substance which aids in ease of administration through injection or other means, or may slow the migration of protein from the site of application.

The choice of a carrier material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the compositions will define the appropriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined. Further matrices are comprised of pure proteins or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined. Preferred matrices include collagen-based materials, such as Helistat ' sponge (Integra LifeSciences, Plainsboro, N.J.), or collagen in an injectable form, as well as sequestering agents, which may also be biodegradable, and which may include alkylcellulosic materials.
Another preferred class of carrier are porous particulate polymer matrices, including polymers of poly(lactic acid), poly(glycolic acid) and copolymers of lactic acid and glycolic acid. These matrices may also include a sequestering agent.
Suitable polymer matrices are described, for example, in WO 93/00050, the A preferred family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl-methylcellulose, and carboxymethylcellulose, the most preferred being cationic salts of carboxymethylcellulose (CMC). Other preferred sequestering agents include hyaluronic acid, sodium alginate, poly(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and poly(vinyl alcohol). The amount of sequestering agent useful herein is 0.5-20 wt%, preferably 1-10 wt% based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein.the opportunity to assist the activity of the progenitor cells.
Additional optional components useful in the practice of the subject application include, e.g. cryogenic protectors such as mannitol, sucrose, lactose, glucose, or glycine (to protect the protein from degradation during lyophilization), antimicrobial preservatives such as methyl and propyl parabens and benzyl alcohol;

WO 95/16035 "1769411-1 PCT[ S9$1U030 antioxidants such as EDTA, citrate and BHT (butylated hydroxytoluene); and surfactants such as poly(sorbates) and poly(oxyethylenes); etc.
As described above, the compositions of the invention may be employed in methods for treating a number of tendon defects, such as the regeneration of tendon/ligament-like tissue in areas of tendon or ligament damage, to assist in repair of tears of tendon tissue, ligaments, and various other types of tissue defects or wounds. These methods, according to the invention, entail administering to a patient needing such tendon/ligament-like tissue or other tissue repair, a composition comprising an effective amount of a tendon/ligament-like tissue inducing protein, such as described in SEQ ID N :2, SEQ ID N :4 and/or SEQ ID NO:26. These methods may also entail the administration of a tendon/ligament-like tissue inducing protein in conjunction with at least one of the BMP proteins described above.
In another embodiment, the methods may entail administration of a heterodimeric protein in which one of the monomers is a tendon/ligament-like tissue inducing polypeptide, such as BMP-12, VL-1 (BMP-13) or MP52, and the second monomer is a member of the TGF-,6 superfamily of growth factors. In addition, these methods may also include the administration of a tendon/ligament-like tissue inducing protein with other growth factors including EGF, FGF, TGF-a, TGF-0, and IGF.
Thus, a further aspect of the invention is a therapeutic method and composition for repairing tendon/ligament-like tissue, for repairing tendon or ligament as well as treating tendinitis and other conditions related to tendon or ligament defects. Such compositions comprise a therapeutically effective amount of one or more tendon/ligament-like tissue inducing proteins, such as BMP-12, a EMP-12 related protein, or MP52, in admixture with a pharmaceutically acceptable vehicle, carrier or matrix.
The dosage regimen will be determined by the attending physician considering various factors which modify the action of the composition, e.g., amount of tendon or ligament tissue desired to be formed, the site of tendon or ligament damage, the condition of the damaged tendon or ligament, the size of a wound, type of daged tissue, the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the types of additional proteins in the composition. The addition of other known growth factors, such as IGF-I
(insulin like growth factor I), to the final composition, may also affect the dosage.
Progress can be monitored by periodic assessment of tendon/ligament-like tissue formation, or tendon or ligament growth and/or repair. The progress can be monitored by methods known in the art, for example, X-rays, arthroscopy, histomorphometric determinations and tetracycline labeling.
The following examples illustrate practice of the present invention in recovering and characterizing human tendon/ligament-like tissue inducing protein and employing them to recover the other tendon/ligament-like tissue inducing proteins, obtaining the human proteins, expressing the proteins via recombinant techniques, and demonstration of the ability of the compositions of the present invention to form tendon/ligament-like tissue in an in vivo model. Although the examples demonstrate the invention with respect to BMP-12, with minor modifications within the skill of the art, the same results are believed to be attainable with MP52 and VL-1.

Isolation of DNA
DNA sequences encoding BMP-12 and BMP-12 related proteins may be isolated by various techniques known to those skilled in the art. As described below, oligonucleotide primers may be designed on the basis of amino acid sequences present in other BMP proteins, Vg-1 related proteins and other proteins of the TGF-0 superfamily. Regions containing amino acid sequences which are highly conserved within the BMP family of proteins and within other members of the TGF-0 superfamily of proteins can be identified and consensus amino acid sequences of these highly conserved regions can be constructed based on the similarity of the corresponding regions of individual BMP/TGF-O/Vg-1 proteins. An example of such a consensus amino acid sequence is indicated below.
Consensus amino acid sequence (1):
Trp-Gin/Asn-Asp-Trp-Ile-Val/Ile-Ala (SEQ ID NO:16) Where X/Y indicates that either amino acid residue may appear at that position.

WO 95/16035 2 1 6 9 4 2 IPClIUS94/14030 The following oligonucleotide is designed on the basis of the above identified consensus amino acid sequence (1) :
#1: CGGATCCTGGVANGAYTGGATHRTNGC (SEQ ID NO:17) This oligonucleotide sequence is synthesized on an automated DNA
synthesizer. The standard nucleotide symbols in the above identified oligonucleotide primer are as follows: A,adenosine; C,cytosine; G, guanine; T, thymine; N, adenosine or cytosine or guanine or thymine; R,adenosine or cytosine; Y,cytosine or thymine;
H,adenosine or cytosine or thymine; V,adenosine or cytosine or guanine;
D,adenosine or guanine or thymine.
The first seven nucleotides of oligonucleotide #1 (underlined) contain the recognition sequence for the restriction endonuclease Ea 1 in order to facilitate the manipulation of a specifically amplified DNA sequence encoding the EMP-12 protein and are thus not derived from the consensus amino acid sequence (1) presented above.

A second consensus amino acid sequence is derived from another highly conserved region of EMP/TGF-O/Vg-1 proteins as described below:
His-Ala-Ile-Val/Ieeu-Gln-Thr (SEQ ID NO:18) The following oligonucleotide is designed on the basis of the above identified consensus amino acid sequence (2):
#2: TTTCTAGAARNGTYTGNACDATNGCRTG (SEQ ID NO:19) This oligonucleotide sequence is synthesized on an automated DNA
synthesizer. The same nucleotide symbols are used as described above.
The first seven nucleotides of oligonucleotide #1 (underlined) contain the recognition sequence for the restriction endonuclease Xbal in order to facilitate the manipulation of a specifically amplified DNA sequence encoding the BMP-12 protein and are thus not derived from the consensus amino acid sequence (2) presented above.
It is contemplated that the B MP-12 protein of the invention and other EMP/TGF-O/Vg-1 related proteins may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within a BMP-12 protein or other novel related proteins would correspond to the relative locations in the proteins from which they were derived. It is further contemplated that this positional information derived from the structure of other BMP/TGF-O/Vg-1 proteins and the oligonucleotide sequences #1 and #2 which have been derived from consensus amino acid sequences (1) and (2),respectively, could be utilized to specifically amplify DNA sequences encoding the corresponding amino acids of a BMP-12 protein or other BIM/TGP-O/Vg-1 related proteins.
Based on the knowledge of the gene structures of BMP/TGF-¾/Vg-1 proteins it is further contemplated that human genomic DNA can be used as a template to perform specific amplification reactions which would result in the identification of BMP-12 BMP/TGF-a/Vg-1 (BMP-12 related protein) encoding sequences. Such specific amplification reactions of a human genomic DNA template could be initiated with the use of oligonucleotide primers #1 and #2 described earlier.
Oligonucleotides #1 and #2 identified above are utilized as primers to allow the specific amplification of a specific nucleotide sequence from human genomic DNA.
The amplification reaction is performed as follows:
Human genomic DNA (source: peripheral blood lymphocytes), provided by Ken Jacobs of Genetics Institute, is sheared by repeated passage through a 25 gauge needle, denatured at 100 C for 5 minutes and then chilled on ice before adding to a reaction mixture containing 200 M each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP), 10 Tris-HCl pH 8.3, 50 KC1, 1.5 MgC12, 0.001 % gelatin, 1.25 units Taq DNA polymerase, 100 pM oligonucleotide #1 and 100 pM oligonucleotide #2. This reaction mixture is incubated at 94 C for two minutes and then subjected to thermal cycling in the following manner: 1 minute at 94 C, 1 minute at 40 C, 1 minute at 72 C for three cycles; then 1 minute at 94 C, 1 minute at 55 C, 1 minute at 72 C for thirty-seven cycles, followed by a 10 minute incubation at 72 C.
The DNA which is specifically amplified by this reaction is ethanol precipitated, digested with the restriction endonucleases B I and XbaI and subjected to agarose gel electrophoresis. A region of the gel, corresponding to the predicted size of the BMP-12 or other BMP/TGF-Q/Vg-1 encoding DNA fragment, is excised and the specifically amplified DNA fragments contained therein are electroeluted and subcloned into the plasmid vector pGEM-3 between the XbaI
and BamHI sites of the polylinker. DNA sequence analysis of one of the resulting BMP-~3 W 95/16035 2176942 CTIUS94f14030 12 related subclones indicates the specifically amplified DNA sequence product contained therein encodes a portion of the BMP-12 protein of the invention.
The DNA sequence (SEQ ID N :5) and derived amino acid sequence (SEQ
ID NO:6) of this specifically amplified DNA fragment of BMP-12 are shown in the SEQUENCE Listings.

Nucleotides #1-#26 of SEQ ID N :5 comprise a portion of oligonucleotide #1 and nucleotides #103 - #128 comprise a portion of the reverse compliment of oligonucleotide #2 utilized to perform the specific amplification reaction.
Due to the function of oligonucleotides #1 and #2 in initiating the amplification reaction, they may not correspond exactly to the actual sequence encoding a BMP-12 protein and are therefore not translated in the corresponding amino acid derivation (SEQ ID
N :6).

DNA sequence analysis of another subclone indicates that the specifically amplified DNA product contained therein encodes a portion of another EMP/TGF-O/Vg-1 (BMP-12 related) protein of the invention named VL-1.
The DNA sequence (SEQ ID NO:7) and derived amino acid sequence (SEQ
ID N :8) of this specifically amplified DNA fragment are shown in the Sequence Listings.

Nucleotides #1 - #26 of SEQ ID N :7 comprise a portion of oligonucleotide #1 and nucleotides #103 - #128 comprise a portion of the reverse compliment of oligonucleotide #2 utilized to perform the specific amplification reaction.
Due to the function of oligonucleotides #1 and #2 in initiating the amplification reaction, they may not correspond exactly to the actual sequence encoding a VL-1 protein of the invention and are therefore not translated in the corresponding amino acid derivation (SEQ ID NO:8).

The following oligonucleotide probe is designed on the basis of the specifically amplified BMP-12 human DNA sequence set forth above (SEQ ID
N :5) and synthesized on an automated DNA synthesizer:
#3: CCACTGCGAGGGCCTTTGCGACTTCCCTTTGCGTTCGCAC (SEQ ID
NO:20) This oligonucleotide probe is radioactively labeled with 32P and employed to screen a human genomic library constructed in the vector XFIX (Stratagene catalog VO 95/16035 21 ` 6 9 2 PCT/US94/14030 #944201). 500,000 recombinants of the human genomic library are plated at a density of approximately 10,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques and hybridized to oligonucleotide probe #3 in standard hybridization buffer (SHB = 5X SSC, 0.1 %
SDS, 5X Denhardt's, 100 g/ml salmon sperm DNA) at 65 C overnight. The following day the radioactively labelled oligonucleotide containing hybridization solution is removed an the filters are washed with 0.2X SSC, 0.1 % SDS at 65 C.
A single positively hybridizing recombinant is identified and plaque purified.
This plaque purified recombinant bacteriophage clone which hybridizes to the BMP-12 oligonucleotide probe #3 is designated XHuG-48. A bacteriophage plate stock is made and bacteriophage DNA is isolated from the XHuG-48 human genomic clone.
The bacteriophage XHuG-48 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD "ATCC" under the accession #75625 on December 7, 1993. This deposit meets the requirements of the Budapest Treaty of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. The ooligonucleodde hybridizing region of this recombinant, AHuG-48, is localized to a 3.2 kb P I
fragment. This fragment is subcloned into a plasmid vector (pGEM-3) and DNA
sequence analysis is performed. This plasmid subclone is designated PCR1-1#2 and has been deposited with the American Type Culture Collection, 12301 Parkiawn Drive, Rockville, MD "ATCC" under the accession #69517 on December 7, 1993.
This deposit meets the requirements of the Budapest Treaty of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. The partial DNA sequence (SEQ ID NO: 1) and derived amino acid sequence (SEQ ID NO:2) of the 3.2 kb DNA insert of the plasmid subclone PCR1-1#2, derived from clone XHuG-48, are shown in the Sequence Listings.
It should be noted that nucleotides #639 - #714 of SEQ ID NO: 1 correspond to nucleotides #27 - #102 of the specifically amplified BMP-12 encoding DNA
fragment set forth in SEQ ID NO:5 thus confirming that the human genomic bacteriophage clone XHuG-48 and derivative subclone PCR1-1#2 encode at least a portion of the BMP-12 protein of the invention. The nucleotide sequence of a portion of the 3.2 kb BamHI insert of the plasmid PCR1-1#2 contains an open reading frame of at least 882 base pairs, as defined by nucleotides #14882 of SEQ
ID NO: 1. This open reading frame encodes at least 294 amino acids of the human BMP- 12 protein of the invention. The encoded 294 amino acid human BMP-12 protein includes the full mature human BMP-12 protein (amino acids #1-#104 of SEQ ID N :2), as well as the C-terminal portion of the propeptide region of the primary translation product (amino acid #-190 to #-1 of SEQ ID N :2).
Additional DNA sequence of the 3.2 kb BamHI insert of the plasmid PCR1-1#2 set forth in SEQ ID N :33 demonstrates the presence of an 1164 bp open reading frame, as defined by nucleotides #138 through #1301 of SEQ ID N :33.
[NOTE that all the sequence disclosed in SEQ ID NO:1 is contained within SEQ
ID
NO:33]. As this sequence is derived from a genomic clone it is difficult to determine the boundary between the 5' extent of coding sequence and the 3' limit of intervening sequence (intron/non-coding sequence).

Based on the knowledge of other BMP proteins and other proteins within the TGF-0 family, it is predicted that the precursor polypeptide would be cleaved at the multibasic sequence Arg-Arg-Gly-Arg in agreement with a proposed consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the BMP-12 precursor polypeptide is expected to generate a 104 amino acid mature peptide beginning with the amino acid Ser at position #1 of SEQ ID N :2. The processing of BMP-12 into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to the processing of the related protein TGF-0 [Gentry et al., Molec & Cell. Biol., 8:4162 (1988); Derynck et al.
Nature, 316:701 (1985)].
It is contemplated therefore that the mature active species of BMP-12 comprises a homodimer of two polypeptide subunits, each subunit comprising amino acids #1 to #104 of SEQ ID N :2 with a predicted molecular weight of approximately 12,000 daltons. Further active species are contemplated comprising at least amino acids #3 to #103 of SEQ ID N :2, thereby including the first and last conserved cysteine residue. As with other members of the TGF-O/EMP family of proteins, the carboxy-terminal portion of the BMP-12 protein exhibits greater sequence conservation than the more amino-terminal portion. The percent amino a 4*

O 95/16035 2176942 PCr/US94/14030 acid identity of the human BMP-12 protein in the cysteine-rich C-terminal domain (amino acids #3 - #104) to the corresponding region of human BMP proteins and other proteins within the TGF-0 family is as follows: BMP-2, 55 %; BMP-3, 43 %;
BMP-4. 53%; BMP-5, 49%; BMP-6, 49%; BMP-7, 50%; BMP-8, 57%; BMP-9, 48%; BMP-10, 57%; activin WC (BMP-11), 38%; Vg1, 46%; GDF-1, 47%; TGF-J31, 36%; TGF-02, 36%; TGF-f3, 39%; inhibin $(B), 36%; inhibin /3(A), 41%.
The human BMP-12 DNA sequence (SEQ ID NO: 1), or a portion thereof, can be used as a probe to identify a human cell line or tissue which synthesizes BMP-12 mRNA. Briefly described, RNA is extracted from a selected cell or tissue source and either electrophoresed on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formaldehyde and spotted on nitrocellulose directly.
The nitrocellulose is then hybridized to a probe derived from the coding sequence of human BMP-12.
Alternatively, the human BMP-12 sequence is used to design oligonucleotide primers which will specifically amplify a portion of the BMP-12 encoding sequence located in the region between the primers utilized to perform the specific amplification reaction. It is contemplated that these human BMP-12 derived primers would allow one to specifically amplify corresponding BMP-12 encoding sequences from mRNA, cDNA or genomic DNA templates. Once a positive source has been identified by one of the above described methods, mRNA is selected by oligo (dT) cellulose chromatography and cDNA is synthesized and cloned in Xgt10 or other X
bacteriophage vectors known to those skilled in the art, for example, XZAP by established techniques (Toole et al., sera). It is also possible to perform the oligonucleotide primer directed amplification reaction, described above, directly on a pre-established human cDNA or genomic library which has been cloned into a X
bacteriophage vector. In such cases, a library which yields a specifically amplified DNA product encoding a portion of the human BMP-12 protein could be screened directly, utilizing the fragment of amplified BMP-12 encoding DNA as a probe.
Oligonucleotide primers designed on the basis of the DNA sequence of the human BMP-12 genomic clone XHuG-48 are predicted to allow the specific amplification of human BMP-12 encoding DNA sequences from pre-established human cDNA libraries which are commercially available (ie. Stratagene, La Jolla, Z?

WO 95/16035 2 l 6 9 2 PCTJUS94/14030 CA or Clontech Laboratories, Inc., Palo Alto, CA). The following oligonucleotide primer is designed on the basis of nucleotides #571 to #590 of the DNA
sequence set forth in SEQ ID NO:1 and synthesized on an automated DNA synthesizer:
#4: TGCGGATCCAGCCGCTGCAGCCGC GCC (SEQ ID NO:21) The first nine nucleotides of primer #4 (underlined) comprise the recognition sequence for the restriction endonuclease B I which can be used to facilitate the manipulation of a specifically amplified DNA sequence encoding the human EMP-protein of the invention and are thus not derived from the DNA sequence presented in SEQ ID NO:1.
The following oligonucleotide primer is designed on the basis of nucleotides #866 -#885 of the DNA sequence set forth in SEQ ID NO:1 and synthesized on an automated DNA synthesizer:
#5 GACTCTAGACTACCTGCAGCCGCAGGCCT (SEQ ID N :22) The first nine nucleotides of primer #5 (underlined) comprise the recognition sequence for the restriction endonuclease Xbal which can be used to facilitate the manipulation of a specifically amplified DNA sequence encoding the human PMP-protein of the invention and are thus not derived from the DNA sequence presented in SEQ ID NO:1.

The standard nucleotide symbols in the above identified primers are as follows: A, adenine; C, cytosine; G, guanine; T, thymine.
Primers #4 and #5 identified above are utilized as primers to allow the amplification of a specific BMP-12 encoding nucleotide sequence from pre-established cDNA libraries which may include the following: human fetal brain cDNA/XZ II (Stratagene catalog #936206), human liver/XUNI-ZAP
(Stratagene Catalog #937200), human lung/XUNI-ZAP (Stratagene catalog #937206), and human fetal spleen/UNI-ZAP XR (Stratagene catalog #937205).
Approximately 1 x 108 pfu (plaque forming units) of Xbacteriophage libraries containing human cDNA inserts such as those detailed above are denatured at 95 C
for five minutes prior to addition to a reaction mixture containing 200 ,M
each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 Tris-ICI
pH 8.3, 50 KC1, 1.5 MgC121 0.001% gelatin, 1.25 units Taq DNA
polymerise, 100 pM oligonucleotide primer #4 and 100 pM oligonucleotide primer #5. The reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94 C, 1 minute at 50 C, 1 minute at 72 C for thirty-nine cycles followed by 10 minutes at 72 C.
The DNA which is specifically amplified by this reaction would be expected to generate a BMP-12 encoding product of approximately 333 base pairs, the internal 315 bp of which correspond to nucleotides #571 to #885 of SEQ ID NO: 1 and also including 9 bp at each end of the BMP-12 specific fragment which correspond to the restriction sites defined by nucleotides #1 - #9 of primers #4 and #5. The resulting 333 bp DNA product is digested with the restriction endonucleases BamHI and Xbal, phenol extracted, chloroform extracted and ethanol precipitated.
Alternatively, to ethanol precipitation, buffer exchange and removal of small fragments of DNA resulting from the BamHI/Xbal restriction digest is accomplished by dilution of the digested DNA product in 10 Tris-HCl pH 8.0, 1 EDTA
followed by centrifugation through a CentriconTM 30 microconcentrator (W.R.
Grace & Co., Beverly, MA; Product #4209). The resulting BamHI/XbaI digested amplified DNA product is subcloned into a plasmid vector (ie. pBluescript, pGEM-3 etc.) between the BamHI and Xbal sites of the polylinker region. DNA sequence analysis of the resulting subclones would be required to confirm the integrity of the BMP-12 encoding insert. Once a positive cDNA source has been identified in this manner, the corresponding cDNA library from which a 333 bp BMP-12 specific sequence was amplified could be screened directly with the 333 bp insert or other BMP-12 specific probes in order to identify and isolate cDNA clones encoding the full-length BMP-12 protein of the invention.
Additional methods known to those skilled in the art may be used to isolate other full-length cDNAs encoding human BMP-12 related proteins, or full length cDNA clones encoding BMP-12 related proteins of the invention from species other than humans, particularly other mammalian species.
The following examples demonstrate the use of the human BMP-12 sequence to isolate homologues from BMP-12 related proteins in a murine genomic DNA
library.
The DNA sequence which encodes the human B MP-12 protein of the invention is predicted to be significantly homologous to BMP-12 and BMP-12 related a9 sequences from species other than humans that it could be utilized to specifically amplify DNA sequences from those other species which would encode the corresponding EMP-12 related proteins. Specifically, the following oligonudleotides are designed on the basis of the human BMP-12 sequence (SEQ ID NO: 1) and are synthesized on an automated DNA synthesizer:
#6: GCGGATCCAAGGAGCTCGGCTGGGACGA (SEQ ID NO:23) #7: GGAATTCCCCACCACCATGTCCTCGTAT (SEQ ID NO:24) The first eight nucleotides of oligonucleotide primers #6 and #7 (underlined) comprise the recognition sequence for the restriction endonucleases B I and EcoRl, respectively. These sequences are utilized to facilitate the manipulation of a specifically amplified DNA sequence encoding a BMP-12 or BMP-12 related protein from a species other than human and are thus not derived from the DNA
sequence presented in SEQ ID NO:1. Oligonucleotide primer #6 is designed on the basis of nucleotides #607-#626 of SEQ ID NO: 1. Oligonucleotide primer #7 is designed on the basis of the reverse compliment of nucleotides #846-#865 of the DNA sequence set forth in SEQ ID NO: 1.
Oligonucleotide primers #6 and #7 identified above are utilized as primers to allow the amplification of specific TIP-12 related sequences from genomic DNA
derived from species other than humans. The amplification reaction is performed as follows:

Murine genomic DNA (source: strain Balb c) is sheared by repeated passage through a 25 gauge needle, denatured at 100 C for five minutes and then chilled on ice before adding to a reaction mixture containing 200 uM each deoxynucleotide triphosphates (dATP, DGTP, dCTP and dTTP) 10 Tris-PICT pH 8.3, 50 ICI, 1.5 MgCl2, 0-001% gelatin, 1.25 units Taq DNA polymerase, 100 pM
oligonucleotide primer #6 and 100 pM oligonucleotide primer #7. The reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 95 C, 1 minute at 55 C, 1 minute at 72 C for forty cycles followed by 10 minutes at 72 C.
The DNA which is specifically amplified by this reaction is ethanol precipitated, digested with the restriction endonucleases BamHI and EcoRI and subjected to agarose gel electrophoresis. A region of the gel, corresponding to the WO 95/16035 2176942 PC [US94/14030 predicted size of the murine BMP-12 or BMP-12 related encoding DNA fragment, is excised and the specifically amplified DNA fragments contained therein are extracted (by electroelution or by other methods known to those skilled in the art) and subcloned in to a plasmid vector, such as pGEM-3 or pBluescript between the BamHI and EcoRI sites of the polylinker. DNA sequence analysis of one of the resulting subclones named mV1, indicates that the specifically amplified DNA
sequence contained therein encodes a portion of a protein which appears to be the murine homolog to either the EMP-12 or VL-1 sequence of the invention. The DNA
sequence (SEQ ID NO:10) and derived amino acid sequence (SEQ ID NO:11) of this specifically amplified murine DNA fragment are shown in the sequence listings.
Nucleotides #1-26 of SEQ ID NO: 10 comprise a portion of oligonucleotide #6 and nucleotides #246-#272 comprise a portion of the reverse compliment of oligonucleotide #7 utilized to perform the specific amplification reaction.
Nucleotide #27 of SEQ ID NO: 10 appears to be the last nucleotide of a codon triplet, and nucleotides #244-#245 of SEQ ID NO: 10 appear to be the first two nucleotides of a codon triplet. Therefore, nucleotides #28 to #243 of SEQ ID NO: 10 correspond to a partial coding sequence of mV1. Due to the function of oligonucleotides #6 and #7 in initiating the amplification reaction, they may not correspond exactly to the actual sequence encoding the murine homolog to the human EMP-12 or VL-1 protein of the invention and are therefore not translated in the corresponding amino acid sequence derivation (SEQ ID NO: 11).
Oligonucleotide probes designed on the basis of the specifically amplified murine BMP-12 or VL-1 DNA sequence set forth in SEQ ID NO: 10 can be utilized by those skilled in the art to identify full-length murine BMP-12 or VL-1 encoding clones (either cDNA or genomic).
DNA sequence analysis of another of the resulting subclones named mV2, indicates that the specifically amplified DNA sequence contained therein encodes a portion of a murine BMP-12 related sequence of the invention. The DNA sequence (SEQ ID NO: 12) and derived amino acid sequence (SEQ ID NO: 13) of this specifically amplified murine DNA fragment are shown in the sequence listings.
Nucleotides #1-#26 of SEQ ID NO: 12 comprise a portion of oligonucleotide #6 and nucleotides #246-#272 comprise a portion of the reverse compliment of oligonucleotide #7 utilized to perform the specific amplification reaction.
Nucleotide #27 of SEQ ID NO: 12 appears to be the last nucleotide of a codon triplet, and nucleotides #2444245 of SEQ ID NO: 12 appear to be the first two nucleotides of a codon triplet. Therefore, nucleotides #28 to #243 of SEQ ID NO: 12 correspond to a partial coding sequence of mV2. Due to the function of oligonucleotides #6 and #7 in initiating the amplification reaction, they may not correspond exactly to the actual sequence encoding the murine EMP-12 related protein of the invention and are therefore not translated in the corresponding amino acid sequence derivation (SEQ ID NO:13).

Oligonucleotide probes designed on the basis of the specifically amplified murine EMP-12 related DNA sequence set forth in SEQ ID NO: 12 can be utilized by those skilled in the art to identify full-length murine BMP-12 related encoding clones (either cDNA or genomic).

DNA sequence analysis of another of the resulting subclones named mV9, indicates that the specifically amplified DNA sequence contained therein encodes a portion of a murine BMP-12 related sequence of the invention. This sequence appears to be the murine homolog to the human MP52 DNA sequence described at SEQ ID NO:3. The DNA sequence (SEQ ID NO: 14) and derived amino acid sequence (SEQ ID NO: 15) of this specifically amplified murine DNA fragment are shown in the sequence listings.

Nucleotides #1-#26 of SEQ ID NO: 14 comprise a portion of oligonucleotide #6 and nucleotides #246-#272 comprise a portion of the reverse compliment of oligonucleotide #7 utilized to perform the specific amplification reaction.
Nucleotide #27 of SEQ ID NO: 14 appears to be the last nucleotide of a codon triplet, and nucleotides #244-#245 of SEQ ID NO: 14 appear to be the first two nucleotides of a codon triplet. Therefore, nucleotides #28 to #243 of SEQ ID NO: 14 correspond to a partial coding sequence of mV9. Due to the function of oligonucleotides #6 and #7 in initiating the amplification reaction, they may not correspond exactly to the actual sequence encoding the murine 13 -12 related protein of the invention and are therefore not translated in the corresponding amino acid sequence derivation (SEQ ID NO:15).

WO 95/16035 2176942 PC fUS94/1 1030 Oligonucleotide probes designed on the basis of the specifically amplified murine 13MP-12 related DNA sequence set forth in SEQ ID NO: 14 can be utilized by those skilled in the art to identify full-length murine BMP-12 related encoding clones (either cDNA or genomic).
Alternatively, oligonucleotide primers #6 and #7 identified above are utilized as primers to allow the specific amplification of a 275 base pair DNA probe, the internal 259 bp of which correspond to nucleotides #607 to #865 of SEQ ID NO:
1, from the BMP-12 encoding plasmid subclone PCR1-1#2. This 275bp DNA probe was radioactively labelled with 32P and employed to screen a murine genomic library constructed in the vector X FIX II (Stratagene catalog #946306). 1 million recombinants of the murine genomic library are plated at a density of approximately 20,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are hybridized, under reduced stringency conditions, to the specifically amplified 333 bp probe in standard hybridization buffer (SHE = 5X SSC, 0.1 % SDS, 5X Denhardt's, 100 g/ml salmon sperm DNA) at 60 C overnight. The following day the radioactively labelled oligonucleotide containing hybridization solution is removed an the filters are washed, under reduced stringency conditions, with 2X SSC, 0.1 % SDS at 60 C. Multiple positively hybridizing recombinants are identified and plaque purified. Fragments of the positively hybridizing murine genomic recombinant clones are subcloned into standard plasmid vectors (i.e. pGEM-3) and subjected to DNA sequence analysis.
DNA sequence analysis of one of these subclones named MVR3 indicates that it encodes a portion of the mouse gene corresponding to the PCR product mV l (murine homolog of the human BMP-12 sequence set forth in SEQ ID NO.: 1) described above. The partial DNA sequence of this subclone and corresponding amino acid translation are set forth in SEQ ID NO: 29 and SEQ ID N :30 respectively.
DNA sequence analysis of another one of these subclones named MVR32 indicates that it encodes a portion of the mouse gene corresponding to the PCR
product mV2 (murine homolog of the human VL-1 sequence set forth in SEQ ID
N :7) described above. The partial DNA sequence of this subclone and 2176942 WO 95/16035 PC7fUS94/14030 corresponding amino acid translation are set forth in SEQ ID NO: 31 and SEQ ID
N :32 respectively.
DNA sequence analysis of another of these subclones named'MVR23 indicates that it encodes a portion of the mouse gene corresponding to the PCR
product mV9 (murine homolog of the MP-52 sequence set forth in SEQ ID NO:3) described above.
In a similar manner to that which is described above for identifying and isolating human genomic clones encoding the BMP-12 protein of the invention, oligonucleotide probe(s) corresponding to the VL-1 encoding sequence set forth in SEQ ID N :7 can be designed and utilized to identify human genomic or cDNA
sequences encoding the VL-1 (BMP-13) protein. These oligonucleotides would be designed to regions specific for VL-1 encoding sequences and would therefore be likely to be derived from regions of the lowest degree of nucleotide sequence identity between the specifically amplified VL-1 encoding sequence (SEQ ID NO:7) and the specifically amplified BMP-12 encoding sequence (SEQ ID NO:5).
Alternatively, oligonucleotide primers #4 and #5 identified above are utilized as primers to allow the specific amplification of a 333 base pair DNA probe, the internal 315 bp of which correspond to nucleotides #571 to #885 of SEQ ID
NO:1, from the BMP-12 encoding plasmid subclone PCR1-1#2. This 333 bp DNA probe was radioactively labelled with 32P and employed to screen a human genomic library constructed in the vector XDASH II (Stratagene catalog #945203). 1 million recombinants of the human genomic library are plated at a density of approximately 20,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are hybridized, under reduced stringency conditions, to the specifically amplified 333 bp probe in standard hybridization buffer (SHB = 5X SSC, 0.1 % SDS, 5X Denhardt's, 100 jAg/ml salmon sperm DNA) at 60 C overnight. The following day the radioactively labelled oligonucleotide containing hybridization solution is removed an the filters are washed, under reduced stringency conditions, with 2X SSC, 0.1 % SDS at 60 C. Multiple (approximately 15) positively hybridizing recombinants are identified and plaque purified.
In order to distinguish positively hybridizing recombinants encoding the VI,-1 protein of the invention from EMP 12 and other BMP-12-related encoding recombinants which would be predicted to hybridize positively to the 333 bp DNA
probe generated from the BMP-12 encoding plasmid PCR1-1#2 utilized in this screening procedure, the following oligonucleotide probe, based on the VL-1 sequence set forth in SEQ ID NO:7, is designed and synthesized on an automated DNA synthesizer:
#8: TGTATGCGACTTCCCGC [SEQUENCE ID NO: 35]
An oligonucleotide corresponding to nucleotides #60 to #76 of SEQ ID NO:7 which contains 5 nucleotide differences to the corresponding region of the BMP-encoding sequence set forth in SEQ ID NO: 1 (nucleotides #672 to #689) One of the recombinant bacteriophage clones which hybridizes to the VL-1 oligonucleotide probe #8 is designated XJLDc31. This recombinant bacteriophage clone is plaque purified, a bacteriophage plate stock is made and bacteriophage DNA is isolated from the XJLDc31 human genomic clone. The bacteriophage XJLDc31 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD "ATCC" under the accession #75922 on October 20, 1994. This deposit meets the requirements of the Budapest Treaty of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. The oligonucleotide hybridizing region of this recombinant,XJLDc31, is localized to a 2.5 kb Eco fragment. This fragment is subcloned into a plasmid vector (pGEM-3) and DNA sequence analysis is performed.
This plasmid subclone is designated pGEMJLDc31/2.5 and has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD
"ATCC " under the accession # 69710 on October 20, 1994. This deposit meets the requirements of the Budapest Treaty of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder.

The partial DNA sequence (SEQ ID NO:25) and derived amino acid sequence (SEQ ID NO:26) of a portion of the 2.5 kb DNA insert of the plasmid subclone pGEMJLDc31/2.5, derived from clone XJLDc3 1, are shown in the Sequence Listings The DNA sequence of a portion of the 2.5 kb EcoRl insert of the plasmid pGEMJLDc31/2.5 is set forth in SEQ ID NO:25.
3s WO 95/16035 21 ( 9 2 PCT/US94/14030 contains an 912 bp open reading frame, as defined by nucleotides #52 through #963 of SEQ ID N :25. As this sequence is derived from a genomic clone it is difficult to determine the boundary between the 5' extent of coding sequence and the 3' limit of intervening sequence (intron/non-coding sequence). The entire open reading frame (nucleotides #52 through #963 of SEQ ID N :25) encodes a portion of the VL-1 protein of the invention of up to 304 amino acids.
Based on the knowledge of other BMP proteins and other proteins within the TGF-Q family, it is predicted that the precursor polypeptide would be cleaved at the multibasic sequence Arg-Arg-Arg-Arg in agreement with a proposed consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the VL-1 precursor polypeptide is expected to generate a 120 amino acid mature peptide beginning with the amino acid Thr at position #1 of SEQ ID N :26. The processing of VL-1 into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to the processing of the related protein TGF-0 [Gentry et al., Molec & Cell. Biol., 8:4162 (1988); Derynck et al. Nature, 316:701 (1985)].
It is contemplated therefore that the mature active species of AIL.-1 comprises a homodimer of two polypeptide subunits, each subunit comprising amino acids #1 to #120 of SEQ ID N :26 with a predicted molecular weight of approximately 12,000 daltons. Further active species are contemplated comprising at least amino acids #19 to # 119 or #120 of SEQ ID N :26, thereby including the first and last conserved cysteine residue.

Using such a method, a clone encoding the mature human AIL-1 (BMP-13) was obtained. The nucleotide sequence and corresponding amino acid sequence encoded by this clone are listed in the Sequence Listings at SEQ ID NO: 25 and 26, respectively.

Expression of B MP-12 In order to produce human BMP-12 proteins, the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques.

WO 95/16035 2l 7 6 / 4 PCTJUS94/14030 In order to produce the human BMP-12 protein in bacterial cells, the following procedure is employed.
Expression of BMP-12 in E. coli An expression plasmid pALV 1-781, for production of BMP- 12 in E. coli was constructed which contains the following principal features. Nucleotides 1-contain DNA sequences originating from the plasmid pUC-18 [Norrander et al., Gene 26:101-106 (1983)] including sequences containing the gene for (3-lactamase which confers resistance to the antibiotic ampicillin in host E. coli strains, and a colEl-derived origin of replication. Nucleotides 2061-2221 contain DNA
sequences for the major leftward promotor (pL) of bacteriophage X [Sanger et al., J.
Mol. Biol.
162:729-773 (1982)], including three operator sequences OL1, OL2 and OL3. The operators are the binding sites for XcI repressor protein, intracellular levels of which control the amount of transcription initiation from pL. Nucleotides 2222-2723 contain a strong ribosome binding sequence included on a sequence derived from nucleotides 35566 to 35472 and 38137 to 38361 from bacteriophage lambda as described in Sanger et al., J. Mol. Biol. 162:729-773 (1982). Nucleotides 2724-3041 contain a DNA sequence encoding mature BMP-12 protein with all 3' untranslated sequence removed. The BMP-12 DNA sequences introduced into the pALV1-781 expression vector were modified at the 5'end to raise the A+T
content without altering the coding capacity. These changes were made to increase the efficiency of translation initiated on the BMP-12 mRNA in E. coli. Nucleotides 3042-3058 provide a "Linker" DNA sequence containing restriction endonuclease sites. Nucleotides 3059-3127 provide a transcription termination sequence based on that of the E. coli aW A gene [Takagi et al., Nucl. Acids Res. 13:2063-2074 (1985)]. Nucleotides 3128-3532 are DNA sequences derived from pUC-18.
Plasmid pALV1-781 was transformed into the E. coli host strain G1724 (F, lacIq, 1cpL8, ampC::XcI¾) by the procedure of Dagert and Ehrlich, Gene 6:23 (1979). G1724-(ATCC accession No. 55151) contains a copy of the wild-type XcI
repressor gene stably integrated into the chromosome at the AMC locus, where it has been placed under the transcriptional control of Salmonella typhimurium try promotor/operator sequences. In G1724, XCI protein is made only during growth in tryptophan-free media, such as minimal media or a minimal medium supplemented 2 r with casamino acids such as IMC, described above. Addition of tryptophan to a culture of G1724 will repress the t p promoter and turn off synthesis of XcI, gradually causing the induction of transcription from pL promoters if they are present in the cell.
Transformants were selected on 1.5% w/v agar plates containing IMC
medium, which is composed of M9 medium [Miller, "Experiments in Molecular Genetics," Cold Spring Harbor Laboratory, New York (1972)] containing 1 mM
MgSO4 and supplemented with 0.5% w/v glucose, 0.2% w/v casamino acids and 100 g/ml ampicillin. G1724 transformed with pALVI-781 was grown at 37 C to an A550 of 0.5 in IMC medium containing 100 pg/ml ampicillin. Tryptophan was then added to a final concentration of 100 g/ml and the culture incubated for a further 4 hours. During this time BMP-12 protein accumulates within the "inclusion body" fraction.
Preparation of Protein Monomer 18 g of frozen cells were weighed out and resuspended in 60m1 of 100 mM
Tris, 10 mM EDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF], pH 8.3. Cells were lysed by 3 passes through a MicrofluidizerTM [model #MCF 100 T]. The inclusion body pellet was obtained by centrifugation at 15,000g at 4 C for 20 minutes. The supernatant was decanted, and the pellet was washed with 100 ml of 100 mM Tris, 1.0 M NaCl, 10 mM EDTA, 1 mM PMSF, pH 8.3. The suspension was centrifuged again at 15,000g at 4 C for 10 minutes, and the supernatant decanted. The pellet was then washed with 100 ml of 100 mM Tris, 10 mM EDTA, TM
I% Triton X-100, 1 mM PMSF, pH 8.3. The suspension was centrifuged again at 15,000g at 4 C for 10 minutes, and the supernatant decanted. The pellet was resuspended with 50 ml of 20 mM Tris, I mM EDTA, 1 mM PMSF, pH 8.3, containing I% DTT in a glass tissue homogenizer. Monomeric BMP-12 was then solubilized by acidification to pH 2.5 with glacial acetic acid. The soluble fraction was isolated by centrifugation at 15,000g for 20 minutes at 4 C.
The supernatant from this centrifugation was collected and chromatographed over a Sephacryl S-1001 size exclusion column (83 cm x 2.6 cm; -440 ml bed) in 20 ml increments. The Sephacryl S-100TH column was run with a mobile phase of I!% acetic acid at a flow rate of 1.4 ml/min. Fractions corresponding to 3 $' monomer were detected by absorbance at 280 nm, and using a computer calculated extinction coefficient of 18200M-1cm 1 and molecular weight (11667 daltons).
This size exclusion column pooled material was used as starting material for refolding reactions.
As an alternative to the above, 1.0 g of cells stored at -80 C are measured. Solution (3.4 ml 100 TRIS, 10 EDTA, pH 8.5) is added. The solution is vortexed until cells are well suspended. 40 l 100 mM
PMSF in isopropanol is added. The cells are lysed at 1000 psi in a French pressure cell. The inclusion bodies are centrifuged at 4 C for 20 minutes in an Eppendorf microfuge to form pellets. The supernatants are decanted. To one pellet (out of 4 total) 1.0 ml degassed 8.0 M guanidine hydrochloride, 0.5 M TRIS, 5 mM EDTA, pH 8.5, containing 250 DTT is added. The pellet is dissolved and argon is blown over the liquid for 30 seconds. Next the solution is incubated at 37'C
for one hour. Insoluble material is pelleted for 2-3 minutes in an Eppendorf microfuge at 23 C. 0.5-1.0 ml of supernatant is injected onto a Supelco 2 cm guard cartridge (LC-304), and eluted with an acetonitrile gradient in 0.1 % TFA from 1-70%
over 35 minutes. BMP-12 elutes between 29 and 31 minutes. Fractions are pooled and the protein concentration determined by adsorbance at 280 nanometers versus 0.1 %
TFA, using the theoretical extinction coefficient based upon the amino acid content.

As a second alternate method to the above, frozen cell pellets obtained from the E. coli transformants as described above are thawed in 30 ml of TE8.3(100:
10) buffer (100 Tris-HCl pH 8.3, 10 Na2EDTA, 1 PMSF). Cells are lysed by three passes through a MicrofluidizerTM [model #MCF 100 T]. The initial inclusion body material pellet is dissolved in 8 M guanidine-HCI, TE8.5(100:10) buffer (100 Tris-HC1 pH 8.5, 10 Na2EDTA which contained 100 DTT, and incubated at 37 C for 1 hour. This material is centrifuged at 12,000 x g for 15 minutes at room temperature.
Refolding of B -12 protein using CHAPS system A sufficient volume of the BMP-12 pool is lyophilized to give 10 jig of protein. 5 l of glass distilled water is added to redissolve the residue, then 100 Al of refold mix (50 Tris, 1.0 M NaCl, 2% 3-(3-chlolamido-3`1 propyl)dimethylammonio-l-propane-sulfate (CHAPS). 5 mM EDTA, 2 mM
glutathione (reduced) 1 mM glutathione (oxidized); at pH of approximately 8.5).
The solution is gently mixed and stored at 23 C for 1-4 days. Dinner formation is assessed by running an aliquot on a Novex 16% tricine gel at 125 volts for 2.5 hours, followed by Coomassie Blue staining and destaining.

EMP-12 dimer was purified using a C4 analytical RP-HPLC (reversed phase-high performance liquid chromatography) column (Vydac 214TP54) which was equilibrated to 1% B buffer (diluted into A buffer) and was run over 35 minutes, during which the protein elutes, using the following gradient (A buffer = 0.1%
trifluoroacetic acid, B buffer = 95 % acetonitrile, 0.1 % trifluoroacetic acid [TPA]), with a flow rate of 1 ml/min:
1-5 minutes 20 % B buffer 5-10 minutes 20-30% B buffer 10-30 minutes 30-50% B buffer 30-35 minutes 50-100% B buffer Protein was monitored by absorbance at 280nm. Peak BMP-12 fractions (eluting between 29 and 31 minutes) were pooled. Purity was assessed by SDS-PAGE. The concentration was determined by absorbance at 280nm, and using the computer calculated extinction coefficient and molecular weight as indicated above.
Expression of P-12 in mammalian cells:
Another contemplated preferred expression system for biologically active recombinant human BMP-12 is stably transformed mammalian cells.

One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 1, or other DNA sequences encoding BMP-12 proteins or other modified sequences and known vectors, such as pCD
[Okayama et al., Mol. Cell Biol., 2:161-170 (1982)], pJL3, pJLA [Gough et al., EMBO J., 4:645-653 (1985)] and pMT2 CXM.
The mammalian expression vector pMT2 CXM is a derivative of p91023(b) (Wong et al., Science 228:810-815, 1985) differing from the latter in that it contains the atnpicillin resistance gene in place of the tetracycline resistance gene and further contains a Xhol site for insertion of cDNA clones. The functional elements of pMT2 CXM have been described (Kaufman, R.J., 1985, Proc. Natl. Acad. Sci.
o USA 82:689-693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 5' splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences needed for propagation in E. coll.
Plasmid pMT2 CXM is obtained by EcoRl digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under accession number ATCC 67122. EcoRl digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. coli HE 101 or DH-5 to ampicillin resistance.
Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout/in mutagenesis [Morinaga, et al., Biotechnology 54:

(1984). This removes bases 1075 to 1145 relative to the Hind III site near the origin of replication and enhancer sequences of pMT2. In addition it inserts a sequence containing the recognition site for the restriction endonuclease Xho I. A
derivative of pMT2CXM, termed pMT23, contains recognition sites for the restriction endonucleases PstI, Eco RI, Sall and Xhol. Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods.
pEMC201 derived from pMT21 may also be suitable in practice of the invention. pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear form which can be ligated and used to transform E.
Coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods.
pMT21 is derived from pMT2 through the following two modifications.
First, 76 bp of the 5' untranslated region of the DHFR cDNA including a stretch of 19 G residues from G/C tailing for cDNA cloning is deleted. In this process, a Xhol site is inserted to obtain the following sequence ' immediately upstream from DHFR. Second, a unique Clal site is introduced by digestion with EcoRV and Xbal, treatment with Klenow fragment of DNA polymerase I, and ligation to a C1aI
linker (CATCGATG). This deletes a 250 bp segment from the adenovirus associated RNA
5 217 6 I 'Q PCTJUS94/14030 (VAI) region but does not interfere with VAI RNA gene expression or function.
pMT21 is digested with EcoRI and Xhol, and used to derive the vector pEMC2B1.
A portion of the EMCV leader is obtained from pMT2-ECAT1 [S.K. Jung, et al, J. Virol 63:1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a 2752 bp fragment. This fragment is digested with Tagl yielding an Eco RI-TaqI
fragment of 508 bp which is purified by electrophoresis on low melting agarose gel.
A 68 bp adapter and its complementary strand are synthesized with a 5' TaqI
protruding end and a 3' oI protruding end which has a sequence which matches the EMC virus leader sequence from nucleotide 763 to 827. It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a oI site. A three way ligation of the pMT21 Eco RI-Xhol fragment, the EMC
virus EcoRl-Tagl fragment, and the 68 bp oligonucleotide adapter Tagl-Xhol adapter resulting in the vector pEMC201.

This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, DHFR and fl-lac ase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.

The construction of vectors may involve modification of the BMP-12 DNA
sequences. For instance, BMP-12 cDNA can be modified by removing the non-coding nucleotides on the 5' and 3' ends of the coding region. The deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expression, These vectors are transformed into appropriate host cells for expression of BMP-12 proteins. Additionally, the sequence of SEQ ID N0:1 or other sequences encoding BMP-12 proteins can be manipulated to express BMP-12 protein by isolating the mature coding sequence of nucleotides 571 to 882 of SEQ
ID NO:1 and adding at the 5' end sequences encoding the complete propeptides of other BMP proteins.

For example, one skilled in the art can make a fusion protein in which the propeptide of BMP-2 is linked in operable fashion to the mature BMP-12 peptide by preparing a DNA vector in which the DNA sequence encoding the BMP-2 propeptide is linked in proper reading frame to the DNA sequence encoding the mature BMP-12 peptide. The DNA sequence of such a fusion protein is shown in SEQUENCE ID NO:27.
One skilled in the art can manipulate the sequences of SEQ ID NO: 1 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells, as described above. As another example, the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences therefrom or altering nucleotides therein by other known techniques). The modified BMP-12 coding sequence could then be inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA, 77:5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a BMP-12 protein expressed thereby. For a strategy for producing extracellular expression of BMP-12 proteins in bacterial cells, see, e.g.
European patent application EPA 177,343.
Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures described in published European patent application 155,476] for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells. [See, e.g., procedures described in published PCT application W086/00639 and European patent application EPA
123,289].
A method for producing high levels of a B MP-12 protein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous BIM-12 gene. The heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J.
Mol.
Biol., 159:601-629 (1982). This approach can be employed with a number of different cell types.
4e3 For example, a plasmid containing a DNA sequence for a BMP-12 of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol., 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO
cells, D -BII, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol., 5:1750 (1983). Transformants are cloned, and biologically active BMP-12 expression is monitored by the Rosen-modified Sampath-Reddi rat assay described below in Example 5. BMP-12 expression should increase with increasing levels of MTX resistance. BMP-12 polypeptides are characterized using standard techniques known in the art such as pulse labeling with [35S]
methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related BMP-12 proteins.

Preparation of BMP-2 propeptide/BMP-12 mature peptide fusion In order to construct a vector encoding the BMP-2 propeptide/BMP-12 mature peptide fusion, the following cloning procedure was used to fuse the two sequences together.

First, a DNA restriction enzyme fragment comprising the propeptide of human BMP-2 protein, comprising nucleotides 1 through 843 of SEQ ID NO:27 is cut from pBMP2AEMC. pB P2 EMC is a plasmid derived from lambda U20S-39 (ATCC #40345) comprising the entire coding sequence for human BMP-2 protein with the non-translated 5' and 3' sequences of BMP-2 deleted from the vector.
The 5' restriction enzyme used was Bgl II and it cuts pBMP2 EMC in the vector at nucleotide 979. The 3' restriction enzyme used was Mae II and it cuts pB P2 EMC in the BMP-2 propeptide at nucleotide 1925, just short of the carboxy terminus. The resulting 954 base pair product was then gel isolated and gene cleaned. Second, a DNA restriction enzyme fragment comprising the 5' portion of the human BMP-12 mature peptide DNA sequence, is cut from pPCR1-1#2 V1-1 WO 95/16035 21 7 6 9 4 2 PC'T/US94114030 (ATCC #69517). The 5' restriction enzyme used was Eae I and it cuts pPCR1-1#2 V1-1 just 3' of N-terminus of the human BMP-12 mature peptide sequence. The resulting 259 base pair product was gel isolated and gene cleaned. Third, two DNA
oligos were designed and synthesized, so that when annealed would form a tiny DNA fragment comprising fusion sequence of the extreme 3' end of the human BMP-2 propeptide and the 5' end of BMP-12 mature peptide. The DNA fragment has a 5' Mae II complimentary sticky end which anneals to the 3' restriction enzyme fragment comprising the human BMP-2 propeptide. The annealed oligo DNA
fragment has a 3' Eae I complimentary sticky end which anneals to the 5' of the restriction enzyme fragment comprising the mature peptide of human BMP-12. The coding strand oligo is named B2/12 and is 13 base pairs long. Next, a DNA
fragment encoding the 123 base pairs at the 3' end of the BMP-12 mature peptide fragment was obtained as follows. First, a DNA fragment comprising the propeptide of human BMP-2 protein, comprising nucleotides 1 through 846 is PCR amplified from pBMP2 EMC. The 5' primer (oligo 655a) anneals just 5' of the polylinker.
The 3' primer (BMPpro3) anneals to the BMP-2 propeptide 3' end and introduces a Bgl II restriction enzyme site by silent sequence mutations. The resulting PCR
product was cut with Sal I, which cleaves in the polylinker, and Bgl II. The base pair restriction enzyme fragment (ending in amino acid sequence KR) was gel isolated and gene cleaned. The BMP-12 mature peptide was PCR amplified using a 5' primer (oligo 5-1) encoding the Bgl II restriction enzyme site by silent sequence mutations, and annealing to the 5' end of a possible mature cleavage product, beginning with amino acid sequence SRCS. The 3' primer (V1-1 3) anneals to the BMP-12 mature peptide 3' end and introduces a Xba I restriction enzyme site after the stop codon. The resulting PCR product was cut with Bgl II and Xba I.
The 321 base pair restriction enzyme fragment was gel isolated and gene cleaned.
The two restriction fragments were three-way ligated into a previously Sall and Xbal cut vector. The resultant construct was sequenced to check for PCR
induced errors and a silent C to. T mutation was observed at base pair 185 in the propeptide. This plasmid was designated pREKRSRC. Then pREKRSRC was cut with BgllI and NgoMI, and the vector fragment encompassing the last 123 base pairs of the BMP12 mature sequence was thereby isolated. The three restriction fragments qs-and the annealed oligolinker were four-way ligated to yield pREKR-TAL with the BMP-2 propeptide with the mature cleavage site at the 3' end fused to the (TAI.,) 5' end of the BMP-12 mature peptide. The coding sequence of the resulting ligated vector is shown in SEQ ID N :27.

Biological Activity of Expressed BMP-12 To measure the biological activity of the expressed BMP-12 proteins obtained in Example 2 above, the proteins are recovered from the cell culture and purified by isolating the BMP-12 proteins from other proteinaceous materials with which they are co-produced as well as from other contaminants. The purified protein may be assayed in accordance with the rat assay described below in Example 5.
Purification is carried out using standard techniques known to those skilled in the art.

Protein analysis is conducted using standard techniques such as SIBS-PAGE
acrylamide [Laemmli, Nature 227:650 (1970)] stained with Coomassie Blue or silver [Oakley, et al. Anal. Biochem. 105:361 (1980)] and by immunoblot [Towbin, et al.
Proc. Natl. Acad. Sci. USA 76:4350 (1979)]
Example 5 ROSEN M I) D S PATH- DDI ASSAY
A modified version of the rat ectopic implant assay described in Sampath and Reddi, Proc. Natl. Acad. Sci. USA, 80:6591-6595 (1983) is used to evaluate the activity of the BMP-12 proteins. This modified assay is herein called the Rosen-modified Sampath-Reddi assay. The assay has been widely used to evaluate the bone and cartilage-inducing activity of BMPs. The ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialyzing (if the composition is a solution) or diafiltering (if the composition is a suspension) the fraction to be assayed against water. The solution or suspension is then equilibrated to 0.1 % TEA. The resulting solution is added to 20 mg of rat matrix. A mock rat matrix sample not treated with the protein serves as a control. This material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules. The capsules are implanted subcutaneously in the abdominal thoracic area of 21-49 day old male Long Evans rats. The implants are removed after 10 days. A section of each implant is fixed WO 95/16035 PCTIUS94l14030 and processed for histological analysis. 1 m glycolmethacry late sections are stained with Von Kossa and acid fuschin to score the amount of induced tendon/ligament-like tissue formation present in each implant.
BMP-12 was implanted in the rats in doses of 1, 5, 25 and 50 g per implant for 10 days. BMP-2 at a dose of 5 g was included as a positive control. For all doses of BMP-12 tested, no bone or cartilage formation was observed in the implants after ten days. Instead, the implants were filled with tissue resembling embryonic tendon, which is easily recognized by the presence of dense bundles of fibroblasts oriented in the same plane and packed tightly together. [Tendon/ligament-like tissue is described, for example, in Ham and Cormack, Histology (3B Lippincott Co.
(1979), pp. 367-369.
These findings were reproduced in a second set of assays in which tendon/ligament-like tissues was present in all BMP-12 containing implants. In contrast, the implants, as expected, showed cartilage and bone formation, but contained no tendon/ligament-like tissue.
The BMP-12 proteins and related proteins of this invention may be assessed for activity on this assay.
Example 6 Using methods in accordance with the above examples, with minor modifications within the skill of the art, human MP52 protein and the murine homologue of BMP-13 protein were expressed and assayed for tendon/ligament-like tissue inducing activity. All proteins showed comparable results, similar to those described above for human BMP-12.
The foregoing descriptions detail presently preferred embodiments of the, present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these descriptions.
Those modifications and variations are believed to be encompassed within the claims appended hereto.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: GENETICS INSTITUTE, INC.
PRESIDENT AND FELLOWS OF HARVARD COLLEGE
(ii) TITLE OF INVENTION: TENDON-INDUCING COMPOSITIONS
(iii) NUMBER OF SEQUENCES: 35 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: GENETICS INSTITUTE, INC.
(B) STREET: 87 CambridgePark Drive (C) CITY: Cambridge (D) STATE: Massachusetts (E) COUNTRY: USA
(F) ZIP: 02140 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Herewith (C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/164,103 (B) FILING DATE: 07-DEC-1993 (C) APPLICATION NUMBER: US 08/217,780 (D) FILING DATE: 25-MAR-1994 (E) APPLICATION NUMBER: US 08/333,576 (F) FILING DATE: 02-NOV-1994 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Lazar, Steven R.
(B) REGISTRATION NUMBER: 32,618 (C) REFERENCE/DOCKET NUMBER: 5202D-PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 617 498-8260 (B) TELEFAX: 617 876-5851 (2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 926 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (vii) IMMEDIATE SOURCE:
(B) CLONE: vl-1 (ix) FEATURE:
(A) NAME/KEY: mat peptide (B) LOCATION: 571..882 (ix) FEATURE:
(A) NAME/KEY: CDS

'0 95/16035 21 7 6 9 4 2 PCT/US94/14030 (B) LOCATION: 1.,882 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

Ala Arg Asn Thr Thr His Tyr Arg Ala Asn Trp Val Arg Gly Pro Gly Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro Gly Ala Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val Gly Gln Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His Arg Arg Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu Leu Arg Ala Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu Val Val Ser Ser Arg Thr Gln Arg Lys Glu Ser Leu Phe Arg Glu Ile Arg Ala Gln Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu Pro Asp Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val Ile Gly Gly Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gln Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp GAC TGG ATC ATC GCG CCG CTG' GAC TAC GAG GCG TAC CAC TGC GAG GGC 672 Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Ply Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 294 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Ala Arg Asn Thr Thr His Tyr Arg Ala Asn Trp Val Arg Gly Pro Giy Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro Gly Ala Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val Gly Gln Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His Arg Arg Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu Leu Arg Ala Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu Val Val Ser Ser Arg Thr Gin Arg Lys Glu Ser Leu Phe Arg Glu Ile Arg Ala Gln Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu Pro Asp Pro Gly Thr'Gly Thr Ala Ser Pro Arg Ala Val Ile Gly Gly Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gln Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg 'NO 95/16035 217 6 9 2 PCTIUS94/14030 Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1207 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (vii) IMMEDIATE SOURCE:
(B) CLONE: MP52 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 845..1204 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

WO 95/16035 21 ( 6 4 PCT/US94/14030 Ala Pro Leu Ala Thr Arg Gln Gly Lys Arg Pro Ser Lys Asn Leu Lys Ala Arg Cys Ser Arg Lys Ala Leu His Val Asn Phe Lys Asp Met Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Val Ile Gin Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro Ile Ser Ile Leu Phe Ile Asp Ser Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 120 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Ala Pro Leu Ala Thr Arg Gln Gly Lys Arg Pro Ser Lys Asn Leu Lys Ala Arg Cys Ser Arg Lys Ala Leu His Val Asn Phe Lys Asp Met Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Val Ile.Gln Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro Ile Ser Ile Leu Phe Ile Asp Ser Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 128 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (vii) IMMEDIATE SOURCE:
(B) CLONE: Vi-1 fragment (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 28..102 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn (2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 128 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear i (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (vii) IMMEDIATE SOURCE:
(B) CLONE: VL-1 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 28..102 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn (2) INFORMATION FOR SEQ ID NO:B:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn (2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3585 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: pALV1-781 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

TGATACGAAA CGAAGCATTG GCCGTAAGTG CGATTCCGGA TTAGCTGCCA ATGTGCCAAT '2400 (2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 272 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: mouse (vii) IMMEDIATE SOURCE:
(B) CLONE: mVI

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 28..243 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys (2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 72 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 272 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE : DNA (genomi c ) (vi) ORIGINAL SOURCE:
(A) ORGANISM: mouse (vii) IMMEDIATE SOURCE:
(B) CLONE: mV2 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 28..243 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro Ile Ser Ile Leu Tyr Ile Asp Ala Gly Asn Asn Val Val Tyr Lys (2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 72 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro Ile Ser Ile Leu Tyr Ile Asp Ala Gly Asn Asn Val Val Tyr Lys (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 272 base pairs (B) TYPE: nucleic acid.
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) lzre (vi) ORIGINAL SOURCE:
(A) ORGANISM: mouse (vii) IMMEDIATE SOURCE:
(B) CLONE: mV9 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 28..243 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Val Ile Gln Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro Ile Ser Ile Leu Phe Ile Asp Ser Ala Asn Asn Val Val Tyr Lys (2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 72 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Phe His Cys Glu Gly Leu Cys Glu Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Val Ile Gln Thr Leu Met Asn Ser Met Asp Pro Glu Ser Thr Pro Pro Thr Cys Cys Val Pro Thr Arg Leu Ser Pro Ile Ser Ile Leu Phe Ile Asp Ser Ala Asn Asn Val Val Tyr Lys (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids , (B) TYPE: amino acid ,3,o7 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (vi) ORIGINAL SOURCE:
(A) ORGANISM: BMP/TGF-beta consensus sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Trp Xaa Asp Trp Ile Xaa Ala (2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: oligonucleotide #1 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (vii) IMMEDIATE SOURCE:
(B) CLONE: BMP/TGF-beta consensus sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1B:

His Ala Ile Xaa Gln Thr (2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear .

(ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: oligonucleotide #2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: oligonucleotide #3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(A) LIBRARY: oligonucleotide #4 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

(2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: oligonucleotide #5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single bar WO 95/16035 ? 7 6 9 4 2 PCTIUS94/14030 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(A) LIBRARY: oligonucleotide #6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: oligonucleotide #7 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

(2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1171 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: Human VL-1 protein (ix) FEATURE :
(A) NAME/KEY: CDS
(B) LOCATION: 2..964 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 605..964 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

Asn Ser Asp Leu Ser His Thr Pro Leu Arg Arg Gln Lys Tyr Leu TTT GAT GTG TCC ATG CTC TCA GAC AAA GAP. GAG CTG GTG GGC GCG GAG 94 Phe Asp Val Ser Met Leu Ser Asp Lys Glu Glu Leu Val Gly Ala Glu Leu Arg Leu Phe Arg Gln Ala Pro Ser Ala Pro Trp Gly Pro Pro Ala Gly Pro Leu His Val Gin Leu Phe Pro Cys Leu Ser Pro Leu Leu Leu Asp Ala Arg Thr Leu Asp Pro Gln Gly Ala Pro Pro Ala Gly Trp Glu Val Phe Asp Val Trp Gln Gly Leu Arg His Gln Pro Trp Lys Gln Leu Cys Leu Glu Leu Arg Ala Ala Trp Gly Glu Leu Asp Ala Gly Glu Ala Glu Ala Arg Ala Arg Gly Pro Gln Gln Pro Pro Pro Pro Asp Leu Arg Ser Leu Gly Phe Gly Arg Arg Val Arg Pro Pro Gln Glu Arg Ala Leu Leu Val Val Phe Thr Arg Ser Gln Arg Lys Asn Leu Phe Ala Glu Met Arg Glu Gln Leu Gly Ser Ala Glu Ala Ala Gly Pro Gly Ala Gly Ala Glu Gly Ser Trp Pro Pro Pro Ser Gly Ala Pro Asp Ala Arg Pro Trp Leu Pro Ser Pro Gly Arg Arg Arg Arg Arg Thr Ala Phe Ala Ser Arg His Gly Lys Arg His Gly Lys Lys Ser Arg Leu Arg Cys Ser Lys Lys Pro Leu His Val Asn Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro Ile Ser Ile Leu Tyr Ile Asp Ala Gly Asn 90 95 (03 100 Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:26:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 321 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

Asn Ser Asp Leu Ser His Thr Pro Leu Arg Arg Gln Lys Tyr Leu Phe Asp Val Ser Met Leu Ser Asp Lys Glu Glu Leu Val Gly Ala Glu Leu Arg Leu Phe Arg Gln Ala Pro Ser Ala Pro Trp Gly Pro Pro Ala Gly Pro Leu His Val Gln Leu Phe Pro Cys Leu Ser Pro Leu Leu Leu Asp Ala Arg Thr Leu Asp Pro Gln Gly Ala Pro Pro Ala Gly Trp Glu Val Phe Asp Val Trp Gln Gly Leu Arg His Gln Pro Trp Lys Gln Leu Cys Leu Glu Leu Arg Ala Ala Trp Gly Glu Leu Asp Ala Gly Glu Ala Glu Ala Arg Ala Arg Gly Pro Gln Gln Pro Pro Pro Pro Asp Leu Arg Ser Leu Gly Phe Gly Arg Arg Val Arg Pro Pro Gln Glu Arg Ala Leu Leu Val Val Phe Thr Arg Ser Gln Arg Lys Asn Leu Phe Ala Glu Met Arg Glu Gln Leu Gly Ser Ala Glu Ala Ala Gly Pro Gly Ala Gly Ala Glu Gly Ser Trp Pro Pro Pro Ser Gly Ala Pro Asp Ala Arg Pro Trp Leu Pro Ser Pro Gly Arg Arg Arg Arg Arg Thr Ala Phe Ala Ser Arg His Gly Lys Arg His Gly Lys Lys Ser Arg Leu Arg Cys Ser Lys Lys Pro 15 coq 20 Leu His Val Asn Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro Ile Ser Ile Leu Tyr Ile Asp Ala Gly Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1233 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: DNA encoding BMP2 propeptide/BMP-12 mature peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1233 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 847 .1233 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gln Val Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gln Pro Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys Gln Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met. Leu -2:L5 -210 -205 Asp Leu Tyr Arg Arg His Ser Gly Gln Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser Ile Pro Thr Glu Glu Phe Ile Thr Ser Ala Glu Leu Gln Val Phe Arg Glu Gln Met Gln Asp Ala Leu Gly Asn Asn Ser Ser Phe His His Arg Ile Asn Ile Tyr Glu Ile Ile Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu Asp Thr Arg Leu Val Asn Gln Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Pro Ala Val Met Arg Trp Thr Ala Gln Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gln Gly Val Ser Lys Arg His Val Arg Ile Ser Arg Ser Leu His Gln Asp Glu His Ser Trp Ser Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gln Gly Ser Giy Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu NO 95/16035 21, 7 9 4 PC IUS94114030 Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 411 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gin Val Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gln Pro Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys Gin Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu Asp Leu Tyr Arg Arg His Ser Gly Gln Pro Gly Ser Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser Ile Pro Thr Glu Glu Phe Ile Thr Ser Ala Glu Leu Gln Val Phe Arg Glu Gin Met Gln Asp Ala Leu Gly Asn Asn Ser Ser Phe His His Arg Ile Asn Ile Tyr Glu Ile Ile Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu Asp Thr Arg Leu Val Asn Gln Asn Ala Ser Arg Trp Glu Ser Phe Asp 1P r f -' WO 95/16035 2 f 6' 9 4 PCTJUS94/14030 Val Thr Pro Ala Val Met Arg Trp Thr Ala Gln Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gln Gly Val Ser Lys Arg His Val Arg Ile Ser Arg Ser Leu His Gin Asp Glu His Ser Trp Ser Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gin Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1203 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vii) IMMEDIATE SOURCE:
(B) CLONE: murine MV1 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..721 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

Lys Phe Cys Leu Val Leu X01 X02 Val Thr Ala Ser Glu Ser X03 X04 Leu Ala Leu Arg Arg Leu Gly Phe Gly X05 Pro Gly Gly Gly Asp Gly Gly Gly Thr Ala X06 Glu Glu Arg Ala Leu Leu Val Ile Ser Ser Arg Thr Gln Arg Lys Glu Ser Leu Phe Arg Glu Ile Arg Ala Gln Ala Arg Ala Leu Arg Ala Ala Ala Glu Pro Pro Pro Asp Pro Gly Pro Gly Ala Gly Ser Arg Lys Ala Asn Leu Gly Gly Arg Arg Arg Gln Arg Thr Ala Leu Ala Gly Thr Arg Gly X07 X08 Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Gly Arg Lys Ser Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg GAGTGCACTG CAGGGCTGGG ATACCCAGAT TC T gTGGAGT GGGCATTGGG AACCTTCAAA 1131 WO 95/16035 21 ! 6 9 l PC B 594/14030 (2) INFORMATION FOR SEQ ID NO:30:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 240 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

Lys Phe Cys Leu Val Leu X01 X02 Val Thr Ala Ser Glu Ser X03 X04 Leu Ala Leu Arg Arg Leu Gly Phe Gly X05 Pro Gly Gly Gly Asp Gly Gly Gly Thr Ala X06 Glu Glu Arg Ala Leu Leu Val Ile Ser Ser Arg Thr Gln Arg Lys Glu Ser Leu Phe Arg Glu Ile Arg Ala Gln Ala Arg Ala Leu Arg Ala Ala Ala Glu Pro Pro Pro Asp Pro Gly Pro Gly Ala Gly Ser Arg Lys Ala Asn Leu Gly Gly Arg Arg Arg Gln Arg Thr Ala Leu Ala Gly Thr Arg Gly X07 X08 Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Gly Arg Lys Ser Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:31:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1046 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vii) IMMEDIATE SOURCE:
(B) CLONE: MURINE MV2 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 2..790 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:

Arg Lys Gin Ala Cys Ile Pro Ala Gly Pro Thr Leu Arg Gly Ser Ser Gly Thr Gin Pro Arg Pro Ala Gly Lys Ser Phe Asp Val Trp Gln Gly Leu Arg Pro Gln Pro Trp Lys Gln Leu Cys Leu Glu Leu Arg Ala Ala Trp Gly Glu Leu Asp X01 Gly Asp Thr Gly Ala Arg Ala Arg Gly Pro Gln Gln Pro Pro Pro Leu Asp Leu Arg Ser Leu Gly Phe Gly Arg Arg Val Arg Pro Pro Gln Glu Arg Ala Leu Leu Val Val Phe Thr Arg Ser Gln Arg Lys Asn Leu Phe Thr Glu Met His Glu Gln Leu Gly Ser Ala Glu Ala Ala Gly Ala Glu Gly Ser Cys Pro Ala Pro Ser Gly Ser Pro Asp Thr Gly Ser Trp Leu Pro Ser Pro Gly Arg Arg Arg Arg Arg Thr Ala Phe Ala Ser'Arg His Gly Lys Arg His Gly Lys Lys Ser Arg Leu Arg Cys Ser Arg Lys Pro Leu His Val Asn Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys WO 95/16035 21 " 6 9 4 2 PCTfUS94/14030 Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro Ile Ser Ile Leu Tyr Ile Asp Ala Gly Asn Asn X02 Val Tyr Lys Gin Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:32:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 263 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

Arg Lys Gln Ala Cys Ile Pro Ala Gly Pro Thr Leu Arg Gly Ser Ser Gly Thr Gln Pro Arg Pro Ala Gly Lys Ser Phe Asp Val Trp Gln Gly Leu Arg Pro Gln Pro Trp Lys Gln Leu Cys Leu Glu Leu Arg Ala Ala Trp Gly Glu Leu Asp X01 Gly Asp Thr Gly Ala Arg Ala Arg Gly Pro Gln Gln Pro Pro Pro Leu Asp Leu Arg Ser Leu Gly Phe Gly Arg Arg Val Arg Pro Pro Gln Glu Arg Ala Leu Leu Val Val Phe Thr Arg Ser Gln Arg Lys Asn Leu Phe Thr Glu Met His Glu Gln Leu Gly Ser Ala Glu Ala Ala Gly Ala Glu Gly Ser Cy(s Pro Ala Pro Ser Gly Ser Pro Asp Thr Gly Ser Trp Leu Pro Ser Pro Gly Arg Arg Arg Arg ArgThr WO 95/16035 2176942 PCTfUS94114030 Ala Phe Ala Ser Arg His Gly Lys Arg His Gly Lys Lys Ser Arg Leu Arg Cys Ser Arg Lys Pro Leu His Val Asn Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Glu Tyr Glu Ala Tyr His Cys Glu Gly Val Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Met Asn Ser Met Asp Pro Gly Ser Thr Pro Pro Ser Cys Cys Val Pro Thr Lys Leu Thr Pro Ile Ser Ile Leu Tyr Ile Asp Ala Gly Asn Asn X02 Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ser Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:33:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1345 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vii) IMMEDIATE SOURCE:
(B) CLONE: HUMAN Vi-i (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 138..1301 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 990..1301 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:

Pro.Gly Arg Arg Arg Pro Leu Leu Trp'Ala Arg Leu Ala Ala Phe Arg Leu Gly Gln Arg Arg Gly Val G1y Arg Trp Leu Gln Gln Ala Trp Leu Pro His Arg Arg Gln Leu Gly His Leu Leu Leu Gly Gly Pro Ala Leu Thr Val Cys Arg Ile Cys Ser Tyr Thr Ala Leu Ser Leu Cys Pro Cys Arg Ser Pro Ala Asp Glu Ser Ala Ala Glu Thr Gly Gln Ser Phe Leu Phe Asp Val Ser Ser Leu Asn Asp Ala Asp Glu Val Val Gly Ala Glu Leu Arg Val Leu Arg Arg Gly Ser Pro Glu Ser Gly Pro Gly Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro Gly Ala Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val Gly Gln Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His Arg Arg Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu Leu Arg Ala Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu Val Val Ser Ser Arg Thr Gln Arg Lys Glu Ser Leu Phe Arg Glu Ile Arg Ala Gln Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu Pro Asp Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val Ile Gly Gly Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gln Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg=Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Glu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu. Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:34:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 388 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

Pro Gly Arg Arg Arg Pro Leu Leu Trp Ala Arg Leu Ala Ala Phe Arg Leu Gly Gln Arg Arg Gly Val Gly Arg Trp Leu Gln Gin Ala Trp Leu Pro His Arg Arg Gln Leu Gly His Leu Leu Leu Gly Gly Pro Ala Leu Thr Val Cys Arg Ile Cys Ser Tyr Thr Ala Leu Ser Leu Cys Pro Cys Arg Ser Pro Ala Asp Glu Ser Ala Ala Glu Thr Gly Gln Ser Phe Leu Phe Asp Val Ser Ser Leu Asn Asp Ala Asp Glu Val Val Gly Ala Glu Leu Arg Val Leu Arg Arg Gly Ser Pro Glu Ser Gly Pro Gly Ser Trp Thr Ser Pro Pro Leu Leu Leu Leu Ser Thr Cys Pro Gly Ala Ala Arg Ala Pro Arg Leu Leu Tyr Ser Arg Ala Ala Glu Pro Leu Val Gly Gln Arg Trp Glu Ala Phe Asp Val Ala Asp Ala Met Arg Arg His Arg Arg WO 95/16035 L 11 7 6! PCTIUS94/14030 Glu Pro Arg Pro Pro Arg Ala Phe Cys Leu Leu Leu Arg Ala Val Ala Gly Pro Val Pro Ser Pro Leu Ala Leu Arg Arg Leu Gly Phe Gly Trp Pro Gly Gly Gly Gly Ser Ala Ala Glu Glu Arg Ala Val Leu Val Val Ser Ser Arg Thr Gln Arg Lys Glu Ser Leu Phe Arg Glu Ile Arg Ala Gln Ala Arg Ala Leu Gly Ala Ala Leu Ala Ser Glu Pro Leu Pro Asp Pro Gly Thr Gly Thr Ala Ser Pro Arg Ala Val Ile Gly Gly Arg Arg Arg Arg Arg Thr Ala Leu Ala Gly Thr Arg Thr Ala Gln Gly Ser Gly Gly Gly Ala Gly Arg Gly His Gly Arg Arg Gly Arg Ser Arg Cys Ser Arg Lys Pro Leu His Val Asp Phe Lys Glu Leu Gly Trp Asp Asp Trp Ile Ile Ala Pro Leu Asp Tyr Giu Ala Tyr His Cys Glu Gly Leu Cys Asp Phe Pro Leu Arg Ser His Leu Glu Pro Thr Asn His Ala Ile Ile Gln Thr Leu Leu Asn Ser Met Ala Pro Asp Ala Ala Pro Ala Ser Cys Cys Val Pro Ala Arg Leu Ser Pro Ile Ser Ile Leu Tyr Ile Asp Ala Ala Asn Asn Val Val Tyr Lys Gln Tyr Glu Asp Met Val Val Glu Ala Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) ST EDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) INDIVIDUAL ISOLATE: primer number 8 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:

Claims (37)

What is claimed is
1. A DNA molecule comprising an isolated DNA sequence encoding a BMP-12 protein characterized by the ability to induce the formation of tendon and or ligament tissue, wherein the DNA sequence is selected from the group consisting of:
(a) nucleotides 496, 571, or 577 to 882 of SEQ ID NO:1; and (b) equivalent degenerative codon sequences of (a).
2. A DNA molecule comprising an isolated DNA sequence encoding a BMP-12 protein characterized by the ability to induce the formation of tendon and/or ligament tissue, wherein the DNA sequence comprises nucleotides encoding amino acids -25, 1, or 3 to 104 of SEQ ID NO: 2.
3. A host cell transformed with a DNA molecule of claim 1.
4. A vector comprising a DNA molecule of claim 1 operatively linked with an expression control sequence.
5. A host cell transformed with the vector of claim 4.
6. A method of producing a purified BMP-12 protein, said method comprising the steps of:
(a) culturing a host cell transformed with a DNA molecule according to claim 1, comprising a nucleotide sequence encoding a BMP-12 protein; and (b) recovering and purifying said BMP-12 protein from the culture medium.
7. A purified polypeptide comprising an amino acid sequence selected from the group consisting of:
(a) amino acids -25 to 104 of SEQ ID NO:2;
(b) amino acids 1 to 104 of SEQ ID NO:2; and (c) amino acids 3 to 104 of SEQ ID NO:2.
8. A purified protein comprising a dimer of two subunits of a polypeptide of claim 7.
9. A purified protein produced by the steps of (a) culturing a cell transformed with a DNA molecule comprising the nucleotide sequence from nucleotides 496, 571, and 577 to 882 of SEQ ID
NO:1, and (b) recovering and purifying from the cell culture a protein comprising an amino acid sequence from amino acids -25, 1, and 3 to 104 of SEQ ID
NO:2.
10. A purified protein produced by the steps of (a) culturing a cell transformed with a DNA molecule comprising the nucleotide sequence from nucleotides 496, 571, or 577 to 882 of SEQ ID
NO:1, and (b) recovering and purifying from the cell culture a protein comprising an amino acid sequence from amino acids -25, 1, or 3 to 104 of SEQ ID
NO:2.
11. A pharmaceutical composition comprising an effective amount of a BMP-12 protein of claim 7 in admixture with a pharmaceutically acceptable carrier.
12. A use of an effective amount of the composition of claim 11, for treating a tendon or ligament defect in a subject in need of same.
13. A use of an effective amount of the composition of claim 11, for the preparation of a medicament treating a tendon or ligament defect in a subject in need of same.
14. The use of claim 12 or 13, wherein the tendon or ligament defect is tendinitis.
15. A chimeric DNA molecule comprising a DNA sequence encoding a propeptide from a member of the TGF-.beta. superfamily of proteins linked in correct reading frame to a DNA sequence of claim 1.
16. A chimeric DNA molecule according to claim 15, wherein the propeptide is the propeptide from BMP-2.
17. A heterodimeric protein molecule comprising one monomer having an amino acid sequence of a polypeptide of claim 7, and one monomer having the amino acid sequence of a protein of the TGF-.beta. superfamily.
18. A use of an effective amount of a composition comprising a protein encoded by a DNA sequence selected from the group consisting of:
(a) nucleotides 496, 571, or 577 to 882 of SEQ ID NO: 1;
(b) nucleotides 845 or 899 to 1204 of SEQ ID NO:3;
(c) nucleotides 605 or 659 to 964 of SEQ ID NO:25, and (d) sequences which hybridize to the complement of (a), (b) or (c) under stringent hybridization conditions of washing in 0.2x SSC, 0.1% SDS at 65°C and encode a protein which exhibits the ability to form tendon and/or ligament tissue, for inducing tendon and/or ligament tissue formation in a subject in need thereof.
19. A use of an effective amount of a composition comprising a protein encoded by a DNA sequence selected from the group consisting of:
(a) nucleotides 496, 571, or 577 to 882 of SEQ ID NO:1;
(b) nucleotides 845 or 899 to 1204 of SEQ ID NO:3;
(c) nucleotides 605 or 659 to 964 of SEQ ID NO:25, and (d) sequences which hybridize to the complement of (a), (b) or (c) under stringent hybridization conditions of washing in 0.2x SSC, 0.1% SDS at 65° and encode a protein which exhibits the ability to form tendon and/or ligament tissue, for the preparation of a medicament for inducing tendon and/or ligament tissue formation in a subject in need thereof.
20. A use of an effective amount of a composition comprising a protein having an amino acid sequence selected from the group consisting of:
(a) amino acids -25, 1, or 3 to 104 of SEQ ID NO:2;
(b) amino acids 1 or 19 to 120 of SEQ ID NO:4; and (c) amino acids 1 or 19 to 120 of SEQ ID NO:26, for inducing tendon and/or ligament tissue formation in a subject in need thereof.
21. A use of an effective amount of a composition comprising protein having an amino acid sequence selected from the group consisting of:
(a) amino acids -25, 1, or 3 to 104 of SEQ ID NO:2;
(b) amino acids 1 or 19 to 120 of SEQ ID NO:4; and (c) amino acids 1 or 19 to 120 of SEQ ID NO:26, for the preparation of a medicament for inducing tendon and/or ligament tissue formation in a subject in need thereof.
22. A DNA molecule comprising an isolated DNA sequence encoding a BMP-13 protein characterized by the ability to induce the formation of tendon and or ligament tissue, wherein the DNA sequence is selected from the group consisting of:
(a) nucleotides 605 or 659 to 964 of SEQ ID NO:25; and (b) equivalent degenerative codon sequences of (a).
23. A DNA molecule comprising an isolated DNA sequence encoding a BMP-12 protein characterized by the ability to induce the formation of tendon and/or ligament tissue, wherein the DNA sequence comprises nucleotides encoding amino acids 1 or 19 to 120 of SEQ ID NO: 26.
24. A host cell transformed with a DNA molecule of claim 22.
25. A vector comprising a DNA molecule of claim 22 operatively linked with an expression control sequence.
26. A host cell transformed with the vector of claim 25.
27. A method of producing a purified a BMP-13 protein, said method comprising the steps of:
(a) culturing a host cell transformed with a DNA molecule according to claim 22, comprising a nucleotide sequence encoding a BMP-13 protein; and (b) recovering and purifying said BMP-13 protein from the culture medium.
28. A purified polypeptide comprising an amino acid sequence selected from the group consisting of:
(a) amino acids 1 to 120 of SEQ ID NO:26; and (b) amino acids 19 to 120 of SEQ ID NO:26.
29. A purified protein comprising a dimer of two subunits of a polypeptide of claim 28.
30. A purified protein produced by the steps of (a) culturing a cell transformed with a DNA molecule comprising the nucleotide sequence from nucleotides 605 or 659 to 964 of SEQ ID
NO:25, and (b) recovering and purifying from the cell culture a protein comprising an amino acid sequence from amino acids 1 or 19 to 120 of SEQ ID NO:26.
31. A pharmaceutical composition comprising an effective amount of a BMP-13 protein of claim 28 in admixture with a pharmaceutically acceptable carrier.
32. A use of an effective amount of the composition of claim 31 for treating a tendon or ligament defect in a subject in need of same.
33. A use of an effective amount of the composition of claim 31 for the preparation of a medicament treating a tendon or ligament defect in a subject in need of same.
34. The use of claim 32 or 33, wherein the tendon or ligament defect is tendinitis.
35. A chimeric DNA molecule comprising a DNA sequence encoding a propeptide from a member of the TGF-.beta. superfamily of proteins linked in correct reading frame to a DNA sequence of claim 22.
36. A chimeric DNA molecule according to claim 35, wherein the propeptide is the propeptide from BMP-2.
37. A heterodimeric protein molecule comprising one monomer having an amino acid sequence of a polypeptide of claim 28, and one monomer having the amino acid sequence of a protein of the TGF-.beta. superfamily.
CA2176942A 1993-12-07 1994-12-06 Bmp-12, bmp-13 and tendon-inducing compositions thereof Expired - Lifetime CA2176942C (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US16410393A 1993-12-07 1993-12-07
US08/164,103 1993-12-07
US21778094A 1994-03-25 1994-03-25
US08/217,780 1994-03-25
US08/333,576 1994-11-02
US08/333,576 US6027919A (en) 1993-12-07 1994-11-02 BMP-12 and BMP-13 proteins and DNA encoding them
PCT/US1994/014030 WO1995016035A2 (en) 1993-12-07 1994-12-06 Bmp-12, bmp-13 and tendon-inducing compositions thereof

Publications (2)

Publication Number Publication Date
CA2176942A1 CA2176942A1 (en) 1995-06-15
CA2176942C true CA2176942C (en) 2011-11-01

Family

ID=27388970

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2176942A Expired - Lifetime CA2176942C (en) 1993-12-07 1994-12-06 Bmp-12, bmp-13 and tendon-inducing compositions thereof

Country Status (15)

Country Link
US (5) US5658882A (en)
EP (1) EP0733109B9 (en)
JP (3) JP3717930B2 (en)
KR (1) KR100353182B1 (en)
AT (1) ATE319823T1 (en)
AU (1) AU689184B2 (en)
CA (1) CA2176942C (en)
DE (1) DE69434651T2 (en)
DK (1) DK0733109T3 (en)
ES (1) ES2255059T3 (en)
FI (1) FI119816B (en)
NO (1) NO317801B1 (en)
OA (1) OA10582A (en)
PT (1) PT733109E (en)
WO (1) WO1995016035A2 (en)

Families Citing this family (147)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6150328A (en) * 1986-07-01 2000-11-21 Genetics Institute, Inc. BMP products
US6586388B2 (en) 1988-04-08 2003-07-01 Stryker Corporation Method of using recombinant osteogenic protein to repair bone or cartilage defects
US20070166353A1 (en) * 1988-04-08 2007-07-19 Stryker Corporation Osteogenic proteins
US20080070842A1 (en) * 1991-11-04 2008-03-20 David Israel Recombinant bone morphogenetic protein heterodimers, compositions and methods of use
WO1993009229A1 (en) 1991-11-04 1993-05-13 Genetics Institute, Inc. Recombinant bone morphogenetic protein heterodimers, compositions and methods of use
DE19525416A1 (en) * 1995-07-12 1997-01-16 Bioph Biotech Entw Pharm Gmbh Use of MP52 for the treatment and prevention of diseases of the nervous system
US20080233170A1 (en) * 1992-02-21 2008-09-25 Stryker Corporation Osteogenic Proteins
JPH09503904A (en) 1993-07-09 1997-04-22 ザ ジョーンズ ホプキンス ユニバーシティー スクール オブ メディシン Growth differentiation factor-7
AU697625B2 (en) * 1993-07-09 1998-10-15 Johns Hopkins University School Of Medicine, The Growth differentiation factor-6
US6291206B1 (en) * 1993-09-17 2001-09-18 Genetics Institute, Inc. BMP receptor proteins
PT733109E (en) * 1993-12-07 2006-07-31 Genetics Inst Llc MORPHOGENETIC PROTEINS OF 0SS0S PMO-12 AND PMO-13 AND THEIR COMPOSITIONS FOR TENDAO INDUCTION
US5942496A (en) 1994-02-18 1999-08-24 The Regent Of The University Of Michigan Methods and compositions for multiple gene transfer into bone cells
US6551618B2 (en) 1994-03-15 2003-04-22 University Of Birmingham Compositions and methods for delivery of agents for neuronal regeneration and survival
US5906827A (en) * 1994-06-03 1999-05-25 Creative Biomolecules, Inc. Matrix for the manufacture of autogenous replacement body parts
US20010011131A1 (en) * 1997-07-28 2001-08-02 Luyten Frank P. DNA molecules encoding cartilage-derived morphogenetic proteins
AU1120295A (en) * 1994-11-07 1996-05-31 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Cartilage-derived morphogenetic proteins
US5846770A (en) * 1994-11-22 1998-12-08 Genetics Institute, Inc. DNA molecules encoding human chordin
DK0955313T3 (en) * 1995-04-19 2006-08-21 Bioph Biotech Entw Pharm Gmbh New protein and process for making the same
ES2203701T3 (en) * 1995-06-05 2004-04-16 Genetics Institute, Llc USE OF BONE MORPHOGENIC PROTEINS TO HEAL AND REPAIR CONJUNCTIVE FABRIC UNIONS.
US5902785A (en) * 1995-06-06 1999-05-11 Genetics Institute, Inc. Cartilage induction by bone morphogenetic proteins
ZA966489B (en) * 1995-08-03 1997-02-26 Bioph Biotech Entw Pharm Gmbh New protein human MP52 Arg.
US6048964A (en) * 1995-12-12 2000-04-11 Stryker Corporation Compositions and therapeutic methods using morphogenic proteins and stimulatory factors
US7026292B1 (en) 1995-12-12 2006-04-11 Stryker Corporation Compositions and therapeutic methods using morphogenic proteins and stimulatory factors
DE19548476A1 (en) * 1995-12-22 1997-06-26 Bioph Biotech Entw Pharm Gmbh Targeted connections with cartilage and / or bone inducing activity
US5700774A (en) * 1996-03-26 1997-12-23 Genetics Institute, Inc. Compositions comprising bone morphogenic proteins and truncated parathyroid hormone related peptide, and methods of inducing cartilage by administration of same
US5965403A (en) * 1996-09-18 1999-10-12 Genetics Institute, Inc. Nucleic acids encoding bone morphogenic protein-16 (BMP-16)
JPH11335398A (en) * 1998-05-22 1999-12-07 Hoechst Marion Roussel Kk New monomeric protein having bone-inducing activity and preventive/therapeutic agent for chondropathy/ osteopathy consisting thereof
EP1074620A1 (en) * 1999-08-06 2001-02-07 HyGene AG Monomeric protein of the TGF-beta family
US6281195B1 (en) 1997-02-07 2001-08-28 Stryker Corporation Matrix-free osteogenic devices, implants and methods of use thereof
US20010016646A1 (en) 1998-03-20 2001-08-23 David C. Rueger Osteogenic devices and methods of use thereof for repair of endochondral bone, osteochondral and chondral defects
US7041641B2 (en) 1997-03-20 2006-05-09 Stryker Corporation Osteogenic devices and methods of use thereof for repair of endochondral bone and osteochondral defects
US6235316B1 (en) * 1997-04-04 2001-05-22 Barnes-Jewish Hospital Neocartilage and methods of use
EP2309261A1 (en) 1997-05-30 2011-04-13 Stryker Corporation Methods for evaluating tissue morphogenesis and morphogenic activity
ATE220564T1 (en) 1997-08-14 2002-08-15 Sulzer Innotec Ag COMPOSITION AND DEVICE FOR REPAIRING CARTILAGE TISSUE IN VIVO CONSISTING OF NANOCAPSULES WITH OSTEOINDUCTIVE AND/OR CHONDROINDUCTIVE FACTORS
US6482584B1 (en) 1998-11-13 2002-11-19 Regeneration Technologies, Inc. Cyclic implant perfusion cleaning and passivation process
US20010031254A1 (en) * 1998-11-13 2001-10-18 Bianchi John R. Assembled implant
US6281175B1 (en) 1997-09-23 2001-08-28 Scimed Life Systems, Inc. Medical emulsion for lubrication and delivery of drugs
US20020052026A1 (en) 1997-10-08 2002-05-02 Steven M. Vicik Methods of refolding proteins
AU752816B2 (en) 1997-11-28 2002-10-03 Curis, Inc. An active hedgehog-protein-mutant, a process for its preparation and its use for pharmaceutical purposes
US6027917A (en) * 1997-12-10 2000-02-22 Genetics Institute, Inc. Bone morphogenetic protein (BMP)-17 and BMP-18 compositions
ES2389387T3 (en) 1998-03-17 2012-10-25 Genentech, Inc. Homologous VEGF and BMP1 polypeptides
US6337072B1 (en) 1998-04-03 2002-01-08 Hyseq, Inc. Interleukin-1 receptor antagonist and recombinant production thereof
US6541623B1 (en) 1998-04-03 2003-04-01 Hyseq, Inc. Interleukin—1 receptor antagonist and uses thereof
US6426191B1 (en) 1998-04-03 2002-07-30 Hyseq, Inc. Assays involving an IL-1 receptor antagonist
US6294655B1 (en) 1998-04-03 2001-09-25 Hyseq, Inc. Anti-interleukin-1 receptor antagonist antibodies and uses thereof
US6958149B2 (en) 1998-10-06 2005-10-25 Stryker Corporation Repair of larynx, trachea, and other fibrocartilaginous tissues
US7572440B2 (en) 1999-07-30 2009-08-11 Stryker Corporation Method for repairing a defect in an intervertebral disc
EP1649865B1 (en) * 1998-10-06 2012-06-13 Stryker Corporation GDF-5 for use in repairing a nonarticular cartilage defect in an intervertebral disc
CA2343698C (en) * 1998-10-06 2014-05-20 Stryker Corporation Repair of larynx, trachea, and other fibrocartilaginous tissues
US6846906B1 (en) 1998-10-07 2005-01-25 Stryker Corporation Modified proteins of the TGF-β superfamily, including morphogenic proteins
US6677432B1 (en) 1998-10-07 2004-01-13 Stryker Corporation Mutations of the C-terminal portion of TGF-β superfamily proteins
EP2128260A3 (en) 1998-10-07 2010-06-16 STRYKER CORPORATION (a Michigan corporation) Modified TGF-beta superfamily proteins
US6727224B1 (en) * 1999-02-01 2004-04-27 Genetics Institute, Llc. Methods and compositions for healing and repair of articular cartilage
ATE255920T1 (en) * 1999-02-01 2003-12-15 Genetics Inst Llc METHODS AND COMPOSITIONS FOR HEALING AND REPAIRING ARTicular cartilage
JP4828703B2 (en) 1999-04-28 2011-11-30 ジェネティックス インスティテュート エルエルシー Human GIL-19 / AE289 protein and polynucleotide encoding the same
DK1054018T3 (en) 1999-05-18 2009-05-18 Dyax Corp Fab fragment libraries and method of using them
DK1223990T3 (en) * 1999-10-15 2004-11-29 Inst Genetics Llc Formulations of hyaluronic acid for delivery of osteogenic proteins
US6368787B1 (en) 1999-12-16 2002-04-09 Stryker Corporation Methods and compositions for identifying morphogenic protein analogs using morphogenic protein responsive inhibitory elements
ATE460951T1 (en) 2000-01-25 2010-04-15 Edwards Lifesciences Corp RELEASE SYSTEMS FOR THE TREATMENT OF RESTENOSIS AND ANASTOMOTIC INTIMAL HYPERPLASIA
AU2001245461A1 (en) * 2000-03-09 2001-09-17 Sulzer Biologics, Inc. Product and method for biological anchoring of connective tissue to bone
US20030065140A1 (en) * 2000-04-03 2003-04-03 Vernet Corine A.M. Novel proteins and nucleic acids encoding same
CA2648046A1 (en) 2000-06-23 2002-01-03 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP2275549A1 (en) 2000-06-23 2011-01-19 Genentech, Inc. Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
US7270730B2 (en) * 2000-08-04 2007-09-18 Essen Instruments, Inc. High-throughput electrophysiological measurement system
US7067046B2 (en) 2000-08-04 2006-06-27 Essen Instruments, Inc. System for rapid chemical activation in high-throughput electrophysiological measurements
US20040010118A1 (en) * 2000-08-16 2004-01-15 Zerhusen Bryan D. Novel proteins and nucleic acids encoding same
US20030082233A1 (en) * 2000-12-01 2003-05-01 Lyons Karen M. Method and composition for modulating bone growth
CA2441588A1 (en) * 2001-03-23 2002-10-03 Biopharm Gesellschaft Zue Biotechnologischen Entwicklung Von Pharmaka Mbh Use of cytokines of the tgf-.beta. superfamily for the treatment and diagnosis of skin related disorders
DK1399023T3 (en) * 2001-06-01 2008-08-18 Wyeth Corp Compositions for systemic administration of sequences encoding bone morphogenesis proteins
TWI267378B (en) 2001-06-08 2006-12-01 Wyeth Corp Calcium phosphate delivery vehicles for osteoinductive proteins
US20030087274A1 (en) * 2001-07-05 2003-05-08 Anderson David W. Therapeutic polypeptides, nucleic acids encoding same, and methods of use
US8546334B2 (en) 2001-11-19 2013-10-01 Scil Technology Gmbh Device having osteoinductive and osteoconductive properties
CH695985A5 (en) * 2002-01-21 2006-11-15 Straumann Holding Ag Surface-modified implants.
WO2003099992A2 (en) * 2002-05-17 2003-12-04 Wyeth Injectable solid hyaluronic acid carriers for delivery of osteogenic proteins
US7622562B2 (en) 2002-06-26 2009-11-24 Zimmer Orthobiologics, Inc. Rapid isolation of osteoinductive protein mixtures from mammalian bone tissue
WO2004014940A2 (en) * 2002-08-13 2004-02-19 Wyeth PEPTIDES AS SOLUBILIZING EXCIPIENTS FOR TRANSFORMING GROWTH FACTOR ß PROTEINS
JP4358741B2 (en) 2002-09-10 2009-11-04 スキール テヒノロギー ゲーエムベーハー Metal implants coated with osteoinductive protein under low oxygen concentration
ATE554108T1 (en) 2003-07-25 2012-05-15 Amgen Inc PROCEDURES REGARDING LDCAM AND CRTAM
ATE357244T1 (en) 2003-09-12 2007-04-15 Wyeth Corp INJECTABLE SOLID CALCIUM PHOSPHATE RODS FOR DELIVERY OF OSTEOGENIC PROTEINS
EP1701729B1 (en) * 2003-12-31 2018-05-02 Warsaw Orthopedic, Inc. Improved bone matrix compositions and methods
US7767221B2 (en) * 2004-03-05 2010-08-03 The Trustees Of Columbia University In The City Of New York Multi-phased, biodegradable and osteointegrative composite scaffold for biological fixation of musculoskeletal soft tissue to bone
ES2350939T3 (en) 2004-03-10 2011-01-28 Scil Technology Gmbh COVERED IMPLANTS, THEIR MANUFACTURE AND USE OF THE SAME.
WO2005116052A2 (en) 2004-04-27 2005-12-08 Research Development Foundation ANTAGONISM OF TGF-β SUPERFAMILY RECEPTOR SIGNALING
WO2005115438A1 (en) 2004-05-25 2005-12-08 Stryker Corporation Use of morphogenic proteins for treating cartilage defects
JP2008511405A (en) * 2004-08-30 2008-04-17 アリーン、ネビル Methods of using grafts for treatment of ligaments and tendons
US8398638B2 (en) 2004-08-30 2013-03-19 Spineovations, Inc. Method of treating spinal internal disk derangement
US7473678B2 (en) 2004-10-14 2009-01-06 Biomimetic Therapeutics, Inc. Platelet-derived growth factor compositions and methods of use thereof
US20060166251A1 (en) * 2005-01-26 2006-07-27 Archambault Joanne M Use of sFRPs as markers of BMP activity
AU2006226941A1 (en) * 2005-03-24 2006-09-28 Wyeth Use of fibrous tissue inducing proteins for hernia repair
BRPI0609504A2 (en) * 2005-03-30 2010-04-13 Wyeth Corp methods to stimulate hair growth by administering bone morphogenetic proteins (bmps)
US20060247790A1 (en) * 2005-04-30 2006-11-02 Mckay William F Shaped osteochondral grafts and methods of using same
US20060287676A1 (en) * 2005-06-15 2006-12-21 Rita Prajapati Method of intra-operative coating therapeutic agents onto sutures, composite sutures and methods of use
US20060286289A1 (en) * 2005-06-15 2006-12-21 Rita Prajapati Method of intraoperative coating therapeutic agents onto sutures
US20060287675A1 (en) * 2005-06-15 2006-12-21 Prajapati Rita T Method of intra-operative coating therapeutic agents onto sutures composite sutures and methods of use
US20060286171A1 (en) * 2005-06-17 2006-12-21 Tianhong Zhou Bone morphogenetic protein formulations
WO2007052096A2 (en) * 2005-06-29 2007-05-10 Cameron Malcolm Lang Clokie Production of bone morphogenic proteins (bmps) in transgenic mammals
CA2627907C (en) 2005-11-01 2014-06-17 Osteotech, Inc. Osteoinductive composition comprising osteoinductive factors recovered from mineralized bone and a carrier
CA2627370C (en) * 2005-11-18 2016-02-23 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka Mbh High activity growth factor mutants
US8147860B2 (en) 2005-12-06 2012-04-03 Etex Corporation Porous calcium phosphate bone material
EP2311505B1 (en) 2006-02-09 2013-11-06 BioMimetic Therapeutics, LLC Compositions and methods for treating bone
WO2007142818A2 (en) 2006-05-17 2007-12-13 Stryker Corporation Use of a soluble morphogenic protein complex for treating cartilage defects
AU2007269712B2 (en) 2006-06-30 2013-02-07 Biomimetic Therapeutics, Llc PDGF-biomatrix compositions and methods for treating rotator cuff injuries
US9161967B2 (en) 2006-06-30 2015-10-20 Biomimetic Therapeutics, Llc Compositions and methods for treating the vertebral column
US8524265B2 (en) 2006-08-17 2013-09-03 Warsaw Orthopedic, Inc. Medical implant sheets useful for tissue regeneration
US20100047309A1 (en) * 2006-12-06 2010-02-25 Lu Helen H Graft collar and scaffold apparatuses for musculoskeletal tissue engineering and related methods
AU2007234612B2 (en) 2006-12-14 2013-06-27 Johnson & Johnson Regenerative Therapeutics, Llc Protein stabilization formulations
EP2120859B1 (en) 2006-12-21 2013-11-20 Stryker Corporation Sustained-release formulations comprising bmp-7 crystals
US8753391B2 (en) 2007-02-12 2014-06-17 The Trustees Of Columbia University In The City Of New York Fully synthetic implantable multi-phased scaffold
CA2688232A1 (en) * 2007-05-25 2008-12-04 Induce Biologics Inc. A method of enhancing recombinant protein production
US20080299172A1 (en) * 2007-06-04 2008-12-04 Stuart Young Tissue repair implant
AU2008265852B2 (en) 2007-06-15 2014-04-17 Warsaw Orthopedic, Inc. Method of treating tissue
CA2690457C (en) 2007-06-15 2018-02-20 Osteotech, Inc. Bone matrix compositions and methods
US9554920B2 (en) 2007-06-15 2017-01-31 Warsaw Orthopedic, Inc. Bone matrix compositions having nanoscale textured surfaces
WO2008157492A2 (en) 2007-06-15 2008-12-24 Osteotech, Inc. Osteoinductive demineralized cancellous bone
US7678764B2 (en) 2007-06-29 2010-03-16 Johnson & Johnson Regenerative Therapeutics, Llc Protein formulations for use at elevated temperatures
US9358113B2 (en) 2007-07-10 2016-06-07 Warsaw Orthopedic, Inc. Delivery system
EP2019117A1 (en) * 2007-07-27 2009-01-28 BIOPHARM GESELLSCHAFT ZUR BIOTECHNOLOGISCHEN ENTWICKLUNG VON PHARMAKA mbH Optimized purification process of recombinant growth factor protein
WO2009020744A1 (en) 2007-08-07 2009-02-12 Johnson & Johnson Regenerative Therapeutics, Llc Protein formulations comprising gdf-5 in aqueous acidic solution
ES2446544T3 (en) * 2007-10-19 2014-03-10 Warsaw Orthopedic, Inc. Demineralized bone matrix compositions and methods
WO2009102966A2 (en) 2008-02-13 2009-08-20 Keith Hruska Method of treating vascular sclerosis
US20100010549A1 (en) * 2008-03-05 2010-01-14 Neville Alleyne device and method of minimally invasive extracapsular ligamentous augmentation for canine stifle ligament injuries
US20100004700A1 (en) * 2008-03-05 2010-01-07 Neville Alleyne Method of treating tissue with a suspenson of tricalcium hydroxyapatite microspheres
US8469961B2 (en) * 2008-03-05 2013-06-25 Neville Alleyne Methods and compositions for minimally invasive capsular augmentation of canine coxofemoral joints
WO2009129101A1 (en) 2008-04-14 2009-10-22 Advanced Technologies And Regenerative Medicine, Llc Liquid buffered gdf-5 formulations
EP2300610A1 (en) * 2008-06-09 2011-03-30 Wyeth LLC Novel bmp-12-related proteins and methods of their manufacture
EP2341951A2 (en) 2008-09-09 2011-07-13 BioMimetic Therapeutics, Inc. Platelet-derived growth factor compositions and methods for the treatment of tendon and ligament injuries
CA2752157A1 (en) 2009-02-12 2010-08-19 Stryker Corporation Peripheral administration of proteins including tgf-.beta. superfamily members for systemic treatment of disorders and disease
CN102369017A (en) 2009-02-12 2012-03-07 史赛克公司 Compositions and methods for minimally invasive systemic delivery of proteins comprising TGF-beta superfamily members
WO2010093950A1 (en) 2009-02-12 2010-08-19 Osteotech, Inc. Delivery system cartridge
WO2010110974A1 (en) 2009-03-24 2010-09-30 Stryker Corporation Methods and compositions for tissue engineering
US8609127B2 (en) 2009-04-03 2013-12-17 Warsaw Orthopedic, Inc. Medical implant with bioactive material and method of making the medical implant
US20110002897A1 (en) 2009-06-11 2011-01-06 Burnham Institute For Medical Research Directed differentiation of stem cells
WO2011031856A1 (en) 2009-09-09 2011-03-17 Stryker Corporation Bmp -7 for use in treating pain induced by injuries and diseases of an articular joint
CA2774024A1 (en) 2009-09-17 2011-03-24 Stryker Corporation Buffers for controlling the ph of bone morphogenetic proteins
US8657859B2 (en) * 2009-12-16 2014-02-25 Advanced Veterinary Solutions Implant for promoting stability of the canine stifle joint
JP2013514811A (en) 2009-12-22 2013-05-02 ストライカー コーポレイション BMP-7 mutant with reduced immunogenicity
CN102811622A (en) 2010-02-22 2012-12-05 生物模拟治疗公司 Platelet-derived growth factor compositions and methods for the treatment of tendinopathies
JP5837930B2 (en) 2010-07-30 2015-12-24 ビオファーム・ゲゼルシャフト・ツァ・ビオテヒノロジッシェン・エントヴィックルング・フォン・ファルマカ・エムベーハー Pharmaceutical delivery device and growth factor formulation for accelerating wound healing
EP2537538A1 (en) 2011-06-22 2012-12-26 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka mbH Bioresorbable Wound Dressing
EP2602264A1 (en) 2011-12-05 2013-06-12 Biopharm Gesellschaft Zur Biotechnologischen Entwicklung Von Pharmaka mbH GDF-5 mutant for inducing cartilage formation
WO2014012101A1 (en) 2012-07-13 2014-01-16 Trustees Of Tufts College Silk powder compaction for production of constructs with high mechanical strength and stiffness
EP2983643A4 (en) 2013-04-12 2016-12-28 Univ Columbia Methods for host cell homing and dental pulp regeneration
CA2973727A1 (en) 2015-01-16 2016-07-21 Spineovations, Inc. Method of treating spinal disk
JP7025021B2 (en) 2015-10-26 2022-02-24 プレジデント アンド フェローズ オブ ハーバード カレッジ Reduced and oxidized polysaccharides and methods of their use
KR101659796B1 (en) 2016-01-13 2016-10-10 주식회사 셀루메드 Mixture of bmp proteins at specific ratios
US20190328792A1 (en) * 2017-01-11 2019-10-31 Paracelsus Medizinische Privatuniversität Salzburg - Privatstiftung Mesenchymal stem cell-derived extracellular vesicles and their medical use
AU2020403846A1 (en) 2019-12-18 2022-08-11 Merck Patent Gmbh Use of the GDF-5 mutant for the treatment of pain and cartilage destruction

Family Cites Families (136)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2465357A (en) 1944-08-14 1949-03-29 Upjohn Co Therapeutic sponge and method of making
CH563767A5 (en) 1973-01-30 1975-07-15 Pheulpin Jean
US4468464A (en) 1974-11-04 1984-08-28 The Board Of Trustees Of The Leland Stanford Junior University Biologically functional molecular chimeras
DE2657370C2 (en) 1976-12-17 1982-11-11 Hans Dr.med. Dr.med.dent. 8000 München Scheicher Means for covering and / or filling in bone defects
DE2732848A1 (en) 1977-07-18 1979-02-08 Schering Ag DIURETHANE, HERBICIDAL AGENTS CONTAINING THESE COMPOUNDS AND THE PROCESS FOR THEIR PRODUCTION
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4619989A (en) 1981-05-05 1986-10-28 The Regents Of The University Of Cal. Bone morphogenetic protein composition
US4761471A (en) * 1980-08-04 1988-08-02 The Regents Of The University Of California Bone morphogenetic protein composition
US4294753A (en) * 1980-08-04 1981-10-13 The Regents Of The University Of California Bone morphogenetic protein process
US4455256A (en) 1981-05-05 1984-06-19 The Regents Of The University Of California Bone morphogenetic protein
US4789732A (en) 1980-08-04 1988-12-06 Regents Of The University Of California Bone morphogenetic protein composition
US4419446A (en) 1980-12-31 1983-12-06 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA process utilizing a papilloma virus DNA as a vector
IE52535B1 (en) 1981-02-16 1987-12-09 Ici Plc Continuous release pharmaceutical compositions
US4727028A (en) 1981-06-22 1988-02-23 Eli Lilly And Company Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
US4472840A (en) 1981-09-21 1984-09-25 Jefferies Steven R Method of inducing osseous formation by implanting bone graft material
US4394370A (en) 1981-09-21 1983-07-19 Jefferies Steven R Bone graft material for osseous defects and method of making same
US4474181A (en) 1982-02-18 1984-10-02 Schenck Robert R Method and apparatus for anastomosing small blood vessels
US4455526A (en) * 1982-06-29 1984-06-19 The United States Of America As Represented By The Secretary Of The Air Force FET Switching regulator
DE3382562D1 (en) 1982-09-24 1992-06-25 Us Health ANIMAL TISSUE RECOVERY.
IL68218A (en) 1983-03-23 1985-12-31 Univ Ramot Compositions for cartilage repair comprising embryonal chondrocytes
US4434094A (en) * 1983-04-12 1984-02-28 Collagen Corporation Partially purified osteogenic factor and process for preparing same from demineralized bone
US4795804A (en) 1983-08-16 1989-01-03 The Regents Of The University Of California Bone morphogenetic agents
US4923805A (en) 1983-11-02 1990-05-08 Integrated Genetics, Inc. Fsh
US4703008A (en) 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
GB8334498D0 (en) 1983-12-24 1984-02-01 Beecham Group Plc Compounds
US4804744A (en) * 1984-01-04 1989-02-14 International Genetic Engineering, Inc. Osteogenic factors
US4608199A (en) 1984-03-20 1986-08-26 Arnold Caplan Bone protein purification process
US4662884A (en) 1984-04-25 1987-05-05 University Of Utah Research Foundation Prostheses and methods for promoting nerve regeneration
US4596574A (en) 1984-05-14 1986-06-24 The Regents Of The University Of California Biodegradable porous ceramic delivery system for bone morphogenetic protein
CA1341617C (en) 1984-06-08 2011-06-28 Henry George Burger Inhibin isolated from ovarian follicular fluid
US4868161A (en) 1984-06-29 1989-09-19 City Of Hope Method for promoting nerve regeneration
US4627982A (en) * 1984-07-16 1986-12-09 Collagen Corporation Partially purified bone-inducing factor
ATE128715T1 (en) * 1984-07-16 1995-10-15 Celtrix Pharma POLYPEPTIDE-INDUCING FACTORS IN BONE AND CARTILAGE.
US4843063A (en) 1984-07-16 1989-06-27 Collagen Corporation Polypeptide cartilage-inducing factors found in bone
ATE78515T1 (en) 1984-10-05 1992-08-15 Genentech Inc DNA, CELL CULTURES AND METHODS FOR HETEROLOGOUS PROTEIN SECRETION AND PERIPLASMIC PROTEIN RECOVERY.
US4769328A (en) 1984-10-12 1988-09-06 Zymogenetics Inc. Expression of biologically active PDGF analogs in yeast
US5187263A (en) 1984-10-12 1993-02-16 Zymogenetics, Inc. Expression of biologically active PDGE analogs in eucaryotic cells
US4563350A (en) * 1984-10-24 1986-01-07 Collagen Corporation Inductive collagen based bone repair preparations
AU598455B2 (en) 1984-12-27 1990-06-28 Suntory Limited Method for purifying an interferon
US4886747A (en) 1985-03-22 1989-12-12 Genentech, Inc. Nucleic acid encoding TGF-β and its uses
US4766067A (en) 1985-05-31 1988-08-23 President And Fellows Of Harvard College Gene amplification
US4681763A (en) 1985-06-11 1987-07-21 University Of Medicine And Dentistry Of New Jersey Composition for stimulating bone growth
US4851521A (en) 1985-07-08 1989-07-25 Fidia, S.P.A. Esters of hyaluronic acid
US5215893A (en) 1985-10-03 1993-06-01 Genentech, Inc. Nucleic acid encoding the ba chain prodomains of inhibin and method for synthesizing polypeptides using such nucleic acid
US4798885A (en) 1986-02-07 1989-01-17 Genentech, Inc. Compositions of hormonally active human and porcine inhibin containing an α chain and 62 chain
US5089396A (en) 1985-10-03 1992-02-18 Genentech, Inc. Nucleic acid encoding β chain prodomains of inhibin and method for synthesizing polypeptides using such nucleic acid
US4737578A (en) 1986-02-10 1988-04-12 The Salk Institute For Biological Studies Human inhibin
US4758233A (en) 1986-04-22 1988-07-19 N.J. Phillips TPY. Limited Cream applicator
NL8601328A (en) 1986-05-23 1987-12-16 Langen Research DEVICE FOR INJECTING MEAT WITH A MASS, PARTICULARLY PASTY MASS.
US5108922A (en) * 1986-07-01 1992-04-28 Genetics Institute, Inc. DNA sequences encoding BMP-1 products
US4877864A (en) * 1987-03-26 1989-10-31 Genetics Institute, Inc. Osteoinductive factors
US5459047A (en) * 1986-07-01 1995-10-17 Genetics Institute, Inc. BMP-6 proteins
US5013649A (en) * 1986-07-01 1991-05-07 Genetics Institute, Inc. DNA sequences encoding osteoinductive products
ZA874681B (en) * 1986-07-01 1988-04-27 Genetics Inst Novel osteoinductive factors
US5631142A (en) * 1986-07-01 1997-05-20 Genetics Institute, Inc. Compositions comprising bone morphogenetic protein-2 (BMP-2)
US5187076A (en) * 1986-07-01 1993-02-16 Genetics Institute, Inc. DNA sequences encoding BMP-6 proteins
US6150328A (en) * 1986-07-01 2000-11-21 Genetics Institute, Inc. BMP products
US5106748A (en) * 1986-07-01 1992-04-21 Genetics Institute, Inc. Dna sequences encoding 5 proteins
US6432919B1 (en) * 1986-07-01 2002-08-13 Genetics Institute, Inc. Bone morphogenetic protein-3 and compositions
US5543394A (en) * 1986-07-01 1996-08-06 Genetics Institute, Inc. Bone morphogenetic protein 5(BMP-5) compositions
US5019087A (en) 1986-10-06 1991-05-28 American Biomaterials Corporation Nerve regeneration conduit
US5124316A (en) 1986-11-14 1992-06-23 President And Fellows Of Harvard College Method for periodontal regeneration
US5041538A (en) 1987-08-28 1991-08-20 The Salk Institute For Biological Studies Mammalian follistatin
US5202120A (en) 1987-09-11 1993-04-13 Case Western Reserve University Methods of reducing glial scar formation and promoting axon and blood vessel growth and/or regeneration through the use of activated immature astrocytes
US5147399A (en) 1988-02-01 1992-09-15 Dellon Arnold L Method of treating nerve defects through use of a bioabsorbable surgical device
EP0336760A3 (en) * 1988-04-06 1991-03-13 Celtrix Pharmaceuticals, Inc. Bone-inducing protein
US6586388B2 (en) * 1988-04-08 2003-07-01 Stryker Corporation Method of using recombinant osteogenic protein to repair bone or cartilage defects
US5108753A (en) 1988-04-08 1992-04-28 Creative Biomolecules Osteogenic devices
US5266683A (en) 1988-04-08 1993-11-30 Stryker Corporation Osteogenic proteins
US5011691A (en) 1988-08-15 1991-04-30 Stryker Corporation Osteogenic devices
US5354557A (en) 1988-04-08 1994-10-11 Stryker Corporation Osteogenic devices
US4968590A (en) * 1988-04-08 1990-11-06 Stryker Corporation Osteogenic proteins and polypeptides
US5258494A (en) 1988-04-08 1993-11-02 Stryker Corporation Osteogenic proteins
US5024841A (en) 1988-06-30 1991-06-18 Collagen Corporation Collagen wound healing matrices and process for their production
US5071834A (en) 1988-09-16 1991-12-10 Genentech, Inc. Purified activin B composition
US5284756A (en) * 1988-10-11 1994-02-08 Lynn Grinna Heterodimeric osteogenic factor
US5106626A (en) 1988-10-11 1992-04-21 International Genetic Engineering, Inc. Osteogenic factors
US4955892A (en) 1988-10-24 1990-09-11 Louisiana State University Neural cell adhesion protein nerve prosthesis
US5457038A (en) * 1988-11-10 1995-10-10 Genetics Institute, Inc. Natural killer stimulatory factor
US5011486A (en) 1988-11-18 1991-04-30 Brown University Research Foundation Composite nerve guidance channels
US5162430A (en) 1988-11-21 1992-11-10 Collagen Corporation Collagen-polymer conjugates
US4920962A (en) 1988-11-23 1990-05-01 Claude Proulx Splint-like element for use in end-to-end nerve suture
US5217867A (en) 1988-11-30 1993-06-08 The Salk Institute For Biological Studies Receptors: their identification, characterization, preparation and use
US4963146A (en) 1989-04-20 1990-10-16 Colla-Tec Incorporated Multi-layered, semi-permeable conduit for nerve regeneration
US5026381A (en) 1989-04-20 1991-06-25 Colla-Tec, Incorporated Multi-layered, semi-permeable conduit for nerve regeneration comprised of type 1 collagen, its method of manufacture and a method of nerve regeneration using said conduit
US5166322A (en) 1989-04-21 1992-11-24 Genetics Institute Cysteine added variants of interleukin-3 and chemical modifications thereof
CA2017466A1 (en) * 1989-06-02 1990-12-02 Michael C. Kiefer Bone calcification factor
US5399346A (en) * 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
WO1991000103A1 (en) 1989-06-29 1991-01-10 The United States Of America, Represented By The Secretary, United States Department Of Commerce Method for protecting bone marrow against chemotherapeutic drugs and radiation therapy using transforming growth factor beta 1
CA2020729A1 (en) * 1989-07-19 1991-01-20 Michael C. Kiefer Bone morphogenetic protein
US5324519A (en) 1989-07-24 1994-06-28 Atrix Laboratories, Inc. Biodegradable polymer composition
US5422340A (en) * 1989-09-01 1995-06-06 Ammann; Arthur J. TGF-βformulation for inducing bone growth
CA2024629C (en) * 1989-09-06 2001-07-24 Taiheiyo Cement Corporation Xenopus laevis bone morphogenic protein, dna encoding same and use thereof
US5236456A (en) * 1989-11-09 1993-08-17 Osteotech, Inc. Osteogenic composition and implant containing same
GB8927546D0 (en) * 1989-12-06 1990-02-07 Ciba Geigy Process for the production of biologically active tgf-beta
US5166190A (en) 1990-01-08 1992-11-24 Genentech, Inc. Method for increasing fertility in males
US5256418A (en) 1990-04-06 1993-10-26 Organogenesis, Inc. Collagen constructs
US5290271A (en) 1990-05-14 1994-03-01 Jernberg Gary R Surgical implant and method for controlled release of chemotherapeutic agents
ES2168091T3 (en) * 1990-05-16 2002-06-01 Genetics Inst OSEA AND CARTILAGINOUS INDUCTION PROTEINS.
US5168050A (en) * 1990-05-24 1992-12-01 Genentech, Inc. Mammalian expression of the bone morphogenetic protein-2b using bmp2a/bmp2b fusion
US5218090A (en) 1990-06-12 1993-06-08 Warner-Lambert Company EGF receptor truncates
US5206028A (en) 1991-02-11 1993-04-27 Li Shu Tung Dense collagen membrane matrices for medical uses
US5208219A (en) * 1991-02-14 1993-05-04 Celtrix Pharmaceuticals Inc. Method for inducing bone growth
US5318898A (en) * 1991-04-02 1994-06-07 Genetics Institute, Inc. Production of recombinant bone-inducing proteins
US5118667A (en) 1991-05-03 1992-06-02 Celtrix Pharmaceuticals, Inc. Bone growth factors and inhibitors of bone resorption for promoting bone formation
US5229495A (en) 1991-06-18 1993-07-20 Ludwig Institute For Cancer Research Substantially pure receptor like TGF-β 1 binding molecules and uses thereof
US5216126A (en) 1991-06-19 1993-06-01 Genentech, Inc. Receptor polypeptides and their production and uses
ATE142460T1 (en) 1991-06-21 1996-09-15 Genetics Inst MEDICINAL PRODUCTS CONTAINING OSTEOGENIC PROTEINS
DK0592562T3 (en) * 1991-06-25 1999-08-30 Genetics Inst BMP-9 compositions
US5306307A (en) 1991-07-22 1994-04-26 Calcitek, Inc. Spinal disk implant
US5171579A (en) 1991-10-11 1992-12-15 Genetics Institute, Inc. Formulations of blood clot-polymer matrix for delivery of osteogenic proteins
WO1993009229A1 (en) * 1991-11-04 1993-05-13 Genetics Institute, Inc. Recombinant bone morphogenetic protein heterodimers, compositions and methods of use
EP0625989B1 (en) * 1992-02-12 2000-01-19 BIOPHARM GESELLSCHAFT ZUR BIOTECHNOLOGISCHEN ENTWICKLUNG VON PHARMAKA mbH Dna sequences encoding novel growth/differentiation factors
WO1993016657A1 (en) 1992-02-28 1993-09-02 Collagen Corporation Injectable ceramic compositions and methods for their preparation and use
AU3920693A (en) * 1992-03-18 1993-10-21 General Hospital Corporation, The Four novel receptors of the TGF-beta receptor family
EP0690871A4 (en) * 1993-01-12 1999-10-20 Univ Johns Hopkins Med Growth differentiation factor-5
GB9308060D0 (en) * 1993-04-19 1993-06-02 Cancer Res Campaign Tech Stem cell inhibitor
US5637480A (en) * 1993-05-12 1997-06-10 Genetics Institute, Inc. DNA molecules encoding bone morphogenetic protein-10
ES2213745T3 (en) * 1993-05-12 2004-09-01 Genetics Institute, Llc BMP-11 COMPOSITIONS.
US5447725A (en) * 1993-06-11 1995-09-05 The Procter & Gamble Company Methods for aiding periodontal tissue regeneration
KR100294026B1 (en) * 1993-06-24 2001-09-17 야마자끼 순페이 Electro-optical device
AU697625B2 (en) * 1993-07-09 1998-10-15 Johns Hopkins University School Of Medicine, The Growth differentiation factor-6
JPH09503904A (en) * 1993-07-09 1997-04-22 ザ ジョーンズ ホプキンス ユニバーシティー スクール オブ メディシン Growth differentiation factor-7
PT716610E (en) * 1993-08-26 2006-08-31 Genetics Inst Llc MORPHOGENETIC PROTEINS OF BONES FOR HUMANS TO BE USED IN NEURAL REGENERATION
US5455041A (en) * 1993-09-13 1995-10-03 Research Foundation Of State University Of New York At Buffalo Method for inducing periodontal tissue regeneration
US5399677A (en) * 1993-12-07 1995-03-21 Genetics Institute, Inc. Mutants of bone morphogenetic proteins
US6027919A (en) * 1993-12-07 2000-02-22 Genetics Institute, Inc. BMP-12 and BMP-13 proteins and DNA encoding them
PT733109E (en) * 1993-12-07 2006-07-31 Genetics Inst Llc MORPHOGENETIC PROTEINS OF 0SS0S PMO-12 AND PMO-13 AND THEIR COMPOSITIONS FOR TENDAO INDUCTION
US5723331A (en) * 1994-05-05 1998-03-03 Genzyme Corporation Methods and compositions for the repair of articular cartilage defects in mammals
US5520923A (en) * 1994-09-19 1996-05-28 Genetics Institute, Inc. Formulations for delivery of osteogenic proteins
US5635372A (en) * 1995-05-18 1997-06-03 Genetics Institute, Inc. BMP-15 compositions
ES2203701T3 (en) * 1995-06-05 2004-04-16 Genetics Institute, Llc USE OF BONE MORPHOGENIC PROTEINS TO HEAL AND REPAIR CONJUNCTIVE FABRIC UNIONS.
US5752974A (en) * 1995-12-18 1998-05-19 Collagen Corporation Injectable or implantable biomaterials for filling or blocking lumens and voids of the body
US6034062A (en) * 1997-03-13 2000-03-07 Genetics Institute, Inc. Bone morphogenetic protein (BMP)-9 compositions and their uses
IT1302534B1 (en) * 1998-12-21 2000-09-05 Fidia Advanced Biopolymers Srl INJECTABLE, BIOCOMPATIBLE AND BIODEGRADABLE COMPOSITIONS INCLUDING AT LEAST A DERIVATIVE OF HYALURONIC ACID, CHONDROGENIC CELLS, FOR
US6420243B1 (en) * 2000-12-04 2002-07-16 Motorola, Inc. Method for producing SOI wafers by delamination

Also Published As

Publication number Publication date
US6719968B2 (en) 2004-04-13
US6284872B1 (en) 2001-09-04
AU1301395A (en) 1995-06-27
DE69434651T2 (en) 2007-03-08
US20020160494A1 (en) 2002-10-31
JPH09506261A (en) 1997-06-24
FI962350A (en) 1996-07-16
WO1995016035A2 (en) 1995-06-15
OA10582A (en) 2002-08-23
JP2005312457A (en) 2005-11-10
EP0733109B9 (en) 2006-07-05
JP3717930B2 (en) 2005-11-16
US6984623B2 (en) 2006-01-10
KR100353182B1 (en) 2002-09-28
ES2255059T3 (en) 2006-06-16
JP2007016037A (en) 2007-01-25
FI119816B (en) 2009-03-31
EP0733109B1 (en) 2006-03-08
DE69434651D1 (en) 2006-05-04
EP0733109A1 (en) 1996-09-25
AU689184B2 (en) 1998-03-26
US5658882A (en) 1997-08-19
NO962304L (en) 1996-06-04
DK0733109T3 (en) 2006-07-03
FI962350A0 (en) 1996-06-06
JP3939729B2 (en) 2007-07-04
US20070004005A1 (en) 2007-01-04
US20040146923A1 (en) 2004-07-29
WO1995016035A3 (en) 1995-07-13
NO317801B1 (en) 2004-12-13
NO962304D0 (en) 1996-06-04
ATE319823T1 (en) 2006-03-15
CA2176942A1 (en) 1995-06-15
US7365052B2 (en) 2008-04-29
PT733109E (en) 2006-07-31

Similar Documents

Publication Publication Date Title
CA2176942C (en) Bmp-12, bmp-13 and tendon-inducing compositions thereof
EP1690874B1 (en) BMP-12, BMP-13 and tendon-inducing compositions thereof
AU692709B2 (en) BMP-15 compositions
EP0592562B1 (en) Bmp-9 compositions
AU677849B2 (en) BMP-10 compositions
US5637480A (en) DNA molecules encoding bone morphogenetic protein-10
AU763470B2 (en) Bone morphogenetic protein (BMP)-17 and BMP-18 compositions
ES2367035T3 (en) BMP-12, BMP-13 AND COMPOSITIONS OF THE SAME TO INDUCE TENDONS.
CA2574929C (en) Bone morphogenetic protein (bmp)-17 and bmp-18 and compositions

Legal Events

Date Code Title Description
EEER Examination request
MKEX Expiry

Effective date: 20141208