CA2108770C - Bmp-9 compositions - Google Patents

Abstract

Purified BMP-9 proteins and processes for producing them are disclosed. The proteins may be used in the treatment of bone and cartilage defects and in wound healing and related tissue repair.

Description

2, ~ ~ °'~'~ fl WO 93/00432 PC'I'/US92/~5374 The present invention relates to a novel family of purified proteins designated BMP-9 proteins and processes for obtaining them. These proteins may be used to induce bone and/or cartilage formation and in wound healing and tissue repair.
The murine BMP-9 DNA sequence (SEQ ID NO: 1), and amino acid sequence (SEQ ID NO: 2) are set forth in Figure 1. Human BMP-9 sequence is set forth in Figure 3 (SEQ ID NO: 8 and SEQ
ID NO: 9). It is contemplated that BMP-9 proteins are capable of inducing the formation of cartilage and/or bone. BMP-9 proteins may be further characterized by the ability to demonstrate cartilage and/or bone formation activity in the rat bone formation assay described below.
Murine BMP-9 is characterized~by comprising amino acid #319 to #428 of Figure 1 (SEQ ID NO: 2 amino acids #1-110).
Murine BMP-9 may be produced by culturing a cell transformed with a DNA, sequence comprising nucleotide #610 to nucleotide #1893 as shown in Figure 1 (SEQ ID NO: 1) and recovering and purifying from the culture medium a protein characterized by the amino acid sequence comprising amino acid #319 to #428 as shown in Figure 1 (SEQ ID N0: 2) substantially free from other proteinaceous materials with which it is co-produced.
Human BMP-9 is expected to be homologous to murine BMP-9 and is characterized by comprising amino acid #1 (Ser, Ala, Gly) to #110 of Figure 3 (SEQ ID NO: 9) (Arg). The invention includes methods for obtaining the DNA sequences encoding human BMP-9. This method entails utilizing the murine BMP-9 nucleotide sequence or portions thereof to design probes to screen libraries for the human gene or fragments thereof using standard techniques. Human BMP-9 may be produced by culturing SUBSTITUTE SHEET

CA 02108770 2003-03-14 . .. .. .. .._............._.~.,..,.. .
L
WO 93/00432 . PCT/US92/U5374 a cell transformed with the BMP-9 DNA sequence and recovering and purifying BMP-9 from the culture medium. The expressed protein is isolated, recovered, and purified from the culture r medium. The purified expressed protein is substantially free ~ from other proteinaceous materials with which it is co- .
produced, as well as from other contaminants. The recovered purified protein is. contemplated to exhibit cartilage and/or bone formation activity. The proteins of the invention may be further characterized by the ability to demonstrate cartilage and/or bone formation activity in the rat bone formation assay described below.
Human BMP-9 may be produced by culturing a cell transformed with a DNA'sequence~comprising nucleotide #124 to #453~'as shown in SEQ ID No: 8 and recovering and purifying from the culture medium a protein characterized by the amino acid sequence of SEQ ID NO: 9 from amino acid ~1 to amino acid X110 substantially free from other proteinaceous~ materials with which it is co-produced.
Another aspect of the invention provides pharmaceutical - compositions containing a therapeutically effective amount of a BMP-9 protein in a pharmaceutically acceptable vehicle or carrier. BMP-9 compositions of the invention may be used in the formation of cartilage. These compositions may further be utilized'for the formation of bone. BMP-9 compositions may also be used for wound healing and tissue repair. Compositions of the invention may further include at least one other therapeutically useful agent such as the BMP proteins.BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, and BMP-7 disclosed for instance in PCT publications W088/00205, W089/10409, and W090/11366, and BMP-8, disclosed in U.S. Patent No. 5,688,678.
.The compositions of the invention may comprise, in addition to a BMP-9 protein, other therapeutically useful agents including growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth W4 93/00432 ~ 1~ n ~ ~ rl ~ PG'T/US92/05374

3 factor (TGF-a and 'rGF-~3) , and insulin-like growth factor (IGF) .
The compositions may also include an appropriate matrix for instance, for supporting the composition and providing a surface for bone and/or cartilage growth. The matrix may provide slow release of the osteoinductive protein and/or the appropriate environment for presentation thereof.
The BMP-9 compositions may be employed in methods for treating a number of bone and/or cartilage defects, periodontal disease and various types of wounds. These methods, according to the invention, entail administering to a patient needing such bone and/or cartilage formation wound healing or tissue repair, an effective amount of a BMP-9 protein. These methods may also entail the administration of a protein of the invention in conjunction with at least one of the novel BMP
proteins disclosed in the co-owned applications described above. In addition, these methods may also include the administration of a BMP-9 protein with other growth factors including EGF, FGF, TGF-a, TGF-S, and IGF.
Still -a further aspect of the invention are DNA sequences coding for expression of a BMP-9, protein. Such sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in Figure 1 (SEQ ID NO: 1) and Figure 3 (SEQ ID NO:
8) or DNA sequences which hybridize under stringent conditions with the DNA sequences of Figure 1 or 3 and encode a protein having the ability to induce the formation of cartilage and/or bone. Finally, allelic or other variations of the sequences of Figure 1 or 3, whether such nucleotide changes result in changes in the peptide sequence or not, are also included in the present invention.
A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence therefor.
These vectors may be employed in a novel process for producing a BMP-9 protein of the invention in which a cell line transformed with a DNA sequence encoding a BMP-9 protein in SUBSTITUTE SHEET
~ Y::.
,mr i'.
,. JS .
't.
S

WO 93100432 P~f/US92/0537a~~~

4 operative association with an expression contral sequance therefor, is cultured in a suitable culture medium and a BMP-9 protein is recovered and purified therefrom,. This process may employ a number of known cells both prokaryotic and eukaryotic ' as host cells for expression of the palypeptide.
Other aspects and advantages of the present invention will be apparent upon consideration of the following detailed description and preferred embodiments thereof.
Brief Descrix~tion of the Drawincr FIG. 1 comprises DNA sequence and derived amino acid sequence of murine BMP-9 from clone MLl4a further described below.
FIG. 2 comprises DNA sequence and derived amino acid sequence of human BMP-4 from lambda U20S-3 ATCC #40342.
FIG. 3 comprises DNA sequence and derived amino acid sequence of human BMP-9 from ~ FIX/H6111 ATCC # 75252.
Detailed Describton of the Invention The murine BMP-9 nucleotide sequence (SEQ ID NO: 1) and encoded amino acid sequence (SEQ ID NO: 2) are depicted in Figure 1. Purified murine BMP-9 proteins of the present invention are produced by culturing a host cell transformed wth a DNA sequence comprising the DNA coding sequence of Figure 1 (SEQ TD NO: 1) from nucleotide #610 to nucleotide #1893 and recovering and purifying from the culture medium a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acid ,#319 to #428 of Figure 1 (SEQ ID No: 2). The BMP-9 proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present.
SUBS"T'iTUTE SHEET

?~ ~8~'~~
WO 93/00432 fCf/US92/05374 ' Human BMP-9 nucleotide and amino acid sequence is depictad in SEQ ID No: 8 and 9. Mature human BMP-9 is expected to comprise amino acid #1 (Ser, Ala, Gly) to #110 (Arg).
Human BMP-9 may be produced by culturing a sell

5 transformed with a DNA sequence comprising nucleotide #124 to #453 as shown in SEQ ID NO: 8 and recovering and purifying from the culture medium a protein characterized by the amino acid sequence of SEQ ID NO: 9 from amino acid #1 to amino acid #110 substantially free from other proteinaceous materials with which it is co-produced.
BMP-9 proteins may be characterized by the ability to induce the formation of cartilage. BMP-9 proteins may be further characterized by the ability to induce the formation of bone. BMP-9 proteins may be further characterized by the ability to demonstrate cartilage and/or bone formation activity in the rat bone formation assay described belaw. ' The BMP-9 proteins provided herein also include factors encoded by the sequences similar to those of Figure 1 and 3 (SEQ ID NO~s: 1 and 8), but into which modifications are naturally provided (e. g, allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of Figure 1 of Figure 3 (SEQ ID NO's: 2 and 9). These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with bone growth factor polypeptides of Figure 1 and Figure 3 may possess bone growth factor biological properties in common therewith. Thus, they may be employed as biologically active substitutes for naturally-occurring BMP-9 and other BMP-9 polypeptides in therapeutic processes.
Other specific mutations of the sequences of BMP-9 proteins described herein involve modifications of glycosylation sites. These modifications may involve O-linked suBSrrruTE sHE~-2~ ~'~~~~
VYU 93/00432 ' fCT/C1S92/053' .

6 or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked ' glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of amino acid substitutions l0 or deletions at one or both of the first or third amino acid positions. of a glycosylation recognition site (and/or. amino acid, deletion at the second position) results in non-glycosylation at the modified tripeptide sequence.
The present invention also encompasses the novel DNA
sequences, free of association with DNA sequences encoding other proteinaceous materials, and COdlng on expression for BMP-9 proteins. These DNA sequences~include those depicted in Figure 1 or Figure 3 (SEQ ID NO~s: 1 and 8) in a 5~ to 3~
direction and those sequences which hybridize thereto under stringent hybridization conditions [see, T. Maniatis et al, ~rolecular C~onincr fA Laboratory Manual, Cold Spring Harbor Laboratory (1982), pages 387 to 389] and encode a protein having cartilage and/or bone inducing activity.
Similarly, DNA sequences which code for BMP-9 proteins coded for by the sequences of Figure 1 or Figure 3, but which differ in colon sequence due to the degeneracies of the genetic cads or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein.
Variations in the DNA sequences of Figure 1 or Figure 3 (SEQ ID
NO: 1 and 8) which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the invention.
Another aspect of the present invention provides a novel SUBSTITUTE SHEET

WO 93/00432 ? ~ ~ ~ ~ ~ I'CT/U592/05374

7 method for producing BMP-9 proteins. The method of the present invention involves culturing a suitable call line, which has been transformed with a DNA sequence encoding a BMP-9 protein of the invention, under the contral of known regulatory sequences. The transformed host cells are cultured and the BMP-9 proteins recovered and purified from the culture medium.
The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.
Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO). The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively, Kaufman et al, )Hol. Cell . Blol. , 5 (7) : 1750-1759 (1985) or Howley et a'1, U.S. Patent 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. The mammalian cell CV-1 may also be suitable.
Bacterial cells may also be suitable hosts. Far example, the various strains of E. coli (e.g., HB101, MC1061) are well-known as host cells in the field of biotechnology.
Various strains of B_, subtilis, Pseudomonas, other bacilli and the like may also be employed in this method.
Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Enaineerina, 8_:277-298 (Plenum Press 1986) and references cited therein.
Another aspect of the present invention provides vectors for use in the method of expression of these novel BMP-9 polypeptides. Preferably the vectors contain the full novel SUBSTITUTE SI-iEET

WO 93/00432 PCr/US92/053'7~''~

8 DNA sequences described above which encode the novel factors of the invention. Additionally the vectors also contain appropriate expression control sequences permitting expression of the BMP-9 protein sequences. Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention. The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing the replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and may be selected depending upon the host cells. Such selection is routine and does not form part of the present invention.
A protein of the present invention, which induces cartilage and/or bone formation in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage defects in humans and other animals.
Such a preparation employing a BMP-9 protein may have prophylactic use in closed as well, as open fracture reduction and also in the improved fixation of artificial joints. De novo bane formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery. A BMP-9 protein may be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells.
BMP-9 polypeptides of the invention may also be useful in the treatment of osteoporosis. A variety of osteogenic, cartilage-inducing and bone inducing factors have been described.. See, e.g. European patent applications 148,155 and 169,016 for discussions thereof.
SUBSTITUTE SHEET

~,;.~~, ~ .1.., ~ ~ ~ r~ ~ ~~cr/us92/os3~4 .. WO 93/00432

9 The proteins of the inventian may also be used in wound healing and related tissue repair. The types of wounds include, but a,re not limited to burns, incisions and ulcers.
(See, e.g. PCT Publication W084/01106 for discussion of wound healing and related tissue repair).
It is further contemplated that proteins of the invention may increase neuronal survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival.
l0 A further aspect of the invention is a therapeutic method and composition for repairing fractures and other conditions related to cartilage and/or bone defects or periodontal dis-eases. The invention further comprises therapeutic methods and compositions for wound healing and tissue repair. Such compositions comprise a therapeutically effective amount of at least one of the BMP-9 proteins of the invention in admixture with a pharmaceutically acceptable vehicle, carrier or matrix.
It is expected that the proteins of the invention may act in concert with or perhaps synergistically with other related proteins and growth factors. Further therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one BMP-9 protein of the invention with a therapeutic amount of at least one of the other BMP proteins disclosed in co-owned applications described above. Such combinations may comprise separate molecules of the BMP
proteins or heteromolecules comprised of different BMP
moieties. For example, a method and compasition of the invention may comprise a disulfide linked dimer comprising a BMP-9 protein subunit and a subunit from one of the "BMP"
proteins described above. A further embodiment may comprise a heterodimer of BMP-9 moieties. Further, BMP-9 proteins may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question.
These agents include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), SUBSTITUTE Si-tEET

!"M
WO 93/00432 , ~ fC'T/US92/053i: , transforming growth factors (TGF-a and TGF-a) , and insulin-like growth factor (TGF).
The preparation and formulation of such physiologically acceptable protein compositions, having due regard to pH, ' 5 isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently valuable for veterinary applications due to the lack of species specificity in BMP proteins. Particularly domestic animals and thoroughbred horses in addition to humans are desired patients

10 for such treatment with BMP-9 of the present invention.
The therapeutic method includes administering the composition topically, systemically, or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, ' 15 physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage.
Topical administration may be suitable for waund healing and tissue repair. Therapeutically useful agents other than the BMP-9 proteins which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with ,the BMP composition in the methods of the invention.
Preferably for bone and/or cartilage formation, the composition would include a matrix capable of delivering BMP-9 or other BMP proteins to the site of bone and/or cartilage damage, providing a structure for the developing bone and cartilage and optimally capable of being resorbed into the body. The matrix may provide slow release of BMP-9 and/or the appropriate environment for presentation thereof. Such matrices may be formed of materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular SUBSTITIJrE SHEET

CA 02108770 2003-03-14 , :. _.. _ ..

11 application of the BMP-9 compositions will define the appropriate formulation. Potential matrices . for the compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid and polyanhydrides. Other potential materials are biodegradable and biologically well defined; such as bone or dermal collagen. Further matrices are comprised of pure_ proteins or extracellular matrix components. other. potential matrices are nonbiodegradable and chemically defined, such as l0 sintered hydroxyapatite, bioglass; v aluminates, orw other ceramics.; y.::Matrices.:may. be comprised- of combinations of any of the above -mentioned types of material, such as polylactic acid and hydroxyapatiteworacoilagen and trica3ciumphosphate. The bioceramics may be altered in composition, such as in calcium-.
aluminate-phosphate and processing to alter pore size, particle size, particle shape, and~~biodegradability.-The dosage regimen will be determined by the attending physician considering :various factors which modify the action of the BMP-9 protein, e.g. amount of bone weight desired to be formed, the site, of bone damage, the condition of the damaged bone, the size of a wound, type of damaged tissue, the patient s age, sex, and diet,-the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the types of BMP proteins in the composition. The addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage. Progress can be monitored by periodic assessment of bone growth and/or repair, for example, x-rays, histomorphometric determinations and tetracycline labeling.
The following examples illustrate practice of the present invention in recovering and characterizing murine BMP-9 protein and employing it to recover the human and other BMP-9 proteins, obtaining the human proteins and expressing the proteins via recombinant techniques.
* Trade-mark CA 02108770 2003-03-14 . : . . ._- ... _. __......._ .__.. .. .- . . .
S ~ .
WO 93/00432 . PCT/US92/05374

12 EXAMPLE I
Murine BMP-9 750, 000 recombinants 'of a mouse liver cDNA library made in the vector lambdaZAP~'(Stratagene/Catalog ,935302) are plated and duplicate nitrocellulose replicas made. A fragment .of human BMP-4 DNA...corresponding-to nucleotides 1330-1627 of Figure 2 (SEQ ID NO: 3) (the human BMP-4 sequence) is ~P-.
labeled by the random priming procedure of Feinberg et al.
[Anal. Biochem: 132: 6-13 (1983)] and hybridized to both sets of filters in SHB at~.60°C for 2 to 3 days. Both sets of filters are washed under reduced stringency conditions'-(-4X SSC, 0.1%
SDS at 60°C). Many duplicate hybridizing recombinants of -various intensitiesr:(approximately '92) are noted:" 50 of the strongest hybridizing recombinant bacteriopha'ge are plaque purified and their- inserts are transferred, to the plasmid Bluescript SK (+/-)according to the ~ vivo~excision protocol described by the manufacturer (Stratagene). DNA sequence analysis of several recombinants indicate that they encode a .
protein homologous to other BMP proteins and other proteins in the TGF-Q family. The DNA sequence and derived amino acid sequence of one recombinant, designated MLl4a, is set forth in Figure 1.. ( SEQ ID NO: 1 The nucleotide sequence of clone MLl4a contains an open reading frame of 1284 bp, encoding a BMP-9 protein of 428 amino acids. The encoded 428 amino acid BMP-9 protein is contemplated to be the primary translation product as the coding sequence is preceded by 609 by of 'S' untranslated sequence with stop codons i.n all three reading frames. The 428 amino acid sequence predicts a BMP-9 protein with a molecular weight of 48,000 daltons.
Based on knowledge of other BMP proteins and other proteins within the TGF-(3 family, it is predicted that the precursor polypeptide would be cleaved at the multibasic sequence ARG-ARG-LYS-ARG in agreement with a proposed consensus * Trade-mark 2~.(~~'~'~~J
WO 93/00432 fC'f/US92/U5374

13 proteolytic processing sequence of ARG-X-X-ARG. Cleavage of the BMP-9 precursor polypeptide at this location would generate a 110 amino acid mature peptide beginning with the amino acid SER at position #319. The processing of BMP-9 into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to the processing of the related protein TGF-~ [L. E. Gentry, et al., ~iolec. & Cell_ Biol. 8:4162 (1988); R. Derynck, et al., Nature 316:701 (1985)].
It is contemplated therefore that the mature active species of murine BMP-9 comprises a homodimer of 2 polypeptide subunits, each subunit comprising amino acids #319-#428 with a predicted molecular weight of approximately 12,000 daltons.
Further active species are contemplated comprising amino acids #326 - #428 thereby including the first conserved cysteine residue. As with other members of the BMP and TGF-~ family.of proteins, the carboxy-terminal region of the BMP-9 protein exhibits greater sequence conservation than the more amino-terminal portion. The percent amino acid identity of the murine BMP-9 protein in the cysteine-rich C-terminal domain (amino acids #326 - #428) to the corresponding region of other human BMP proteins and other proteins within the TGF-(3 family is as follows: BMP-2, 53%; BMP-3, 43%; BMP-4, 53%; BMP-5, 55%;
BMP-6, 55%; BMP-7,. 53%; Vgl, 50%; GDF-1, 43%; TGF-~l, 32%; TGF-/32, 34%; TGF-/33, 34%; inhibin S(B) , 34%; and inhibin ~(A) , 42%.
EXAMPLE II
Human B1~P-9 Murine and human osteoinductive factor genes are presumed to be significantly homologous, therefore the murine coding sequence or a portion thereof is used as a probe to screen a human genomic library or as a probe to identify a human cell line or tissue which synthesizes the analogous human cartilage and/or bone protein. A human genomic library (Toole et al., supra) may be screened with such a probe, and presumptive SUE3STITlJTE SHEET

WO 93/00432 f'GT/(JS92/()537~''

14 positives isolated and DNA sequence obtained. Evidence that this recombinant encodes a portion of the human BMP-9 relies of the murine/human protein and gene structure homologies, Once a recombinant bacteriophage containing DNA encoding portion of the human cartilage and/or bone inductive factor molecule is obtained, the human coding sequence can be used as a probe to identify a human cell line or tissue which synthesizes BMP-9. Alternatively, the marine coding sequence can be used as a probe to identify such human cell line or tissue. Briefly described, RNA is extracted from a selected cell or tissue source and either electrophoresed on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formaldehyde and spotted on nitrocellulose directly. The nitrocellulose is then hybridized to a probe derived from a coding sequence of the marine or human BMP-9.
mRNA is selected by oligo (dTj cellulose chromatography and cDNA is synthesized and cloned in lambda gtl0 or lambda ZAP by established techniques (Toole et al,, su ra).
Additional methods known to those skilled in the art may be used to isolate the human and other species BMP-9 proteins of the invention.
A. Isolation of Human BMP-9 DNA
One million recombinants of a human genomic library constructed in the vector FIX (Stratagene catalog # 944201) are plated and duplicate nitrocellulose replicas made. Two oligonucleotides probes designed on the basis of nucleotides #1665-#1704 and #1837-#1876 of the sequence set forth in Figure 1 (SEQ ID N0:1) are synthesized on an automated DNA
synthesizer. The sequence of these two oligonucleotides is indicated below:
#l: CTATGAGTGTAAAGGGGGTTGCTTCTTCCCATTGGCTGAT
#2: GTGCCAACCCTCAAGTACCACTATGAGGGGATGAGTGTGG
These two oligonucleotide probes are radioactively labeled with ~UBST1TUTE SHEET

WO 93/00432 fCa f/lJS9Z/0"374 y3xp_ATP and each is hybridized to one set of the duplicate nitrocellulose replicas in SHB at 65°C and washed with 1X SSC, 0.1% SDS at 65°C. Three recombinants which hybridize to both oligonucleotide probes are noted. All three positively 5 hybridizing recombinants are plaque purified, bacteriophage plate stocks are prepared and bacteriophage DNA is isolated from each. The oligonucleotide hybridizing regions of one of these recombinants, designated HG111, is localized to a 1.2 kb Pst I/Xba I fragment. This fragment is subcloned into a 10 plasmid vector (pGEM-3) and. DNA sequence analysis is performed.
HG111 was deposited with the ATCC, 12301 Parklawn Drive., Rockville, Maryland USA on June 16, 1992 under the requirements of the Budapest Treaty and designated as ATCC # 75252. This subclone is designated pGEM-111. A portion of the DNA sequence

15 of clone pGEM-111 is set forth in Figure 3 (SEQ ID N0:8/ HUMAN
BMP-9 sequence). This sequence encodes the entire mature region of human BMP-9 and a portion of the propeptide. It should be noted that this sequence consists of preliminary data. Particularly, the propeptide region is subject to 20' further analysis and characterization. For example, nucleotides #1 through #3 (TGA) encode a translational stop which may be incorrect due to the preliminary nature of the sequence. It is predicted that additional sequences present in both pGEM-111 (the 1.2 kb PstI/XbaI fragment of HG111 subcloned into pGEM) and HG111 encode additional amino acids of the human BMP-9 propeptide region. Based on knowledge of other BMPs and other proteins within the TGF-(3 family, it is predicted that the precursor polypeptide would be cleaved at the multibasic sequence ARG-ARG-L~YS-ARG (amino acids # -A through # -1 of SEQUENCE ID N0:9) in agreement with a proposed consensus proteolytic processing sequence ARG-X-X-ARG. Cleavage of the human BMP-9 precursor polypeptide at this location would generate a 110 amino acid mature peptide beginning with the amino acid SER at position #1 of SEQUENCE ID N0:9 (encoded by SUBSTITUTE SHEET

WO 93/00432 fCT/US92/()537~~~~

16 nucleotides #124 through #126 of SEQUENCE xD N0:8j. The processing of human BMP-9 into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to the processing of the related protein TGF-~
[L.E. Gentry, et al., Molec. & Cell. Biol. 8:4162 (1988); R.
Derynck, et al., Nature 316:701 (1985)].
Tt is contemplated therefore that the mature active species of human BMP-9 comprises a homodimer of two polypeptide subunits, each subunit comprising amino acids #1 through #110 of SEQUENCE ID N0:9, with a predicted molecular weight of 12,000 daltons. Further active species are contemplated comprising amino acids #8 through #11o thereby including the first conserved cysteine residue. As with other members of the BMP and TGF-(3 family of proteins, the carboxy-terminal portion of the human BMP-9 sequence exhibits greater sequence conservation than the amino-terminal portion. the percent amino acid identity of the human BMP-9 protein in the cysteine-rich C-terminal domain (amino acids #8 through ,110) to the corresponding region of other human BMP proteins and other proteins within the TGF-(3 family is as follows: BMP-2, 52%;
BMP-3, 40%; BMP-4, 52%; BMP-5, 55%; BMP-6, 55%; BMP-7, 53%;
murine BMP-9, 97%; Vgl, 50%; GDF-l, 44%; TGF-(31, 32%; TGF-(32, 32%; TGF-/~3, 32%; inhibin /3 (Bj, 35%; and inhibin (3 (A), 41%.
EXAMPLE III
Rosen Modified Samoath Reddi Assav A modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Natl. Acad Sci U S A , 80:6591-6595 (1983) is used to evaluate bone and/or cartilage activity of the eMP proteins. This modified assay is herein called the Rosen-modified Sampath-Reddi assay. The ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialy2ing (if the composition is a solution) or diafiltering (if the composition is a suspension) the fraction to be assayed against water. The solution or suspension is then redissolved SUBSTITUTE SHEET' ?1 ~~77~

17 in o.l % TFA, and the resulting solution added to 20mg of rat matrix. A mock rat matrix sample not treatad with the protein serves as a control. This material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules. The capsules are implanted subcutaneously in the abdominal thoracic area of 21 - 49 day old male Long Evans rats. The implants are removed after 7 - 14 days. Half of each implant is used for alkaline phosphatase analysis, [See, A. H. Reddi et al., Proc. Natl Acad Sci., 69:1601 (1972)].
The other half of each implant is fixed and processed for histological analysis. l~n glycolmethacrylate sections are stained with Von Kossa and acid fuschin to score.'the amount of induced bone and cartilage formation present in each implant.
The terms +1 through +5 represent the area of each histological section of an implant occupied by new bone and/or cartilage cells and matrix. A score of +5 indicates that greater than 50% of the implant is new bone and/or cartilage produced as a direct result of protein in the implant. A score of +4, +3, +2 and +1 would indicate that greater than 40%, 30%, 20% and 10% respectively of, the implant contains new cartilage and/or bone. In a modified scoring method, three non-adjacent sections are evaluated from each implant and averaged. "+/-" indicates tentative identification of cartilage or bone; "+1" indicates >10% of each section being new cartilage or bone; "+2", >25%; "+3", >50%; "+4", -75%;
"+5", >80%. A "-" indicates that the implant is not recovered.
It is contemplated that the dose response nature of the BMP-9 containing samples of the matrix samples will demonstrate that the amount of bone and/or cartilage formed increases with the amount of BMP-9 in the sample. It is contemplated that the control samples will not result in any bone and/or cartilage formation.
As with other cartilage and/or bone inductive proteins such as the above-mentioned "BMP" proteins, the bone and/or cartilage formed is expected to be physically confined to the aUBST'ITUTE SHEET

21Q8"~'~~
WO 93/00432 ~ PG'f/'~US92/05371'''.,

18 space occupied by the matrix. Samples ara alBO analyzed by fD8 gel electrophoresis and isoelectric focusing followed by autoradiography. The activity is correlated with the protein bands and p2. To estimate the purity of the protein in a ' particuJ.ar fraction an extinction coefficient of 1 OD/mg-cm is used as an estimate for protein and the protein is run on sDS
PAGE followed by silver staining or radioiodination and autoradiography.
EXAMPLE IV ' Expression of BMP-9 In order to produce murine, human or other mammalian BMP-9 proteins, the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. The preferred expression system for biologically active recombi.nant'human BMP-9 is contemplated to be stably transformed mammalian cells.
One skilled in the art can con$truct mammalian expression 2o vectors by employing the sequence of Figure 1 (SEQ ID NO: 1) or Figure 3 (SEQ ID N0: 8), or other DNA sequences encoding BMP-9 proteins or other modified sequences and known vectors, such as pCD [Okayama et al., Mol. Cell Biol., 2:161-170 (1982)], pJL3, pJL4 (cough et al., EMBO J., 4:645-653 (1985)) and pMT2 CXM.
The mammalian expression vector pMT2 CXM is a derivative of p91023 (b) (Worig et al., Science ~2 :810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline resistance gene and further contains a XhoI site for insertion of cDNA clones.
The functional elements of pMT2 CXM have been described (Kaufmari, R.J., 1985, Proc. Natl. Acad. Sci. USA _8:689-693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 by enhancer, the adenovirus major late promoter including a 5' splice site and the majority of SUBSTITUTE SHEET

1'('f/US~)2/05374 ~NQ 93/00432

19 the adenovirus tripartite leader sequence present an adsnovirur~
late mRNAs, a 3' splice acceptor site, a DFiFR insert, tht~ SV40 early polyadenylation site (SV40), and pBR322 sequences neaded for propagation in E. col .
Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under accession number ATCG 67122. EcoRI digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout/in mutagenesis [Morinaga, et al., Biotechnoloay 84: 636 (1984).
This removes bases 1075 to 1145 relative to the Hind III site near the SV40 origin of replication and enhancer sequences of pMT2. In addition it inserts the following sequence:
5' PO-CATGGGCAGCTCGAG-3' (SEQ TD NO: 5) at nucleotide 1145. This sequence contains the recognition site for the restriction endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains recognition sites for the restriction endonucleases PstI, Eco RI, SalI and XhoI. Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods.
pEMC2b1 derived from pMT21 may also be suitable in practice of the invention. pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. Coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods.
pMT21 is derived fram pMT2 through the following two modifications. First, 76 by of the 5' untranslated region of the DHFR cDNA including a stretch of 19 G residues from G/C
tailing for eDNA cloning is deleted. In this process, a XhoI
site is inserted to obtain the following sequence immediately SI.~BST'iTUTE SHEET
>::
y..
s:
;<

,.
--,, WO 93/00432 fCr/U~92/05374,-upstream from DHFR: 5' -C GC GCGAGCCT~CAATTCCTGGAGCCATCj~C-3~
Pstl Eco RI Xhol (SEQ ID N0: 6) Second, a unique Clal site is introduced by digestion with 5 EcoRV and XbaI, treatment with Klenow fragment of DNA
polymerase I, and ligation to a Clal linker (CATCGATG). This deletes a 250 by segment from the adenovirus associated RNA
(VAI) region but does not interfere with VAI RNA gene expression or function. pMT21 is digested with EcoRI and XhoI, 10 and used to derive the vector pEMC2B1.
A portion of the EMCV leader is obtained from pMT2-ECAT1 [S. K. Jung, et al, J. Virol 63:1651-1660 (1989)] by digestion with. Eco RI and PstI, resulting in a 2752 by fragment. This fragment is digested with TaqI yielding an Eco RI-TaqI fragment 15 of 508 by which is purified by electrophoresis on low melting agarose gel. A 68 by adapter and its coanplementary strand are synthesized with a 5' Taql protruding end and a 3' XhoI
protruding end which has.the following sequence:

20 5'-CGAGGTTAAAAA.ACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT
TaqI
GAAAAACACGATTG_C-3' XhoI ~(SEQ TD NO: 7) This sequence matches the EMC virus leader. sequence from nucleotide 763 to 827. It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a XhoI
site. A three way ligation of the pMT21 Eco RI-XhoI fragment, the EMC virus EcoRI-TaqI fragment, and the 68 by oligonucleotide adapter TaqI-XhoI adapter resulting in the vector pEMC2(31.
This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation SUBSTITUTE SHEET

CVO 93/00432 ? ~ ~ ~ , rl ~ PCT/US92/05374

21 signal and the adenovirus VA T gene, DHFR and ~-lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.
The construction of vectors may involve modification of the BMP-9 DNA sequences. For instance, BMP-9 cDNA can be modified by removing the non-coding nucleotides on the 5~ and 3~ ends of the coding region. The deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expressian. These vectors are transformed into appropriate host cells for expression of BMP-9 proteins.
One skilled in the art can manipulate the sequences of Figure 1 or Figure 3 (SEQ ID NO: 1 and 8) by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences therefrom or altering nucleotides therein by other known. techniques). The modified BMP-9 coding sequence could then be inserted into a known bacterial vector using procedures such as described in T.
Taniguchi et al., Proc. Natl Acad. Sci. USA, 77:5230-5233 (1880). This exemplary bacterial vector could then be transformed into bacterial host cells and a BMP-9 protein expressed thereby. For a strategy for producing extracellular expression of BMP-9 proteins in bacterial cells, see, e.g.
European patent application EPA 177,343.
Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures described in published European patent application 155,476) for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the facto.: s of the present invention by yeast cells. [See, e.g., procedures SUBSTITUTE SHEET

W0 93/00432 pf.'f/tJS)2/t)537~

22 described in published PCT application W086/00639 and European patent application EPA 123,289].
A method for producing high levels of a BtdP-9 protein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous BMP-9 gene. The heterologous gene is linked to an amplifiable marker, e,g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) l0 according to the procedures of Kaufman and Sharp, J. Mol.
Biol., 159:601-629 (1982). This approach can be employed with a number of different cell types.
For example, a plasmid containing a DNA sequence for a BMP-9 of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR
expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell:
Biol,, 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO cells, DUKX-BII, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol., 5:1750 (1983), Transformants are cloned, and biologically active BMP-9 expression is monitored by the Rosen-modified Sampath - Reddi rat bone formation assay described above in Example III, BMP-9 expression should increase with increasing levels of MTX resistance. BMP-9 polypeptides are characterized using standard techniques known in the art such as pulse labeling with [35S) methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related BMP-9 proteins.
SUBSTITUTE SHEET

?~ ~~'~'~0 WO 93/00432 i'C'T/U592/05374

23 A. BMP-9 Vector Construction In order to produce human BMP-9 proteins o~ the invention DNA sequences encoding the mature region of the human BMP-9 protein may be joined to DNA sequences encoding the propeptide region of the murine BMP-9 protein. This murine/human hybrid DNA sequence is inserted into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. The construction of this murine/human l0 BMP-9 containing expression plasmid is described below.
A derivative of the human BMP-9 sequence (SEQ ID N0:8) comprising the nucleotide sequence from nucleotide #105 to #470 is specifically amplified. The following oligonucleotides are utilized as primers to allow the amplification of nucleotides #105 to #470 of the human BMP-9 sequence (SEQ ID N0:8) from clone pGEM-111 described above.
#3 ATCGGGCCCCTTTTAGCCAGGCGGAAAAGGAG
#4 AGCGAATTCCCCGCAGGCAGATACTACCTG
This procedure generates the insertion of the nucleotide sequence ATCGGGCCCCT immediately proceeding nucleotide #105 and the insertion of the nucleotide sequence GAATTCGCT immediately following nucleotide #470. The addition of these sequences results in the creation of an Apa I and EcoR I restriction endonuclease site at the respective ends of the specifically amplified DNA fragment. The resulting 374 by Apa I/EcoR I
fragment is subcloned into the plasmid vector pGEM-7Zf(+) (Promega catalog# p2251) which has been digested with Apa I and EcoR I. The resulting clone is designated phBMP9mex-1.
The following oligonucleotides are designed on the basis of murine BMP-9 sequences (SEQ ID N0:1) and are modified to facilitate the construction of the murine/human expression plasmid referred to above:
#5 GATTCCGTCGACCACCATGTCCCCTGGGGCCTGGTCTAGATGGATACACAGCTGTGGGGCC
SUB~~TiTiJ1'E SHEET
S-.

VV~ 93/OU432 E'C~I'/US92/0537;~.~
2a #6 CCACAGCTGTGTATCCATCTAGACCAGGCCCCAGGGGACATGGTGGTCGACG
These oligonucleotides contain complimentary sequences which upon addition to each other facilitate the annealing (base pairing) of the two individual sequences, resulting in the formation of a double stranded synthetic ANA linker (designated LINK-1) in a manner indicated below:

i , i t i i #5GATTCCGTCGACCACCATGTCCCCTGGGGCCTGGTCTAGATGGATACACAGCTGTGGGGCC
GCAGCTGGTGGTACAGGGGACCCCGGACCAGATCTACCTATGTGTCGACACC #6 This DNA linker (LINK-1) contains recognition sequences of restriction endonucleases needed to faci t ; t-atP ~"h~o,~"e.,~
manipulations required to construct the murine/human expression plasmid, as well as sequences required for maximal expression of heterologous sequences in mammalian cell expression systems.
More specifically (referring to the~sequence numbering of oligonucleotide #5/LINK-1): nucleotides #1-#11 comprise recognition sequences for the restriction endonucleases BamH I
and Sal I, nucleotides #11-#15 allow far maximal expression of heterologuos sequences in mammallian cell expression systems, nucleotides #16-#31 correspond to nucleotides #610-#625 of the murine BMP-9 sequence (SEQ ID NO:1), nucleotides #32-#33 are inserted to facilitate efficient restriction digestion of two adjacent restriction endonuclease sites (Eco0109 I and Xba I), nucleotides #34-#60 correspond to nucleotides #1515-#1541 of the murine BMP-9 sequence (SEQ ID NO:1) except that nucleotide #58 of synthetic oligonucloetide #5 is a G rather than the A
which appears at position #1539 of SEQ ID N0:1 (This nucleotide conversion results in the creation of an Apa I restriction SUBSTITUTE SHEET

P~GT/US92/05374 endonuclease recognition sequence, without altexing the amino acid sequence it is intended to encode, to facilitate further.
manipulations of the murine/human hybrid expression plasutid.
LINK-1 (the double stranded product of the annealing of 5 oligonucleotides #5 and #6) is subcloned into the plasmid vector pGEM-7Zf (+) which has been digested with the restriction endonucleases Apa I and BamH I. This results in a plasmid in which the sequences normally present between the Apa I and BamH
I sites of the pGEM-7Zf (+) plasmid polylinker are replaced with 10 the sequences of LINK-1 described above. The resulting plasmid clone is designated pBMP-Slink.
pBMP-Slink is digested with the restriction endonucleases BamH I and Xba I resulting in the removal nucleotides #1-#34 of LINK-1 (refer to the numbering of oligo #5). Clone MLl4a, 15 which contains an insert comprising the sequence set forth in SEQ ID N0.:1, is also digested with the restriction endonucleases BamH I and Xba I resulting in the removal of sequences comprising nucloetides #1-#1515 of SEQUENCE ID NO:1 (murine BMP-9). This BamH I/Xba I fragment of mouse BMP-9 is 20 isolated from the remainder of the MLl4a plasmid clone and subcloned into the BamH I/Xba I sites generated by the removal of the synthetic linker sequences described above. The resulting clone is designated p302.
The p302 clone is digested with the restriction 25 endonuclease Eco0109 I resulting in the excision of nucloetides corresponding to nucleotides #621-#1515 of the murine BMP-9 SUBST'iTUTE SHEET

WO 93/00432 fCf/1JS92/0537~'~~~~' sequence (SEQ ID NO; 1) arid nucleotides #35-#59 of LINK-1 (refer to numbering of oligonucleotide #5). It should be noted that the Apa I restriction site created in LINK-1 by the A to G
conversion described above is a subset of the recognition sequence of Eco0109 I, therefore digestion of p302 with Eco0109 I cleaves at the Apa I site as well as the naturally occuring marine Ecoo109 I (location #619-#625 of SEQ ID NO:1) resulting in the excision of a 920 by Eco0109 I/Eco0109 I (Apa I) fragment comprising the sequences described above. This 920 Eco0,109 I/Eco0109 I (Apa I) fragment is isolated from the remainder of the p302 plasmid clone and subcloned into clone pBMP-Slink which has been similarly digested with Ecool09 1.
It should be noted that the nucleotides GG (#32-#33 of oligonucleotide #5) originally designed to facilitate a more complete digestion of the two adjacent restriction sites Eco0109 I and Xba I of LINK-1, which is now a part of pBMP-9link (described above), results in the creation of Dcm methylation~recognition sequence. The restriction nuclease Eco0109 I is sensitive, to Dcm methylation and therefore cleavage of this sequence (nucleotides #25-#31 of oligonucleotide #5/LINK-Z) by the restriction endonuclease Ecool09 I is prevented at this site. Therefore the plasmid clone pBMP-Slink is cleaved at the Apa I site but not at the Eco0109 I site upon digestion with the restriction endonuclease Eco0109 I as described above, preventing the intended removal of the sequences between the Eco0109 I and Xba I site of LINK-1 SUBSTITUTE SHEET

' ° I'Cf/US92/U5374 WO 93/OU432 ~ ~~ ~ ~ rl r~

(#32-#55 defined by the numbering of oligonucleotide #5) . This results in the insertion of the 920 by Ecoo109 I/Apa I fragment at the Eco0109 T (Ape I) site of pBMP-Slink. The resulting clone is designated p318.
Glone p318 is digested with the restriction endonucleases sal I and Apa I, resulting in the excision of sequences comprising nucleotides #6-#56 of LINK-1 (refer to oligo #5 for location), nucleotides #621-#1515 of murine BMP-9 (SEQ ID
N0:1) , and nucleotides #35-#60 of LINK-1 (refer to oligo #5 for location) . The resulting 972 by Sal I/Apa I fragment described above is isolated from the remainder of the p318 plasmid clone and will be utilized in subsequent manipulations.
The clone phBMP9mex-1 (described above), which contains DNA sequences which encode the entire mature region and portions of the propeptide of 'the human BMP-9 protein, is digested with the restriction endonucleases Apa I and EcoR I.
This results in the excision of a 374 by fragment comprising nucleotides #105-#470 of the human BMP-9 sequence (SEQ ID N0:8) and the additional nucleotides of oligonucleotide primers #3 and #4 which contain the recognition sequences for the restriction endonucleases Apa I and EcoR I. This 374 by Apa I/EcoR T fragment is combined with the 972 by Sal I/Apa I
fragment from p138 (isolation described above) and ligated to the mammalian cell expression plasmid pED6 (a derivative of pEMC2a1) which has been digested with Sal I and EcoR I. The resulting clone is designated p324.
SUBSTITUTE SHEET' 1.
c.
~t.

2~.0~ s7~
WO 93/00432 f'C,'f/US92/OS374~~'~

The clone MLl4a (murine BMP-9) is digested with Eco0109 I
and Xba I to generate a fragment comprising nucleotides #621-#1515 of SEQ ID N0:1.
The following oligonucleotides are synthesized on an automated DNA synthesizer and combined such that their complimentary sequences can base pair (anneal) with each other to generate a double stranded synthetic DNA linker designated LINK-2:
#7 TCGACCACCATGTCCCCTGG
~#8 GCCCCAGGGGACATGGTGG
This double stranded synthetic DNA linker (LINK-2) anneals in such a way that it generates single stranded ends which are compatible to DNA fragments digested with Sal I (one end) or Eco0109 I (the other end) as indicated below:
#7 TCGACCACCATGTCCCCTGG
GGTGGTACAGGGGACCCCG #8~
This LINK-2 synthetic DNA linker is ligated to the 895 by Eco0109 I/Xba I fragment comprising nucleotides #621-#1515 of murine BMP-9 (SEQ ID No:l) described above. This results in a 915 by Sal I/Xba I fragment.
The clone p324 is digested with Sal I/Xba I to remove sequences comprising nucleotides #6-#56 of LINI(-1 (refer to oligo #5 for location) and nucleotides #621-#1515 of murine BMP-9 (SEQ ID NO:1). The sequences comprising nucleotides #35-#60 of LINK-1 (refer to oligo #5 for location) and the sequences comprising the 374 by Apa I/EcoR I fragment (human BMP-9 sequences) derived from phBMP9mex,-1 remain attached to SUBSTITUTE SHEET

21 ~ R'~'~ ~
r~ xT,?, ~O 93/00432fCf/US92/05394 the pED6 backbone. The 915 by Sal I/Xba I fragment comprising LINK-2 sequences and nucleotides #621-#1515 of marine BMP-9 (SEQ ID No:1) is ligated into the p324 clone from which the Sal I to Xba I sequences described above have been removed.
The resulting plasmid is designated BMP9fusion and comprises LINK-2, nucleotides #621-#1551 of marine BMP-9 (SEQ
ID NO:1), nucleotides #35-#59 of LINK-1 (refer to the numbering of oligonucleotide #5), and the 374 by Apa I/EcoR I fragment (human BMP-9) derived from clone pBMP9mex-1 (described above) inserted between the Sal I and EcoR I sites of the mammalian cell expression vector pED6.
BMP9 fusion is transfected into CHO cells using standard techniques known to those having ordinary skill in the art to create stable cell lines capable of expressing human BMP-9 protein. The cell lines are cultured under suitable culture conditions and the BMP-9 pratein is isolated and purified from the culture medium.
EXAMPLE V
Bioloaical Activity of Expressed BMP 9 To measure the biological activity of the expressed BMP-9 proteins obtained in Example IV above, the proteins are recovered from the cell culture and purified by isolating the BMP-9 proteins from other proteinaceous materials with which they are co-produced as well as from other contaminants. The purified protein may be assayed in accordance with the rat bona S~JBSTiTUTE SHEET

~~0~'~'~i7 ,..,.., WO 93/00432 PCT/U~92/QS37:, formation assay described in Example TIT.
Purification is carried out using standard techniques known to those skilled in the art. It is contemplated, a~ with other BMP proteins, that purification may include the use of Heparin sepharose.
Protein analysis is conducted using standard techniques such as SDS-PAGE acrylamide [U. K. Laemmli, Nature 227:680 (1970)] stained with silver [R. R. oakley, et al. Anal. Biochem.
105:361 (1980)] and by immunoblot [H. Towbin, et al. Proc.
Natl. Acad. Sci USA 76:4350 (1979)]
The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these. descrip-tions. Those modifications and variations are believed to be encompassed within the claims appended hereto.
SUBSTITUTE SI-tEET
.,.
Y

(1) GENERAL-INFORMATION:
(i) APPLICANT: Wozney, John M.
Celeste, Anthony (ii) TITLE OF INVENTION: BMP-9 COMPOSITIONS
(iii) NUMBER
OF
SEQUENCES:

(iv) CORRESPONDENCE
ADDRESS:

(A) ADDRESSEE: Genetics Institute, Inc.

(B) STREET: Legal Affairs - 87 CambridgePark Drive (C) CITY: Cambridge (D) STATE: MA

(E) COUNTRY: US

(F) ZIP: 02140 , _ (v) COMPUTER
READABLE~FORM:

(A) MEDIUM TYPE:-Floppy disk (B) COMPUTER: . IBt~'' PC compatible . .

(C) OPERATING SYSTEM:~PC-DOS/MS-DOS's (~D) SOFTWARE; PatentIn Release,~l.0, Version #1.25 (vi) CURRENT..APPLICATION.DATA:..

(A) APPLICATION NUMBER: US

(B) FILING. DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT
INFORMATION:

(A) NAME: Kapinos, Ellen J. .

(B) REGISTRATION NUMBER: 32,245 (C) REFERENCE/DOCKET NUMBER: GI 5186A .

(ix) TELE COMMUNICATION INFORMATION:

(A) TELEPHONE: (617) 876-1170 (B) TELEFAX: (619) 876-5851 (2) INFORMATION FOR SEQ ID NO: l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2447 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOIAGY: linear (ii) MOLECULE TYPE: cDNA to mRNA
' (iii,) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Mus musculus (B) STRAIN: C57B46xCBA
(F) TISSUE TYPE: liver * Trade-mark :,.., WO 93/OO~t32 32 f'CI'/US92/053~.- r (vii) TMMEDIATE SOURCE:
(A) LTBRARY: Mouse liver CDNA
(B) CLONE: ML14A
(viii) POSITION IN GENOME:
(C) UNITS: by (ix) FEATURE;
(A) NAME/KEY: mat_peptide (B) IACATION: 1564..1893 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 610..1896 (ix) FEATURE:
(A) NAME/KEY: mRNA
(B) LOCATION: 1..2447 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
CATTAATAAATATTAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGG
AAGGAAGTGG

CCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTT ~

CCT TTC CGG
GTG GCC
CTG CTC

Met Ser Gly Ala Pro Leu Pro Phe Arg Val Ala Leu Leu Phe LeuLeu ValCys Val ThrGln GlnLys Pro LeuGlnAsn Trp Glu Gln AlaSer ProGly Glu AsnAla HisSer Ser LeuGlyLeu Ser Gly Ala GlyGlu GluGly Val PheAsp LeuGln Met PheLeuGlu Asn Met Lys Val,AspPheLeu Arg SerLeu AsnLeu Ser GlyIlePro Ser Gln SUBSTITUTE SHEET

CA 02108770 2003-03-14 :.,..,.... .~_.."...._.,...... .
........._.....".~.,.~_..i.."~..,.~....,~~~..~....aw,~..
,.~
.
.
i..

~

GAC AAA ACC AGA GCG GAG CCA CCC CAG TAC ATG ATC GAC TTG TAC AAC ggg Asp Lys Thr Arg Ala Glu.Pro Prb Gln~Tyr'Met Ile Asp Leu Tyr Asn AGA TAC~ACA ACG GAC AAA TOG TCT ACG CCT GCC TCC AAC ATC GTG CGG~ 936 ~rg~ Tyr Thr Thr Asp Lys her 8er Thr 'ProAla Ser Asn Ile ~a1 Arg ~ , ' AGC TTC AGC GTG GAA GAT GCT ATA TCG ACA GCT GCC ACG GAG GAC TTC gg4 ser Phe ser Val Giu Asp~Ala Ile Ser Thr Ala Ala Thr Glu Asp Phe ~

CCC TTT''CAG AAG CAC ATC CTG ATC TTC AAC ATC TCC ATC CCG AGG CAC 1032 Pro Phe Gln Lys His Ile.heu Ile Phe Asn Ile 8er Ile Pro Arg His -190 -185 _ -180 ~

~; . , _ 'GAG CAG ATC ACC AGG GCT GAG CTC CGA CTC TAT GTC TCG TGC CAA AAT 1080 Glu Gln Ile Thr Arg ~AlaGlu Leu Arg heu Tyr Val Sex Cys Gln Asn -175 ;' ~-170 -165 ' Asp Val Asp Ser Thr His Gly Leu Glu Gly Ber Met Val Val Tyr Asp -160 .-155 -150 CTG GAC CAG GCC ACG

Val Glu Asp Ser Glu Thr Trp'Asp Gly Thr Z,ysThr Leu Gln Ala Thr ~

-145 -14.0 -135 . -130 TTC GTA TCC CAG GAC ATT CGG GGA TGG GAG ACT TTA GAS 1224.
TTG GAC GAA

Phe Leu Val Ser G1n Asp Ile Arg Gly Trp Glu Thr heu Glu Asp Glu -125 ' -120 -115 GTA TCG AGT GCC GTG AAG CGG TGG GTC GCA GAC TCC ACA ACA AAC 127.2 AGG

Val Ser Ser Ala Val Lys Arg Trp Va1 Ala Asp 8er Thr Thr Asn Arg -110 -105 ~ -100 .

AGC

Lys Asn Lys Leu Glu Val Thr Val Gln.SerHis Arg Glu Ser Cys Asp ACA CTG GAC ATC AGT GTC CCT CCA GGT AAA AAC CTG CCC TTC TTT~ 13 68 TCC

Thr Leu Asp Ile Ser Val Pro Pro Gly Lys Asn Leu Pro Phe Phe Ser ~

GTT GTC TTC TCC AAT GAC CG~ AGC AAT ACC AAG GAG ACC AGA CTG 1416 GGG

Val Val Phe Ser Asn Asp Arg ser Asn fihr Glu Thr Arg Leu Gly Lys GAG CTG AAG GAG ATG ATC GGC CAT ~GAG GAG ACC ATG CTT GTG AAG 1464 CAG

Glu Leu Lys Glu Met Ile Gly His Glu Glu Thr Met Leu Val Lys Gln AAA GGT GAG GAG
AAT
GCT
TAC
CAG
GTG

Thr Ala Ala Glu Ser Gln G1u Lys Gly Glu Glu Asn Ala Tyr Gln Val -3p -25 -20 GAT CCA GCT
GGA AGA
TAC AGG
ACA AFG
GCT
GTG

Gly Leu Gly Leu Leu Asp Pro Ala Gly Arg Tyr Arg Thr Lys Ala Val . ,._. ,.-~ 02108770'2003-03-14~~""~~~~".........,.........~_.. .... _ .._...
_ . ... . .. . . . .

-15 -10 ~ -5 Arg Ser Thr Gly Ala 8er 8er 8is Cys GlnLys Thr Ser heu Arg Val 1 5 10 . ~ 15 .AACTTT GAG GAC ATC GGC TGG GAC AGC TGGATC ATT GCA CCC AAG GAA 1656 ~.AsnP#~eGiu Asp Ile Gly Trp Asp S~r TrpIle Ile Ala Pro Lys=Giu-' 20 25 . 30 Tyr Asp Al~ Tyr Glu Cys ~hys~GlyGly CyePhe Phe Prb ~eu Ala Asp 35 ' 40 ' 45 ACC

,AspVal Thr Pro Thr Lys 8is Ala Ile Val Gla.Thrheu qal His Leu GAG TTC CCC ACA AAG GTG GGC -1~A TGC TGC CCC ACC AAA CTG 1800 GCC GTT

Glu Phe Pro Thr I~ys.Val G1y Lps ~AlaCys Cys Pro Thr Lys,'Leu Val 65 ~ 70 ~ 95 AGTCCC ATC TCC ATC CTCTAC AAG.~GAT-GAC ATG GGG CCA ACC CTC 1848 GTG

SerPro Ile Ser Ile heuTyr Lys,Asp Asp Met Gly Pro Thr Leu .
Val 80 , ~ 85 90 95 AAGTAC CAC TAT GAG GGGATG AGT GTG GCT'GAG TGT TGT AGG TAGTCCCTGC 1903 GGG.

LysTyr His Tyr Glu GlyMet.'Ser Ala Glu Cys Cys Arg Val Gly . . . 105 ~ 110 10.0 AAGAGGTTCT

. - _ ., GGCATCTAAGAGAACTCTGC TTCG~TCATCATCCCCACCGA CTTGTTCTTCCTTGGGAGTG 2263 AAGGACTTCAAAACATCTGG ACAACTCTCATTGACTGATG ~CTCCAACATA-ATTTTTAAAA 2443 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: A28 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein SUBSTITUTE SHEET

. . _ _ . _ _ . _ . .. . . ~ 02108770~2003 ~03-.14 . . _ .... _~. ,_...... . .
. . ... ... . .. _ .. ..... ., _ .
WO 93/00432 ~ 35 - PGT/US92/05374 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Ser Pro G1y Ala Phe Arg Val Ala Leu Leu Pro Leu Phe Leu Leu -318 -315 . -310 ~ ~~ : -3 05 Val Cys Val~Thr Gln Gln Lys Pro Leu Gln Asn Trp Glu Gln Ala Ser -300 =295 ~ -290 Pro Gly Glu Asn.Ala His~Ser Ser~Leu-Gly Leu,Ber Gly Ala Gly Glu -2$5 -280 -275 Glu Gly Val Phe.Asp Leu Gln Met Phe Leu,Glu.Asn Met Lys Val Asp -270 _ -265 .: -260 - -255 Phe Leu Arg Ser Leu Asn Leu Ser Glyl'Ile Pro Ser Gln Asp Lys Thr -250 - _-245 . -240 Arg Ala Glu Pro Pro Gln Tyr Met Ile Asp Leu Tyr Asn Arg Tyr Thr -.,~. ~ . '~'~_ . .. ... . : , .. . _ - ,~.... :, . ~ . , Thr Asp ,:Lys .:Sex:; $er>:..Thr. Pro ~Alav.,~Ser:~Asnalle~, Val Arg..Ber the Ser .y -220 ~~ -215 . -210 Val Glu Asp. .;Ala;~Ile vSer. -.Thr~:;Ala.; aAla.-: Thrr~Glu Asp: _Phe Pro Phe Gln .
-205 ..~ ~° ~., . .. .. . _. -200 , .. . . , .-195x_,-~ ,.
Lys His Ile Leu Ile Phe Asn Ile Ser Ile Pro Arg His Glu Gln Ile .
-190 ~ -185 .., . -1.80 -175 Thr Arg Ala~Glu~Leu Arg Leu Tyr Val~Ser Cys Gla Asn Asp Val I~sp Ser Thr His Gly Leu Glu Gly Ser Met Val Val Tyr Asp Val Leu Glu Asp Ser Glw.Thr Trp Asp=Gly,Ala.Thr Gly Thr Lys Thr Phe Leu Val Ser Gln Asp Ile~Arg Asp Glu Gly Trp Glu Thr Leu Glu Val Ser Ser Ala Val Lys Arg Trp.Val Arg Ala Asp Ser Thr Thr Asn Lys Asn Lys Leu Glu Val Thr Val Gln Ser His Arg Glu Ser Cys Asp Thr Leu Asp Ile Ser Val Pro Pro Gly Ser Lys Asn Leu Pro,Phe Phe Val Val Phe Ser Asn Asp Arg Ser Asn Gly Thr Lys Glu Thr Arg Leu Glu Leu Lys Glu Met Ile Gly His Glu Gln Glu Thr Met Leu Val Lys Thr Ala Lys Asn Ala Tyr Gln Val Ala Gly Glu Ser Gln Glu Glu Glu Gly Leu Asp Gly Tyr Thr Ala Val Gly Pro Leu Leu Ala Arg Arg Lys Arg Ser Thr SUBSTITUTE SHEET

..._.,. ..... .,._.._..._..._..._~___..-.~---..-- ......_...,~.---.....,~
02108770 2003-03-14 .,,.~~~~
. . . . . . ., ., .... .....w..~.~. W, ..w..:. .,.z..,...._....: _... ..
36 pC'1'/US92/05374 Giy Ala ser ser His Cys Gln Lys Thr ser Leu Arg Val Asn Phe Glu .

Asp Ile Gly Trp Asp Ser Trp Ile Ile Ala Pro I~ys Glu Tyr Asp Ala 20 25 30 ~ -..Tyr Giu Cys Lys Gly Gly Cys ~Phe Phe Pro Leu ~Ala Asp Asp Vai Thr . 35 ' ~ 40 45. 50 ;' .
Pro Thr Lys His Ala Ile~Vai Gia Thr Leu Val His ?~eu..Glu Phe Pro 4~ , Thr Lys Val Gly Lys Ala Cys Cys Val Pro Thr Lys Leu Ser Pro Ile_ _ 70 95 .~ 80 Ser Ile Leu Tyr. Lys Asp Asp Met Gly Val Pro Thr Leu Lys Tyr=His ''''' . 85 90 95 Tyr Glu Gly Met Ser Val.Ala Glu Cys Gly Cys Arg 100 ~ '' 105 110 (2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1954 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double. ..
(D) TOPOLOGY: linear (ii) MOLECULE TYPE:.cDNA to_mRNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE:-NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (G) CELL TYPE: Osteosarcoma Cell Line (H) CELL LINE: U-20S
(vii) IMMEDIATE SOURCE:
(A) LIBRARY: U20S cDNA in Lambda gtl0 (B) CLONE: Lambda U20S-3 (viii) POSITION IN GENOME:
(C) UNITS: by (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 403..1629 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1279..1626 (ix) FEATURE:
(A) NAME/KEY: mRNA

WO 93/00432 3 ~ PGT/US92/05374 (B) LOCATION: 9..1934 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
CTCTAGAGGG CAGAGGAGGA GGGAGGGAGG GAAGGAGCGC GGAGCCCGGC~CCGGAAGCTA~ 60 AGTATCTAGC TTGTCTCCCC GATGGGATTC CCGTCCAAGC TATCTCGAGC CTGCAGCGCC ~ 180 CTGGCGAGCC CGCTACTGCA GGGACCTATG GAGCCATTCC GTAGTGCCAT.CCCGAGCAAC 300 . . . .., _ . . . Y S -; . z : =;: = ~- ,.

GCACTGCTGC AGCTTCCCTG AGCCTTTCCA vGCAAGTTTGT TCAAGATTGG CTGTCAAGAA 360 TCATGGACTG TTATTATATG CCTTGTTTTC 'TGTCAAGACA CC ATG ATT CCT-GGT ~ 414 Met Ile Pro Gly . .f:_. : .\ . . : .
v... .~, ,... ~.-.~~. :._y :~.w... -AAC CGA ATG CTG ATG GTC GTT TTA TTA TGC CAA GTC CTG.CTA~GGA~'GGC 462 Asn Arg Met Leu Met Val Val Leu Leu Cys Gln Val Leu Leu Gly Gly ' .-=2..7.,x. :
.~~s _.
.
.
:
' ~

~. .: ~ ;
s .
f,.
..
~:.~
vv, .:.
~ -~:

Ala Ser His Ala Ser Leu Ile Pro Glu Thr wGly2ys = Lys ~r.Lys= rVal 'Ala -270 ~ . -265 , . . -.260 GAG ATT CAG GGC CAC GCG GGA GGA CGC'~CGC..TCA.:GGG; CAG~AGCCAT GAG 558 .... Glu ~ Ile Gln Gly His Ala Arg Arg Ser .Gly Glri- Ser -His Glu Gly Gly -255 -250 ~ -245 CTC CTG CGG GAC TTC GAG GCG ACA CTT CTG CAG ATG TTT GGG CTG.CGC 606' Leu Leu Arg Asp Phe Glu Ala Thr Leu Leu Gln Met Phe Gly Leu Arg Arg Arg Pro Gln Pro Ser Lys Ser Ala Val Ile Pro Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gln Ser Gly Glu Glu Glu Glu Glu Gln Ile His -205 ~200 -195 AGC ACT GGT CTT GAG TAT CCT GAG CGC CCG~GCC AGC CGG GCC AAC ACC 750 Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala Ser Arg Ala Asn Thr ' GTG AGG AGC TTC CAC CAC GAA GAA CAT CTG'GAG AAC ATC CCA GGG ACC 798 Val Arg Ser Phe His His Glu Glu His Leu Glu Asn Ile Pro Gly Thr Ser Glu Asn Ser Ala Phe Arg~ Phe Leu Phe Asn Leu Ser Ser Ile Pro Glu Asn Glu Val Ile Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gln SUBSTITUTE SHEET

t WO 93/00432 PC1'/US92/05374:'~'~'.

GTG GAC.CAG GGC CCTGAT TGG GAAAGG GGCTTC CACCGT ATA AACATT

Val Asp GlnGly ProAsp Trp GluArg GlyPhe HisArg Ile AsnIle TAT GAG GTTATG AAGCCC CC~.GCAGAA GTGGTG CCTGGG CAC CTCATC ggp Tyr Glu ValMet LysPro Pro AlaGlu ValVa1 ProG1y His LeuIle ' Thr A95 LeuLeu AspThr Arg LeuVal HisHis AsnVal Thr ArgTrp Glu Thr PheAsp ValSer Pro AlaVal LeuArg TrpThr Arg G1uLys Gln Pro AsnTyr GlyLeu Ala IleGlu ValThr HisLeu His GlnThr -60 -55 . -50 Arg Thr HisGln GlyGln His ValArg IleSer ArgSer Leu ProGln Gly Ser GlyAsn TrpAla Gln LeuArg ProLeu LeuVal Thr PheGly His Asp GlyArg GlyHis Ala LeuThr ArgArg ArgArg Ala LysArg Ser ProLys HisHi5 SerGln ArgAla Ar Lys Lys AsnLys AsnCys 1 o 15 CGG CGCCAC TCGCTC TATGTG GACTTC AGCGAT GTG GGCTGG AAT~GAC 1374 Arg ArgHis SerLeu TyrVal AspPhe SerAsp Val GlyTrp AsnAsp Trp IleVal AlaPro ProGly TyrGln AlaPhe Tyr CysHis GlyAsp 35 40 , 45 .

Cys ProPhe PraLeu AlaAsp HisLeu AsnSer Thr AsnHis AlaIle Val GlnThr LeuVal AsnSer ValAsn SerSer Ile ProLys AlaCys Cys ValPro ThrGlu LeuSer AlaIle SerMet Leu TyrLeu AspGlu Tyr AspLys ValVal LeuLys AsnTyr GlnGlu Met ValVal GluGlv SUBSTITUTE SHEET

CA 02108770y2003-03-14 TGC GGATAGACAG ATATACACAC

Cys Gly Arg _ Cys 115 , CACACACACA CACCACATAC ACCACACACA .CACGTTCCCATCCACTCACC CACACACTAC 1726 ATCCCTAAAC ATTCACCTTG ACCTTATTTA TGACTTTACG TGCA.AATGTTTTGACCATAT 1846 AGTCATTATT TTA,~~~AAAAA AA.AAAAAACTCTAGAGTCGA CGGAATTC . 1954 ( 2 ) INFORMATION FOR SEQ II3 NO : 4 ( i ) SEQUENCE CHARACTERISTICS : ~- _ , (A) LENGTH: 408 amino acids .
(B) TYPE: amino acid .. (D) TOPOLOGY:..linear , ~ _ . ..
(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION:,~SEQ ID NO:4:
Mat Ile Pro Gly Asn Arg Me_t Leu Met Val Va1 Leu Leu Cys.Gln Val -292 -290 ~ -285 -280 Leu Leu Gly Gly Ala Ser His Ala Ser Leu.Ile Pro Glu Thr Gly Lys Lys Lys Val Ala Glu Ile Gln Gly His Ala Gly Gly Arg Arg Ser~Gly -260 -255 . -250 -245 Gln Ser His Glu Leu Leu Arg Asp Phe Glu Als,Thr Leu Leu Gln Met Phe Gly Leu Arg Arg Arg Pro Gln Pro Ser Lys Ser Ala Val Ile Pro Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gln Ser Gly Glu Glu Glu Glu Glu Gln Ile His Ser Thr Gly Leu Glu Tyr Pro Glu Arg Pro Ala Ser ~ Arg Ala Asn Thr Val Arg Ser Phe His His Glu G1u His Leu Glu Asn -180 -175 -170 ' -165 Ile Pro Gly Thr Ser Glu Asn Ser Ala Phe Arg Phe Leu Phe Asn Leu -160 -155 _ -150 Ser Ser Ile Pro Glu Asn Glu Val Ile Ser Ser Ala Glu Leu Arg Leu Phe Arg Glu Gln Val Asp Gln Gly Pro Asp Trp Glu Arg Gly Phe His SUBSTITUTE SHEET

.. .._._...._.._....:..,~......;,..:~_=.~~ --~-~ _ . ._____ __ ..... __ ...._.
.. _, ..... .._ , .... .., _. 02108770,1,2003 03~ 14~~'y,..., ..,........,.. .
, . _ .. .. . .. _. .. . .._ WO 93/00432 PCT/US92/OS3?4 Arg Ile Asn Ile Tyr Glu Val Met Lys Pro Pro Ale Glu Val Val Pro -115 ' -110 -105 Gly His Leu Ile Thr Arg ?~euLeu Asp Thr Arg ?~eu Val His Asn . His -100 -95 ..g0 -85 Val Thr Arg Trp Glu Thr Phe Asp Val~wBer Ala Val~.LeuArg Trp Pro~

-80 ~ "75 -70 Thr Arg Giu ?~ysG1n Pro Asn Tyr ~Gly3~eu tie Glu Val Thr 8is Ala -65 -60 ~ _ -55 Leu His Gln Thr Arg Thr His c~lnGly Glr1 Val ~lrg ser Arg His Ile ...f Ser Leu Pro Gln Gly Ser Gly Asn Trp Ala Gin :heu; Arg Pro Leu Leu ' . -35 ~30 ~-25 -Val Thr Phe Gly his Asp Gly Arg,Gly .His Ala~ T~eu ~'hr-Arg Arg Arg -20 15 ' ~ ~-10 ' -5 Arg Ala Lys Arg 8er Pro Lys His His Ser Gln~.Arg~Ala Arg Lys Lys . , 1 5 .. . . . 10 Asn Lys Asn Cys.Arg Arg His ser Leu Tyr Val.Asp Phe Ser Asp Val 15 20 '25 .

Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr Gln Ala Phe Tyr ._. Cys His Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu,Asn ser Thr .45 50 55 ' 60 Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Va~..Asn Ser Ser Ile 65 ~?0 ' . ?5 Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Set Ala Ile Ser Met Leu 80 85 ' 90 _ Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gln Glu~Met g5 100 105 val Val.Glu Gly Cys Gly Cys Arg (2) INFORMATION FOR SEQ ID N0:5: ' (i) SEQUENCE CHARACTERISTICS:
(A) 'LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STR.ANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:

WO 93/00432 ~ 41 PGT/US92/05374 CATGGGCAGC TCGAG
(2) INFORMATION FOR-SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTI-CS:
(A) LENGTH: 34 base pairs .
~(B) TYPE:nucleic acid (C) STRANDEnNESS: double (D). TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA
(xi) SEQUENCE DESCRIPTION::SEQ.ID N0:6:
CTGCAGGCGA GCCTGAATTC CTCGAGCCAT CATG ~ - 34 (2) INFORMATION FOR SEQ~ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) ~LENGT8:~68.b~se.pairs (B) TYPE: nucleic acid . ., .
(C). S~DEDNESS': double .
(D) TOPOLOGY: lit:ear ( ii ) MOLECULE TYPE: ~cDNA ~ to~~ mRNA
-- (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
CGAGGTTAAA AAACGTCTAG'GCCCCCCGAA CCACGGGGAC GTGGTTTTCC TTTGAA.AAAC 60 AC~ATTGC 68 (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A). LENGTH: 470 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(v) FRAGMENT TYPE: C-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo Sapiens (H) CELL LINE: W138 (genomic DNA) (vii) IMMEDIATE SOURCE:
(A) LIBRARY: human genomic library (B) CLONE: lambda 111-1 (viii) POSITION IN GENOMu:
(C) UNITS: by SUBSTITUTE SHEET

_ . _ _ . __._._~._.~_ _ _..._._.._..~,._~~,.,.~~ ~ 02108770 2003-03-14 ...... ... .:.._-.,: . ,...,.
,.._..._......:__:.._....,,...__:.....,...._...:_.-..,:".,:,..:z-_~.....~~.:""__.._._._.._,...,....
WO 93/00432 . . PCT/US92/05374 (ix) FEATURE:
(A) NAME/EEY: exon (B) LOCATION: 1..470 (ix) FEATORE: ..

(A) NAME/~Y CDS ' s , (B) LOCATION: 1..456 ., ix) FEATZJRE s ' . ..

(A) NAMFs/I~:Y: mat~epti8e (B) LOCATIONS 124"..453 (ix) FEATORE:

(A ) NAME/I~Y:mRNA .

r (B ) LOCATION:1..470 . .

(xi) 6EQUENCE DESCRIPTION: S8Q ID N0:8: , TGT CCA AGG ACG GCT

* Thr Arg Glu Cys~Ber Arg Ser Cys Pro Gln.Arg Pro Arg Thr Ala -41 -40 -35 -30 ' CAG GTG AGA GCA.GTC ACG AGG AGG GTG GCT GCG 96 ACA CGG ATG GCG CAC

Gln Val Arg Aia Val Thr Arg Arg Val Ala Ala Thr Arg Met Ala His AGG AGC GCC GGG GCT

Gly Ser Thr Leu Ala Arg Arg Lys Ser Ala G1y Gly Ser 8is Arg Ala ~. . ~ 1 5 TGT CAA AAG ACC TCC CTG CGG GTA TTC GAG GAC GGC TGG GAG'" 192 AAC ATC

Cys Gln Lys Thr Ser Ireu Arg Val Phe Glu Asp Gly Trp Asp Asri Ile TAT GAG
~

Ser Trp Ile IlE Ala Pro Lys Glu Ala Tyr Glti Cys Lys Gly Tyr Glu 25 30 ' ~
~ 35 GAT ACG

Gly Cys Phe Phe Pro Leu Ala Asp Val Thr Pro Lys His Ala Asp Thr 40 .45 50 55 AAG AAG

Ile Val Gln Thr Leu Val His Leu Phe Pro Thr Val Gly Lys Lys Lys AGC GTC

Ala Cys Cys Val Pro Thr Lys Leu ProIle Ser~ValLeu Tyr Lys Ser ' ?5 ~ 8 0 ' 85 AAG GAG ATG
AGC

Asp Asp Met Gly Val Pro Thr Leu Tyr His Tyr Lys Glu Gly Met Ser g0 95 100 CTGCGGG

Val Ala Glu Cys Gly Cys Arg _. .. .. .._ ...02108770_2003-03-14 (2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 151 amino acids (B) TYPE: amino acid (D) TOPOIAGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
* Thr Arg Glu Cys Ser Arg Ser Cys Pro Arg Thr Ala Pro Gln Arg Gln Val Arg Ala Val Thr Arg Arg Thr Arg Met Ala His Val Ala Ala Gly Ser Thr Leu Ala Arg Arg Lys Arg Ser Ala Gly Ala Gly Ser His Cys Gln Lys Thr Ser.Leu ArgrValrAsn Phe Glu Asp Ile Gly firp Asp ~ 15 ~ 2 0 .. . .
Ser Trp Ile' Ile Ala Pro'Y Lys;~Glu .:Tyr Glu Ala Tyr Glu : Cys Lys Gly 25 .. 30.. . 35 Gly Cys Phe Phe Pro Leu Ala Asp Asp Val Thr Pro Thr Lys His Ala 40 . 45 50 55 Ile Val Gln Thr Leu Val His Leu Lys Phe Pro Thr Lys Val Gly Lys 60 65 _70 Ala Cys Cys Val-Pro Thr Lys Leu Ser Pro Ile Ser Val Leu Tyr Lys 75 80 85 ' Asp Asp Met Gly Val Pro Thr Leu Lys Tyr His_ Tyr Glu Gly Met Ser Val Ala Glu Cys Gly Cys Arg SUBSTITUTE SHEET

Claims (19)

CLAIMS:

1. A BMP-9 polypeptide with tissue inducing activity comprising the amino acid sequence from amino acid #8 - 110 as set forth in FIG. 3 (SEQ ID NO: 9).

2. A BMP-9 polypeptide with tissue inducing activity comprising the amino acid sequence from amino acid #1 - 110 as set forth in FIG. 3 (SEQ ID NO: 9).

3. A BMP-9 polypeptide of claim 1 wherein said polypeptide is a dimer wherein each subunit comprises at least the amino acid sequence from amino acid #8 - 110 of FIG. 3 (SEQ ID NO: 9).

4. A BMP-9 polypeptide of claim 2 wherein said polypeptide is a dimer wherein each subunit comprises at least the amino acid sequence from amino acid #1-110 of FIG. 3. (SEQ ID NO: 9).

S. A purified BMP-9 protein with tissue inducing activity produced by the steps of (a) culturing a cell transformed with a cDNA comprising the nucleotide sequence from nucleotide #124 to #453 as shown in FIG. 3 (SEQ ID NO: 8); and (b) recovering and purifying from said culture medium a protein comprising the amino acid sequence from amino acid #1 to amino acid #110 as shown in FIG. 3 (SEQ ID NO: 9).

6. A purified BMP-9 protein with tissue inducing activity produced by the steps of (a) culturing a cell transformed with a cDNA comprising the nucleotide sequence from nucleotide #124 to #453 as shown in FIG. 3 (SEQ ID NO: 8); and (b) recovering from said culture medium a protein comprising an amino acid sequence from amino acid #8 to amino acid #110 as shown in Figure 3 (SEQ ID NO: 9).

7. The BMP-9 polypeptide of claim 1 or 2 characterized by the ability to induce the formation of cartilage and/or bone.

8. A DNA sequence encoding a BMP-9 protein, wherein said DNA comprises (a) nucleotide 124 to 453 (SEQ ID NO: 8); or (b) sequences which hybridize to the complement of (a) under stringent hybridization conditions, wherein said sequences encode proteins that exhibit the ability to form cartilage and/or bone.

9. A DNA sequence encoding a BMP-9 protein, wherein said DNA comprises (a) nucleotide 145 to 453 (SEQ ID NO: 8); or (b) sequences which hybridize to the complement of (a) under stringent hybridization conditions, wherein said sequences encode proteins that exhibit the ability to form cartilage and/or bone.

10. A host cell transformed with the DNA sequence of claim 8 or 9.

11. A method for producing a purified BMP-9 protein said method comprising the steps of (a) culturing a cell transformed with a cDNA comprising the nucleotide sequence of claim 8 or 9, and (b) recovering and-purifying said BMP-9 protein from the culture medium.

12. A pharmaceutical composition comprising an effective amount of the BMP-9 polypeptide of claim 1 or 2 in admixture with a pharmaceutically acceptable vehicle.

13. A composition of claim 12 further comprising a matrix for supporting said composition and providing a surface for bone and/or cartilage growth.

14. The composition of claim 13 wherein said matrix comprises a material selected from the group consisting of hydroxyapatite, collagen, polylactic acid and tricalcium phosphate.

15. Use of an effective amount of the composition of claim 12, 13 or 14 for inducing bone and/or cartilage formation in a patient in need of same.

16. A pharmaceutical composition for wound healing and tissue repair said composition comprising an effective amount of the BMP-9 polypeptide of claim 1 or 2 in a pharmaceutically acceptable vehicle.

17. Use of an effective amount of the composition of claim 16 for treating wounds and/or tissue repair in a patient in need of same.

18. A use of an effective amount of the composition of claims 12, 13 or 14 for the preparation of a medicament for inducing bone and/or cartilage formation in a patient in need of same.

19. A use of an effective amount of the composition of claim 16 for the production of a medicament for treating wounds and or/ tissue repair in a patient in need of same.