CA2046904C - Cd4 specific recombinant antibody - Google Patents
Cd4 specific recombinant antibody Download PDFInfo
- Publication number
- CA2046904C CA2046904C CA002046904A CA2046904A CA2046904C CA 2046904 C CA2046904 C CA 2046904C CA 002046904 A CA002046904 A CA 002046904A CA 2046904 A CA2046904 A CA 2046904A CA 2046904 C CA2046904 C CA 2046904C
- Authority
- CA
- Canada
- Prior art keywords
- antibody
- cdr
- residues
- okt4a
- grafted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/241—Tumor Necrosis Factors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2812—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
- C07K16/464—Igs containing CDR-residues from one specie grafted between FR-residues from another
- C07K16/465—Igs containing CDR-residues from one specie grafted between FR-residues from another with additional modified FR-residues
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
Abstract
There are disclosed: a CDR-grafted antibody having at least one chain wherein the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (donor), the CDR-grafted antib-ody being capable of binding to the CD4 antigen; processes for its production;
nucleotide sequences for use in its production;
compositions containing it; and its use in therapy.
nucleotide sequences for use in its production;
compositions containing it; and its use in therapy.
Description
~'O 91 /09966 PCT/GB90/0201 E~. ;-; - n --.
,. _ .. . ,.s CD-t SPEC1F1C RECOMBINANT ANTIBODY
The present invention relates to CDR-grafted antibody molecules, to processes for their production using recombinant DNA technology and to their therapeutic uses.
In the present application, various prior art references are cited. These are referred to by a number given in square brackets []. The references are listed in l0 numerical order at the end of the description.
In the present application, "Ig" is used to describe natural immunoglobulins. Natural immunoglobulins have been known for many years and comprise a generally Y-shaped molecule having an antigen-binding site towards the end of each upper arm. The remainder of the structure, and particularly the stem of the Y, mediates the effector functions associated with Igs. Various fragments of Igs, such as the Fab, (Fab')2, Fv and Fc fragments, which can be derived by enzymatic cleavage, are also known.
Natural Igs comprise two heavy chains and two light chains, the N-terminal ends of each pair of heavy and light chains being associated and forming the antigen binding sites. The C-terminal ends of the heavy chains associate to form the Fc portion.
The residue designations for Ig light and heavy chains g~iv'en in the present description and claims are in accordance with the numbering scheme developed by Kabat [1] and [2]. Thus, the residue designations do not always correspond directly with the linear numbering of the amino acid residues. The actual linear amino acid sequence may contains fewer or additional amino acid residues than in the strict Kabat numbering, thus showing that there have been insertions or deletions. These insertions or SUBS'TiTUTE SHEET
6V0 91/09966 PCT/GB90/0201~
.y~ .,. -.3 . ' .. .-deletions may be present anywhere within the chains. The correct numbering of residues may be determined for a given Ig by alignment at regions of homology of the sequence of the Ig with a "standard" ICabat numbered sequence.
It was determined from a study of the amino acid sequences of a large number of Igs that the variable domains, which are located at the N-terminal ends of the chains, of both the heavy and the light chains contained three regions in which the amino acid sequence was hypervariable. These hypervariable regions are flanked on-each side by regions which varied substantially less in sequence [1] and [2].
It was conjectured that the hypervariable regions are involved in antigen binding.
More recently, structural studies using X-ray crystallography and molecular modelling have defined three regions in the variable domains of each of the heavy and light chains which appear to be involved in antigen binding [47].. These three regions are generally referred to as the complementarity determining regions (CDRs). The CDRs are brought together by the remaining regions of the variable domains to form at least part of the antigen binding site. These remaining regions are generally referred to as the framework regions.
It will be appreciated that some workers in the art, and in particular Kabat [1] and [2], have referred to the . ~hypervariable regions as being CDRs. For the sake of clarity, in this specification the term hypervariable , region is used only to describe antigen binding regions determined by sequence analysis and the term CDR is~used , to describe anitgen binding regions determined by structural analysis.
~SUBSTITU'TE SH~E~' , ~~'O 91/09966 PCT/GB90/0201~
,. _ .. . ,.s CD-t SPEC1F1C RECOMBINANT ANTIBODY
The present invention relates to CDR-grafted antibody molecules, to processes for their production using recombinant DNA technology and to their therapeutic uses.
In the present application, various prior art references are cited. These are referred to by a number given in square brackets []. The references are listed in l0 numerical order at the end of the description.
In the present application, "Ig" is used to describe natural immunoglobulins. Natural immunoglobulins have been known for many years and comprise a generally Y-shaped molecule having an antigen-binding site towards the end of each upper arm. The remainder of the structure, and particularly the stem of the Y, mediates the effector functions associated with Igs. Various fragments of Igs, such as the Fab, (Fab')2, Fv and Fc fragments, which can be derived by enzymatic cleavage, are also known.
Natural Igs comprise two heavy chains and two light chains, the N-terminal ends of each pair of heavy and light chains being associated and forming the antigen binding sites. The C-terminal ends of the heavy chains associate to form the Fc portion.
The residue designations for Ig light and heavy chains g~iv'en in the present description and claims are in accordance with the numbering scheme developed by Kabat [1] and [2]. Thus, the residue designations do not always correspond directly with the linear numbering of the amino acid residues. The actual linear amino acid sequence may contains fewer or additional amino acid residues than in the strict Kabat numbering, thus showing that there have been insertions or deletions. These insertions or SUBS'TiTUTE SHEET
6V0 91/09966 PCT/GB90/0201~
.y~ .,. -.3 . ' .. .-deletions may be present anywhere within the chains. The correct numbering of residues may be determined for a given Ig by alignment at regions of homology of the sequence of the Ig with a "standard" ICabat numbered sequence.
It was determined from a study of the amino acid sequences of a large number of Igs that the variable domains, which are located at the N-terminal ends of the chains, of both the heavy and the light chains contained three regions in which the amino acid sequence was hypervariable. These hypervariable regions are flanked on-each side by regions which varied substantially less in sequence [1] and [2].
It was conjectured that the hypervariable regions are involved in antigen binding.
More recently, structural studies using X-ray crystallography and molecular modelling have defined three regions in the variable domains of each of the heavy and light chains which appear to be involved in antigen binding [47].. These three regions are generally referred to as the complementarity determining regions (CDRs). The CDRs are brought together by the remaining regions of the variable domains to form at least part of the antigen binding site. These remaining regions are generally referred to as the framework regions.
It will be appreciated that some workers in the art, and in particular Kabat [1] and [2], have referred to the . ~hypervariable regions as being CDRs. For the sake of clarity, in this specification the term hypervariable , region is used only to describe antigen binding regions determined by sequence analysis and the term CDR is~used , to describe anitgen binding regions determined by structural analysis.
~SUBSTITU'TE SH~E~' , ~~'O 91/09966 PCT/GB90/0201~
3 n:~ :~ ~_ E=~ :~~ .. ~; > .:.;
A comparison of the hypervariable regions, as determined by sequence analysis, and the CDRs, as determined by structural studies, shows that there is some, but not complete, correspondence between these regions.
In the present application, the term "antibody" is used to describe Igs or any fragments thereof, light chain or heavy chain monomers or dimers, and single chain antibodies, such as a single chain Fvs in which the heavy and light chain variable domains are joined by a peptide linker, whether natural or produced by recombinant DNA
technology or otherwise, provided that the antibody includes at least one antigen binding site. The remainder of the antibody need not comprise only Ig-derived protein sequences. For instance, a gene may be constructed in which a DNA sequence encoding part of a human Ig chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule. Thus, "antibody" encompasses hybrid antibodies (see below).
The abbreviation "MAb" is used to indicate a monoclonal antibody as produced by a hybridoma or derivative cell line.
The term "recombinant antibody'° is used to describe an antibody produced by a process involving the use of recombinant DNA technology.
The term "chimeric antibody" is used to describe an ~ 'antibody in which the variable domains as a whole are derived _rom an antibody from a first mammalian species 1 and have been fused onto at least one constant domain from an antibody from a different mammalian species.
The term "hybrid antibody" is used to describe a protein comprising at least the antigen binding portion of an Ig attached by peptide linkage to at Least part of another SU~STI'i'UTE SHEET
~'O 91/0996b pCT/GB90/02015 ~~ 'y' ~ ~ ~'~ 4 protein. It will be appreciated that certain skilled workers may also use the word '~chimeric" to describe such constructs, but in the present specification such constructs are referred to as hybrid antibodies and the term chimeric antibodies is used in the sense defined above.
The term "CDR-grafted antibody" is used to describe an antibody having at least one, and preferably two or three, of its CDRs in one or both of the variable domains derived from an antibody from a first species, the remaining Ig-derived parts of the antibody being derived from one or more different antibodies. The variable domains may be made by use of recombinant DNA technology or by peptide synthesis.
"Rxpression vector" includes vectors which are capable of expressing DNA sequences contained therein, i.e. the coding sequences are operably linked to other sequences capable of effecting their expression. A useful, but not always necessary (i.e. insect cells), element of an effective expression vector is a marker encoding sequence, i:e. a sequence encoding a vector sequence which results in a phenotypic property (e. g. neomycin resistance, methionine sulfoximine resistance or tryptophan prototrophy) of the cells containing the protein which permits those cells to be readily identified. In sum, "expression vector" is given a functional definition and zany DNA sequence which is capable of effecting expression 30~ of a specified contained DNA code is included in this term as it is applied to the specified sequence. As at present, such vectors are frequently in the form of plasmids. Thus "plasmid" and "expression vector" are often used interchangeably. However, the invention is intended to include such other forms of expression vectors , which serve equivalent functions and which may, from time ~SUSST~TUTE SHEET
WO 91 /09966 PC'T/GB90/0201 c~.., ,n;,, d ~:.~;:..;~a;;
.. ._ . _.
to time, become known in the art, including retroviruses, in vitro systems [48) and the like.
As stated previously, the DNA sequences will be expressed 5 in host cells after the sequences have been operably linked to (i.e. positioned to ensure the functioning of) an expression control sequence. These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
"Recombinant host cells" refers to cells which have been transformed with vectors constructed using recombinant DNA
techniques. By virtue of this transformation, the host cell is able to produce the desired product in useful quantities, rather than in lesser amounts, or more commonly, in less than detectable amounts, as one would expect to be produced by the untransformed host. The antibody of the present invention may be produced by a recombinant host cell in quantities useful to carry out additional experimentation or in commercial quantities such as about a kilogram or more:
In descriptions of processes for isolation of antibodies from recombinant hosts, the terms '°cell" and "cell culture" are used interchangeably to denote the source of antibody unless it is clearly specified otherwise. In other words, recovery of antibody from the "cells" may mean either from spun down whole cells, or from the cell ~ culture containing both the medium and the suspended cells, or, additionally, as is possible in the case of myeloma cell lines, from ascites culture.
Natural Igs have been used in assay, diagnosis and, to a more limited extent, therapy. However, such uses, especially in therapy, have been hindered by the polyclonal nature of natural Igs. ~A significant step SU~ST~TI.JTS SHEEP
V1'O 91 /09966 PC'T/G B90/OZ01 towards the realization of the potential of Igs as therapeutic agents was the discovery of techniques for the preparation of MAbs of defined specificity. MAbs are generally produced by fusions of rodent spleen cells with rodent myeloma cells, and thus are essentially rodent proteins. However, there are very few reports of the successful production of human MAbs.
A series of MAbs having specificities for antigens on T
lymphocytes and subsets of T lymphocytes is described in EP-A-0 017 381, EP-A-0 018 794, EP-A°0 019 195, EP-A-0 025 722, EP-A-0 030 450, EP-A-0 030 814 and EP-A-0 033 578.
Since most available MAbs are entirely of rodent origin, they are naturally antigenic in humans and thus can give rise to an undesirable immune response, such as one response termed the Human Anti-Mouse Antibody,(HAMA) response. Therefore, the use of rodent MAbs as therapeutic agents in humans is inherently limited by the fact that the human subject may mount an immunological response to the MAb and will either remove it entirely or at least reduce its effectiveness. Thus, in practice, MAbs of rodent origin are not generally recommended for use in patients for more than one or a few treatments, as a HAMA response may develop, rendering the MAb ineffective as well as giving rise to undesirable side reactions.
i Proposals have therefore been made to render non-human 30. . MAbs less antigenic in humans. Such techniques can be generically termed "humanization" techniques. These techniques generally involve the use of recombinant DNA
technology to manipulate DNA sequences encoding the polypeptide chains of the antibody molecule.
In recent years advances in molecular biology based on ~SUBST~TUTE SHEET
~'O 91/09966 PC'1'/GB90/0201~
s~ ;~ - n ~' ,,, ;..
i-:: l.' .. :> .:'~ ;, production of a wide range of heterologous polypeptides by transformation of host cells with heterologous DNA
sequences which code for the production of the desired products.
EP-A-0 088 994 (Schering Corporation) proposes the construction of recombinant DNA vectors comprising a ds DNA sequence which codes for the variable domain of a light or a heavy chain of an Ig specific for a l0 predetermined ligand. The ds DNA sequence is provided with initiation and termination codons at its 5'- and 3'-termini respectively but lacks any nucleotides coding for amino acids superfluous to the variable domain. The ds DNA sequence is used to transform bacterial cells. The application does not contemplate variations in the sequence of the variable domain.
EP-A-0 102 634 (Takeda Chemical Industries Limited) describes the cloning and expression in bacterial host organisms of genes coding for the whole or a part of a human IgE heavy chain polypeptide, but does not contemplate variations in the sequence of the polypeptide.
EP-A-0 125 023 (Genentech Inc.) proposes the use of recombinant DNA techniques in bacterial cells to produce Igs which are analagous to those normally found in vertebrate systems and to take advantage of the gene modification techniques proposed therein to construct chimeric antibodies or other modified forms of antibody.
It is believed that the proposals set out in the above Genentech application did not lead to the expression of any significant quantities of Ig polypeptide chains, nor to the production of Ig activity, nor to the secretion and assembly of the chains into the desired chimeric antibodies.
SUBSTITUTE SHEET
N'O 91/09966 PCT/G B90/0201~
S'' ' ~_. ~;iG
The recent emergence of techniques allowing the stable introduction of Ig gene DNA into mammalian cells [3] to [5) has opened up the possibility of using in vitro mutagenesis and DNA transfection to construct recombinant antibodies possessing novel properties.
However, it is known that the function of an antibody molecule is dependent on its three dimensional structure, which in turn is dependent on its primary amino acid sequence. Thus, changing the amino acid sequence of an antibody may adversely affect its activity. Moreover, a change in the DNA sequence coding for the antibody may affect the ability of the cell containing the DNA sequence to express, secrete or assemble the antibody.
It is therefore not at all clear that it will be possible to produce functional altered antibodies by recombinant DNA techniques. However, colleagues of the present inventors have devised a process whereby hybrid antibodies in which both parts of the protein are functional can be secreted. This process is disclosed in International Patent Application No. PCT/GB85/00392. However, the above PCT application only shows the production of hybrid antibodies in which complete variable domains are coded for by the first part of the DNA sequence. It does not show hybrid antibodies in which the sequence of the variable domain has been altered.
EP-A-0 239 400 describes a process in which the CDRs of a ~mousa MAb have been grafted onto the framework regions of the variable domains of a human Ig by site directed mutagenesis using long oligonucleotides. The inventors allude to the possibility of altering the natural amino acid sequence of the framework regions as well.
The earliest work on altering MAbs by CDR-grafting was carried out on MAbs recognizing syf~thetic antigens, such SUBSTITUTE SHEET
WO 9i/09966 PCT/G890/0201~
c, ;, , " " , . i E::: .~ __ ,~ .. _ ._ as the NP or NIP antigens. However, examples in which a , mouse MAb recognizing lysozyme and a rat MAb recognizing an antigen on human T-cells respectively were humanized by CDR-grafting have been described [6] and [7].
Reference [7] shows that transfer of the CDRs alone (as defined in that paper) was not sufficient to provide satisfactory antigen binding activity in the CDR-grafted product. Reference [7] shows that it was necessary to convert a serine residue at position 27 of the human sequence to the corresponding rat phenylalanine residue to obtain a CDR-grafted product having satisfactory antigen binding activity. This residue at position 27 of the heavy chain is within the structural loop adjacent to CDR1. A further construct which additionally contained a human serine to rat tyrosine change at position 30 of the heavy chain did not have a significantly altered binding activity over the CDR-grafted antibody with the serine to phenylalanine change at position 27 alone. These results indicate that, for CDR-grafted antibodies which recognize more complex antigens, changes to residues of the human sequence outside the CDR regions, in particular in the loop adjacent to CDR1, may be necessary to obtain effective antigen binding activity.
Techniques have also recently been described for altering an anti-TAC monoclonal antibody by CDR-grafting. Human framework regions were chosen to maximize homology with the anti-TAC antibody sequence, while several additional ~ amino acids outside the CDRs were retained. The anti-TAC
antibody so altered has an affinity for the p55 chain of human interleukin-2 of about one third that of marine anti-TAC [8].
PCT/US89/05857 also describes CDR-grafted antibodies which are specific for the p55 TAC protein of the IL-2 receptor.
It is therein stated that the CDR-grafted antibody may ~sues~ro~uTE sHE~
N'O 91 /09966 PCT/G 1390/0201 ,, ,~ n, ;°~ 1 Q
c~ ,1 ~ '..' '~..:
_ <,~ '.
require that 3 or more amino acid residues from the donor Ig in addition to the CDRs, usually at least one of which is immediately adjacent to a CDR in the danor Ig, be changed to correspond to that of the donor antibody in order to obtain antigen binding activity.
It is therefore readily apparent that it is not a simple matter to produce a CDR-grafted antibody. It is often not sufficient merely to graft the CDRs from a donor Ig.onto the framework regions from an acceptor Ig. It may also be necessary to alter residues in the framework regions of the acceptor antibody in order to obtain binding activity.
However, it is not possible to predict, on the basis of the available prior art, which, if any, framework residues will need to be altered.
EF-A-0 018 794 describes a murine MAb which recognises an antigen characteristic of human helper T cells. A
particular example of such an MAb is described in the application and is designated OKT~. The antigen it recognises is generally referred to as the CD4 antigen.
The MAb is commercially available from Ortho Diagnostic Systems Inc. of Raritan, New Jersey, USA. Also available from the same supplier is a murine MAb known as 0KT4A.
This recognises a different eptiope on the CD4 antigen from the one recognised by OKT4.
Transplantation experiments in primates have indicated that both OKT4 and OKT4A can extend graft survival and may . gibe useful as an immunomodulator in humans. Experience ' from the treatment of renal transplant patients with the 1 murine MfAb OKT3 has shown that sometimes a population of patients develops neutralizing antibodies to OKT3. This .
immune response precludes repeat administration. To diminish the anticipated immune response to murine anti-CD4 MAbs, it would be desirable to produce a CDR-grafted SUBSTITUTE SHEET
WO 91/09966 PCT/GB90/0201~
1 ~ ~ ' ' :', r, ~, '.' ':' _ version of OKT4A having murine CDRs and human framework and other Ig derived regions.
However, as described above, the simple approach to constructing a CDR-grafted antibody does not always result in an antibody which effectively binds the antigen. The exact residues which comprise the CDRs are difficult to define and do not necessarily correspond to all the residues in the hypervariable regions. There may also be critical framework residues which are important in positioning the CDRs for interaction with antigen or which are involved in interactions between-the heavy and light chains. It may be necessary to alter certain framework residues so that they correspond to the murine residues at these positions, rendering the CDR-grafted antibody less ''human°° in character.
Despite the problems which. are inherent in attempting to produce a specific CDR-grafted antibody, in a preferred embodiment the present inventors have succeeded in producing a CDR-grafted antibody based on human framework regions and having an antigen binding site which recognises the CD4 antigen. In certain particularly preferred embodiment, the CDR-grafted antibody has an affinity for the CD4 antigen similar to that of the murine MAb OKT4A.
Therefore, according to the present invention, there is provided a CDR-grafted antibody having at least one chain . wherein the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (donor), the CDR-grafted antibody being capable of binding to the CD4 antigen.
Preferably, the CDR-grafted chain has two and, most preferably, all three CDRs derived from the donor antibody.
SUBSTITUTE SHEET
W'O 91/09966 5a ,_ d~ p PCT/GB90/0201~
v !.S
Advanta eousl g y, in the CDR-grafted chain, the or each CDR
comprises a composite CDR comprising all the residues from the CDR and all the residues in the corresponding hypervariable region of the donor antibody.
Preferably, at least one residue in the framework regions of the CDR-grafted chain has been altered so that it corresponds to the equivalent residue in the antibody.
Preferably, the framework regions of the CDR-grafted chain are derived from a human antibody.
Advantageously, the framework regions of the CDR-grafted chain are derived from a human Ig heavy chain. For such heavy chains, it is preferred that residue 35 in the heavy chain framework regions be altered so that it corresponds to the equivalent residue in the donor antibody.
Advantageously, for such heavy chains, at least one composite CDR comprising residues 26 to 35, 50 to 65 or 95 to 102 respectively is grafted onto the human framework.
It will be appreciated in this case that residue 35 will already correspond to the equivalent residue in the donor antibody.
Preferably, residues 23, 24 and 49 in such heavy chains correspond to the equivalent residues in the antibody. It is more preferred that residues 6, 23, 24, 48 and 49 in such heavy chains correspond to the donor antibody in . equivalent residue positions. If desired, residues 71, 73 and 79 can also so correspond.
To further optimise affinity, any one or any combination of residues 57, 58, 60, 88 and 91 may correspond to the equivalent residue in the donor antibody.
SUBSTITUTE SHEET
W'O 91 /09966 PCT/G B90/0201 s (, ~. n ~. ; -7 ~-. ~ .7 ,,. ..,...- :.;
1:. '._ . .. _ ' The heavy chain is preferably derived from the human KOL
heavy chain. However, it may also be derived from the human NEWM or EU heavy chain.
Alternatively, the framework regions of the CDR-grafted chain may be derived from a human kappa or lambda light chain. For such a light chain, advantageously at least one composite CDR comprising residues 24 to 39, 50 to 56 or 89 to 97 respectively is grafted onto the human framework. Preferably, residue 49 also corresponds to the equivalent residue in the donor antibody.
To further optimise affinity, it is preferable to ensure that residues 49 and 89 correspond to the equivalent residues in the donor antibody. It may also be desirable to select equivalent donor residues that form salt bridges.
The light chain is preferably derived from the human REI
light chain. However, it may also be derived from the human EU light chain.
Preferably, the CDR-grafted antibody of the present invention comprises a light chain and.a heavy chain, one or, preferably, both of which have been CDR-grafted in accordance with the principles set out above for the individual light and heavy chains.
In the preferred case, it is advantageous that all three ~ ~CDRs on the heavy chain are altered and that minimal ~ alteration is made to the light chain. It may be possible to alter none, one or two of the light chain CDRs and still retain binding affinity at a reasonable level.
It will be appreciated that in some cases, for both heavy and light chains, the donor and acceptor residues may be SUBSTITUTE SHEET
~1'O 91 /09966 pC'T/G)390/0201 :~ _ ..
identical at a particular position and thus no change of acceptor framework residue will be required.
It will also be appreciated that in order to retain as far as possible the human nature of the CDR-grafted antibody, as few residue changes as possible should be made. It is envisaged that in many cases, it will not be necessary to change more than the CDRs and a small number of framework residues. Only in exceptional cases will it be necessary to change a larger number of framework residues.
Preferably, the CDR-grafted antibody.is a complete Ig, for example of isotype IgG~ or IgG'.
If desired, one or more residues in the constant domains of the Ig may be altered in order to alter the effector functions of the constant domains.
Preferably, the CDR-grafted antibody has an affinity for the CD4 antigen of between about 105.M-~ to about 10 ~z.M'~, more preferably at least l0a.Ml. and most preferably the affinity is similar to that of MAb OKT4 or OKT4A.
Advantageously, the or each CDR is derived from a mammalian antibody and preferably is derived from a murine MAb.
Advantageously, the CDR-grafted antibody of the present invention is produced by use of recombinant DNA
~ ' technology.
1 According to a second aspect of the present invention, there is provided a method for producing a CDR-grafted antibody according to the first aspect of the present invention, which method comprises:
providing a first DNA sequence, encoding a first antibody chain in which the framework regioP~s axe predominantly SUBSTITUTE SHEET
WO 91/09966 PCT/G B90/0201~
c~,~ ~ ~~~:?
v F:: ';, __ . , .. _ _..
derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (acceptor), under the control of suitable upstream and downstream elements;
transforming a host cell with the first DNA sequence; and 5 culturing the transformed host cell so that a CDR-grafted antibody according to the first aspect of the invention is produced.
Preferably, the method further comprises:
10 providing a second DNA sequence, encoding a second antibody chain complementary to the first chain, under the control of suitable upstream and downstream elements; and transforming the host cell with both the first and second DNA sequences.
Advantageously, the second DNA sequence encodes a second antibody chain in which the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from the second antibody (donor).
The first and second DNA sequences may be present on the same vector. In this case, the sequences may be under the control of the same or different upstream and/or downstream elements.
Alternatively, the first and second DNA sequences may be present on different vectors.
' ~ According to a third aspect of the present invention, there is provided a nucleotide sequence which encodes an antibody chain in which the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (donor), the antibody chain being capable of forming a CDR-grafted antibody according to the first aspect of the present invention.
~StJSSTI'~l)TE SHEET
~f'O 91 /09966 pCT/G B90/0201 b : .. . r : , ,. :, ..~' 16 ., . ~ _.
It is envisaged that the CDR-grafted antibodies of the present invention will be of particular use in therapy, in particular in treating graft rejections or in treating helper T cell disorders.
The CDR-grafted antibodies of the present invention may be produced by a variety of techniques, with expression in transfected cells, such as yeast, insect, CHO or myeloma cells, being preferred. Most preferably, the host cell is a CHO host cell.
To design a CDR-grafted antibody, it is first necessary to ascertain the variable domain sequence of an antibody having the desired binding properties. Suitable source cells for such DNA sequences include avian, mammalian or other vertebrate sources such as chickens, mice, rats and rabbits, and preferably mice. The variable domain sequences (VH and V~) may be determined from heavy and light chain cDNA, synthesized from the respective mRNA by techniques generally known to the art. The hypervariable regions may then be determined using the Kabat method [2].
The CDRs may be determined by structural analysis using X-ray crystallography or molecular modelling techniques. A
composite CDR may then be defined as-containing all the residues in one CDR and all the residues in the corresponding hypervariable region. These composite CDRs along with certain select residues from the framework region are preferably transferred as the "antigen binding sites", while the remainder of the antibody, such as the ~ heavy and light chain constant domains and remaining . framework regions, may be based on human antibodies of different classes. Constant domains may be selected to have desired effector functions appropriate to the intended use of the antibody so constructed. For example, human IgG isotypes, IgG~ and IgG3 are effective for complement fixation and cell mediated lysis. For other SUBSTITUTE SHEET
v purposes other isotypes, such as IgG2 and IgG', or other classes, such as IgM and IgE, may be more suitable.
For human therapy, it is particularly desirable to use human isotypes, to minimize antiglobulin responses during therapy. Human constant domain DNA sequences, preferably in conjunction with their variable domain framework bases can be prepared in accordance with well-known procedures.
An example of this is CAMPATH 1H available from Burroughs Wellcome Ltd.
In accordance with preferred embodiments of the present invention, certain CDR-grafted antibodies are provided which contain select alterations to the human-like framework region (in other words, outside of the CDRs of the variable domains), resulting in a CDR-grafted antibody with satisfactory binding affinity. Such binding affinity is preferably from about lOS.M'~ to about 10~2.M'~ and is more preferably at least about lOa.M'~. Most preferably the binding affinity is about equal to that of marine MAb OKT4A.
In constructing the CDR-grafted antibodies of the present invention, the VH and/or V~ gene segments may be altered by mutagenesis. One skilled in the art will also understand that various other nucleotides coding for amino acid residues or sequences contained in the Fc portion or other areas of the antibody may be altered in like manner (see, for example, PCT/US89/00297).
Exemplary techniques include the addition, deletion or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, provided that the proper reading frame is maintained.
SUB~iTU'~E SHEET
W'O 91/09966 PCT/GB90/0201~
;, c~ % ~, .
Substitutions, deletions, insertions or any subcombination may be used to arrive at a final construct. Since there are 64 possible codon sequences but only twenty known amino acids, the genetic code is degenerate in the sense that different codons may yield the same amino acid.
However, the code is precise for each amino acid. Thus there is at least one codon for each amino acid, i.e. each codon yields a single amino acid and no other. It will be apparent that during translation, the proper reading frame must be maintained in order to obtain the proper amino acid sequence in the polypeptide ultimately produced.
Techniques for additions, deletions or substitutions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated site-directed mutagenesis and the polymerase chain reaction.
Oligonucleotide site-directed mutagenesis in essence involves hybridizing an oligonucleotide coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the single strand as a template for extension of the oligonucleotide to produce a strand containing the mutation. This technique, in various forms, is described in references [9] to [12].
Polymerase chain reaction (PCR) in essence involves exponentially amplifying DNA in vitro using sequence specific oligonucleotides. The oligonucleotides can 30., incorporate sequence alterations if desired. The ' polymerase chain reaction technique is described in reference [13]. Examples of mutagenesis using PCR are described in references [14] to [17].
The nucleotide sequences of the present invention, capable of ultimately expressing the desired CDR-grafted antibodies, can be formed from a variety of different SUBSTITUTE SHEEN' WO 91/09966 P~CT/GB90/0201:
c/nr~;:'an"'~ j v , polynucleotides (genomic DNA, cDNA, ~2NA or synthetic oligonucleotides). At present, it is preferred that the polynucleotide sequence comprises a fusion of cDNA and genomic DNA. The polynucleotide sequence may encode various Ig components (e. g. V, J, D, and C domains). They may be constructed by a variety of different techniques.
Joining appropriate genomic and cDNA sequences is presently the most common method of production, but cDNA
sequences may also be utilized (see EP-A-0 239 400 and [7J).
Certain suitable expression vectors and host cells are described in US-A-4 816 567.
The vectors and methods disclosed herein are suitable for use in host cells over a wide range of prokaryotic and eukaryotic organisms.
In general, of course, prokaryotes are preferred for cloning of DNA sequences for constructing the vectors useful in the invention. For example, E. coli DH5a is particularly useful. This example is, of course, intended to be illustrative rather than limiting.
Prokaryotes may also be used for expression. The aforementioned E. Coli strains, bacilli such as Bacillus subtilus, and other enterobacteriaceae, such as Salmonella typhimurium or Serratia marcesans, and various Pseudomonas species may be used.
30, In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site as well as marking sequences which are capable of providing phenotypic selection in transformed cells. For example, E. Coli is typically transformed using one of the ~~E~'ITIJTE SHEET
~ O 91 /(?9966 PCT/(y B90/0201 n '": '' ' ~ ~ _ ..
many derivatives of pBR322, a plasmid derived from an E.
Coli species [18]. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, 5 its descendents or other microbial plasmids may also contain, or be modified to contain, promoters which can be used by the microbial organism for the expression of recombinant proteins. Those promoters commonly used in recombinant 'DNA construction include lactose promoter 10 systems [19] to [21] and tryptophan (trp) promoter systems [22] and EP-A-0 036 776. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling a 15 skilled worker to ligate them functionally into plasmid vectors [23].
In addition to prokaryotes, eukaryotic microbes, such as yeast cultures, may also be used. Saccharomyces 20 cerevisiae, or common baker°s yeast, is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, [24] to [26]
is commonly used. This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 [27]. The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for ~ ~datecting transformation by growth in the absence of tryptophan.
Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase [28] or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, suB~oTUTS sHE~'~' « 'O 91/09966 PCT/G 890/0201 c : .-. -21 ~:% '...- ... .. ' _ ....
v , glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase [29] and [30]. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and .termination. Other promoters, which have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, an enzyme responsible for maltose and galactose utilization [30].
Any plasmid vector containing a yeast compatible promoter, origin of replication and termination sequences is suitable.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts.
In principle, any such cell culture is workable, whether from a vertebrate or an invertebrate organism. However, to date, interest has been greatest in vertebrate cells, and propogation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [31]. Examples of such useful host cell lines are VERO, HeLa, Chinese hamster ovary (CHO), W138, BHK, COS-7, MDCK
and myeloma cell lines. Expression vectors for such cells may include (if necessary) an appropriate origin of ' ~ replication, as well as a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation sites and transcriptional terminator sequences.
For use in mammalian cells, the control functions on the expression vectors are often provided by viral material.
For example, commonly used promoters are derived from ~SUgSTITUTE SHEET
V1'O 91/09966 PCT/GB90/0201:
.. 2 2 v , human Cytomegalovirus (HCMV), Polyoma virus, Adenovirus 2 and, most frequently, Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (32]. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell system.
An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e. g.
Polyoma virus, Adeno virus, VSV or BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
The vectors containing the DNA segments of interest (e. g.
the heavy and light chain encoding sequences and expression control sequences) can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, lipofection or electroporation may be used for other cellular hosts (33].
. Once expressed, the CDR-grafted antibodies of the present ,.invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography and gel electrophoresis (34]. Binding affinities of the constructs so expressed may be ascertained by techniques known to the art, as more fully exemplified in the example section of this specification.
SUBSTITUTE SHEET
2 3 s; ~ ,' n .°, , ., YR ;~i ... . :.J '_' -S
Substantiall ure,CDR
y p -grafted antibodies of at least 90 to 95~ homogeneity are preferred, and 98 to 99~ or more homogeneity is most preferred for pharmaceutical uses.
Once purified, partially or to homogeneity as desired, the CDR-grafted antibodies may then be used diagnostically or therapeutically (including extracorporeally) or in developing and performing assay procedures, immunofluorescent stainings and the like [35].
l0 The CDR-grafted antibodies of the present invention will typically find use in treating T-cell mediated disorders.
For example, typical disease states suitable for treatment include graft versus host disease and transplant rejection in patients undergoing an organ, such as heart, lung, kidney or liver, transplant, Other diseases include autoimmune diseases, such as Type I diabetes, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus and myasthenia gravis.
T cells are clonal expansions from single cells expressing only one T sell antigen receptor capable of recognizing a peptide bound to a specific HLA, molecule on specialized antigen presenting cells, such as a macrophages, and on other tissues. The activation of these T cells can be blocked by antibodies recognizing the T cell receptor complex or the peptide-HLA complex. OKT3 recognizes the CD3 molecule which is comprised of several subunits physically complexed with the T cell receptor. Several other molecules on the T cell, including the CD4 and CDS
~ ' molecules, are also involved in T cell activation by binding to the HLA molecules at sites that are distinct from the T cell receptor binding site.
CD4 is found on the subpopulation of T cells with T cell receptors that recognize HLA class II molecules.
Therefore, one approach to immunosuppression involves the use of monoclonal antibodies, such'as OKT4 or OKT4A that ~5UB5TITU?E SHEET
W'O 91/09966 PCT/GB90/0201~
v , ~ , are immunosuppressive because they inhibit the interaction of the CD4 molecule with the HLA class II molecule.
Antibody binding to CD4 can result in immunosuppression by a number of mechanisms including the inhibition of a normal activation signal, the triggering of a down regulation signal pathway, or modulating this receptor from the cell surface. It could also induce a subpopulation of T cells capable of suppressing other alloreactive or autoreactive subpopulations. Anti-CD4 antibodies may also act by inducing complement or antibody-dependent T cell lysis or by removal of the T
cells from the blood stream or site of inflammation.
Therefore the Fc-recptor binding characteristics of each antibody may be important to their function. Alternative strategies include the use of anti-CD4 antibodies that have been radiolabeled or coupled to toxins.
These immunosuppressive properties of these anti-CD4 antibodies provide a therapeutic use in the suppression of activated T lymphocytes that mediate the diseases associated with transplanation and autoimmunity. The CD4 molecule is also the receptor for the gp120 subunit of the HIV virus. Since OKT4A inhibits the binding of gp120 to CD4, this antibody or fragments thereof may block viral infection.
The CD4 molecule is normally involved in providing a co-stimulatory signal to the T cell as a result of its binding to the HLA class II molecule. Therefore it is ~ also possible that anti-CD4 antibodies can provide a co-stimulatory function in combination with other signal inducing reagents. This therapeutic strategy may be useful in the treatment of immunocompromised patients.
The CDR-grafted antibodies of the present invention may also be used in combination with other antibodies, particularly MAbs reactive with otfier markers on human sussTe~uT~ sH~~' E~ ,.
:; :..
... ~ :_ cells responsible for the diseases. For'example, suitable T-cell markers can include those grouped into the so-called "Clusters of Differentiation," as named by the First International Leukocyte Differentiation Workshop 5 [36].
Generally, the present CDR-grafted antibodies will be utilized in purified form together with pharmacologically appropriate carriers. Typically, these carriers include 10 aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer°s. Suitable physiologically acceptable 15 adjuvants, if necessary to keep the complex in suspension, may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates.
20 Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, can also be present [37].
The CDR-grafted antibodies of the present invention may be used as separately administered compositions or ~n conjunction with other agents. These can include various immunotherapeutic drugs, such as cyclosporine, ~ ~ methotrexate, adriamycin or cisplatinum, and immunotoxins.
Pharmaceutical compositions can include "cocktails°' of various cytotoxic or other agents in conjunction with the CDR-grafted antibodies of the present invention, or even combinations of CDR-grafted antibodies according to the present invention and CDR-grafted antibodies having different specificities.
~SUBSTiTUTE SHEET
dfO 9x/09966 PCT/GB90/0201~
a :~.~a ,...
~~', '~~ ''i ' 2 6 The route of administration of pharmaceutical compositions according to the invention may be any of those commanly known to those of ordinary skill in the art. For therapy, including without limitation immunotherapy, the CDR-grafted antibodies of the invention can be administered to any patient in accordance with standard techniques. The administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, or also, appropriately, by direct infusion with a catheter. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter indications and other parameters to be taken into account by the clinician.
The CDR-grafted antibodies of this invention can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective with conventional immunoglobulins and art-known lyophilization and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilization and reconstitution can lead to varying degrees of antibody activity loss (e. g. with conventional immunoglobulins, IgM antibodies tend to have greater activity loss than IgG antibodies) and that use levels may have to be adjusted to compensate.
The compositions containing the present CDR-grafted antibodies or a cocktail thereof can be administered for . prophylactic and/or therapeutic treatments. In certain ' therapeutic applications, an adequate amount to accomplish at least partial inhibition or killing of a population of selected cells is defined as a "therapeutically-effective dose". Amounts needed to achieve this dosage will depend upon the severity of the disease and the general state of the patient's own immune system, but generally range from 0.005 to 5.0 mg of CDR-grafted antibody per kilogram of SUBSTITUTE SHEET
WO 91 /09966 PCT/G>390/0201 2 7 c~. ., ~ ,., ~, G:. .~ ... . ': ., .> ' body weight, with doses of 0.05 to 2.0 mg/kg/dose being more commonly used. For prophylactic applications, compositions containing the present CDR-grafted antibody or cocktails thereof may also be administered in similar or slightly lower dosages.
A composition containing a CDR-grafted antibody according to the present invention may be utilized in prophylactic and therapeutic settings to aid in the alteration, inactivation, killing or removal of a select T cell target population in a mammal.
In another embodiment, the constructs described herein may be used extracorporeally or in vitr~ selectively to kill, deplete or otherwise effectively remove the target cell population from a heterogenous collection of cells. Blood from the mammal may be combined extracorporeally with the CDR-grafted antibodies whereby the undesired cells are killed or otherwise removed from the blood for return to the mammal in accordance with standard techniques.
In addition to the therapeutic uses, the CDR-grafted antibodies will find use in diagnostic assays. The CDR-grafted antibodies may be labelled in accordance with techniques known to the art. The CDR-grafted antibodies are also suitable for other in vivo purposes. For example, the CDR-grafted antibodies can be used for selective cell treatment of peripheral blood cells where it is desired to eliminate only target T lymphocytes or ~ similarly in cell culture to eliminate unwanted T
lymphocytes.
The present invention is now described, by way of example only, with reference to the accompanying drawings, in which;
~SUBST!'fUTE SHEET
WO 9l/09966 PCT/G B90/0201~
1 !~ 2~ ~ i 4~.
-~ 2 8 v , Figure 1 depicts the nucleotide sequence of the OKT4A
heavy chain variable domain;
Figure 2 depicts the nucleotide sequence of the OKT4A
light chain variable domain;
Figure 3 depicts the OKT4A heavy chain variable domain amino acid sequence in which the CDRs are underlined;
Figure 4 depicts the OKT4A light chain variable domain amino acid sequence in which the CDRs are underlined;
Figure 5 depicts the alignment of KOL with the OKT4A CDR
grafted heavy chain amino acid sequence in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
Figure 6 depicts the alignment of REI with the OKT4A CDR
grafted light chain amino acid sequence in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
Figure 7 depicts the DNA sequence and amino acid translation of a GDR-grafted heavy chain;
Figure 8 depicts the DNA sequence and amino acid translation of a CDR-grafted light chain;
Figure 9 depicts the construction of a CDR-grafted OKT4A
. heavy chain expression vector;
Figure 10 depicts binding and blocking assays of CDR-grafted OKT4A light chain constructs in combination'with a chimeric OKT4A heavy chain;
SUESTiTUTE SHEET
WO 91/09966 PCT/GB90/0201~
r .. ,., .3 ~" . . ... .i : ~ _ Figure 11 depicts binding and blocking assays of the OKT4A
heavy chain constructs, HCDR1, HCDR2 and HCDR3, in combination with OKT4A light chain;
Figure 12 depicts the alignment of REI with the CDR-grafted OKT4A light chains, LCDR1 and LCDR2, and the murine OKT4A light chain amino acid sequences in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
to Figure 13 depicts the alignment of KOL with the CDR-grafted OKT4A heavy chains, HCDR1 through HCDR10, and the murine OKT4A heavy chain amino acid sequences in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
Figure 14 depicts binding and blocking assays of the CDR-grafted heavy chain constructs, HCDR1, HCDR2 and HCDR3 in combination with the CDR-grafted light chain LCDR2;
Figure 15 depicts binding and blocking assays of the CDR-grafted heavy chain constructs HCDR4 through HCDR10 in combination with the light chain LCDR2;
Figure 16 (A&13) depicts blocking assays of the OKT4A heavy chain constructs HCDR5, HCDR6, and HCDR10 in combination with light chain constructs LCDR2, LCDR3, LCDR2Q, LCDR3Q, and LCDR4Q, and the chimeric form of OKT4A;
Figure 17 depicts relative affinity assays of the OKT4A
~ ' heavy chain constructs HCDR5 and HCDR10 in combination with light chain construct LCDR2 and the chimeric and murine forms of OKT4A using the murine and chimeric forms of OKT3 as negative controls;
Figure 1B depicts the results of studies on inhibition of MLR by various antibodies using T6 as negative control;
and ~SUSSTI~'UTE SHEE°f 1V0 91/09966 PCT/GB90/0201~
,. r 3~. ~ " E' .z'~ '~ 4:"~ ' . . 3 0 ..
.y Figure 19 depicts the results of studies on inhibition of proliferation by various antibodies.
Humanization of OKT4A
OKT4A is a marine monoclonal antibody which recognizes the CD4 antigen located primarily on helper T lymphocytes.
CDR-grafted antibodies have been constructed in which the CDRs of the variable domains of both heavy and light chains were derived from the marine OKT4A sequence. The variable domain frameworks and constant domains were derived from human antibody sequences.
The three CDRs that lie on both heavy and light chains are composed of those residues which structural studies have shown to be involved in antigen binding. Theoretically, if the CDRs of the marine OKT4A antibody were grafted onto human frameworks to form a CDR-grafted variable domain, and this variable domain were attached to human constant domains, the resulting CDR-grafted antibody would essentially be a human antibody with the specificity of marine OKT4A to bind the human CD4 antigen. Given the highly "human°° nature of this antibody, it would be expected to be far less immunogenic than marine OKT4 when administered to patients.
Following testing for antigen binding of a CDR-grafted OKT4A antibody in which only the CDRs were grafted onto the human framework, it was shown that this did not ~ produce a CDR-grafted antibody having reasonable affinity for the CD4 antigen. It was therefore decided that additional residues adjacent to some of the CDRs and critical framework residues needed to be switched from the human to the corresponding marine OKT4A residues in order to generate a functional antibody.
SUBSTITUTE ShISE'T
WO 91/09966 PCT/G B90/0201~
31 ~3 ~; ;.n a, , a ,: _ ._ Isolation of the OKT4A heavy- and light chain cDNA and DNA
sequence analysis of the variable domain.
To design the CDR-grafted OKT4A antibody, it was first necessary to determine the sequence of the variable domain of the murine OKT4A heavy and light chains. The sequence was determined from heavy and light chain cDNA that had been synthesized from the respective mRNA.
mRNA was prepared from OKT4A-producing hybridoma cells by guanidinium thiocyanate extraction followed by cesium chloride gradient purification [38].- cDNA.was synthesized and libraries were prepared and screened in Dr. J. Rosen's laboratory at The R.W. Johnson Pharmaceutical Research Institute in La Jolla, California. cDNA was synthesized from the mRNA, EcoRI linkers were added, and it was then ligated into the EcoRI site of the lgti0 cloning vector.
The recombinant phage was packaged into infectious particles which were used to infect E. Coli 0600.
This library was screened for OKT4A heavy chain sequences using oligonucleotide probes Cg and FR3. Cg (the mRNA
sequencing primer from Pharmacia LKB Biotechnologies, Inc) has the sequence 5' GGCCAGTGGATAGAC 3' and binds to the murine IgG constant domain. Probe FR3 has the sequence 5' GGCCGTGTCCTCAGACCT 3' and binds to the third framework region of the variable ~ domain of murine heavy chains. Five positive clones were evaluated by southern transfer and hybridization to probes . Cg, FR3 and a cDNA to mouse IgG2a CH3. A single clone with a 1600 by EcoRI insert which hybridized to all three probes was selected.
~gUBSTITUTE SHEET
~~'O 91/09966 PCT/GB90/02015 .~ : . ~ ~ ~; I:'.
' ' The library was screened for the OKT4A light chain sequence using an oligonucleotide probe Ck (the mRNA
sequencing primer from Pharmacia) with a sequence of 5' GGCTCCAGGTTGCTGATGCTGAAGG 3' and which binds to the mouse kappa constant domain. Six positive clones were further assessed by southern transfer and hybridization to oligonucleotide probes T4AK, whose sequence is 5' GGCTCCAGGTTGCTGATGCTGAAGG 3' l0 and which binds to mouse kappa chain framework region 3, and Ck. A single clone which contained a 900 by EcoRI
insert and hybridized to both probes was chosen.
The 1600 by heavy chain cDNA was subcloned into the EcoRI
sites of the pBluescript plasmid vector (Stratagene Cloning Systems) and the M13mp8 sequencing vector (Pharmacia LKB Biotechnologies, Inc). The 900 by light chain cDNA was subcloned into the EcoRI sites of the plasmid vector pUC8 (Pharmacia LKB Biotechnologies, Inc) and the M13mp19 sequencing vector.
The dideoxy-nucleotide chain termination method of DNA
sequence analysis [39) was used to determine sequence of both single-stranded (M13) and double-stranded (plasmid) templates. The sequence of the 5' untranslated regions, signal sequences, variable domains and a portion of the constant domains were determined for both heavy and light chain cDNA. The DNA sequence for heavy and light chains is illustrated in Figures 1 and 2. The amino acid . ~ translation of the heavy chain variable domain sequence is - presented in Figure 3. A translation of the light chain . variable domain is presented in Figure 4.
It is to be noted that the nucleotide sequence given for the light chain has an A residue at position 163, towards the beginning of the CDR1 coding sequence (see Figure 2).
SUBSTITUTE SHEET
~'O 91 /09966 PCT/G1390/0201 33 ~n .~,~, ~i~. 7.; -.. ~ , Translation of this sequence gives a glutamine residue at~
position 27 in the light chain (see Figure 4).
When the sequencing of the OKT4 light chain was originally carried out, nucleotide residue 163 was thought to be a C
residue, giving a proline residue at position 27 in the light chain. The first CDR-grafted antibodies produced by the present inventors were constructed on the assumption that light chain residue 27 was a proline residue. This can be seen from Figures 6, 8 and 12.
Desicrn of the CDR-cLafted OKT~A Antibody To design the CDR-grafted OKT4A antibody, it was necessary to determine which residues of murine OKT4A comprise the CDRs of the light and heavy chains. Examination of antibody X-ray crystal structures shows the antigen binding surface to be located on a series of three loops extending from the b-barrel framework of the variable domain. These loops can thus be used to define the CDRs.
Since the crystal structure of murine OKT4A is not available, the structure of a similar murine antibody of known crystal structure was used to define the residues of the loops.
Three regions of hypervariability amid the less variable framework sequences are found on both light and heavy chains [2]. In most cases these hypervariable regions correspond to, but may extend beyond, the CDRs. It was ~ ' decided that a combination of those murine OKT4A residues in the CDRs and those in the hypervariable regions would 1 comprise composite CDRs to be grafted onto the human antibody framework. The amino acid sequences of the murine OKT4A heavy and light chains are presented in Figures 3 and 4, with the selected composite CDRs underlined.
StJESTITUTE SHEET
W'O 91 /09966 ;s , ;~ ,~ ; ~; °, PCT/G B90/0201 c;.
' ' The human antibody framework sequence for the heavy chain is that of the human antibody KOL. KOL was chosen because its X-ray crystallographic structure had been determined to a high degree of resolution. This should allow for accurate molecular modelling of the antibody. For the same reason, the framework sequence of the human light chain dimer, REI, was used for the light chain frameworks.
The amino acid sequences of KOL arid REI are shown in Figures 5 and 6 in comparison to those of the CDR--grafted OKT4A heavy (HCDR1) and light (LCDR1) chain variable domains.
The CDR-grafted heavy chain was designed to have a human IgG4 constant portion. The IgG4 subclass was selected based on experience with the murine anti-CD3 monoclonal antibody, OKT3, which is used to treat renal graft rejection. OKT3 has a murine IgG2a isotype and does not fix complement in humans. The human IgG4 isotype also does not fix complement. The CDR-grafted OKT4A light chain was constructed with the human kappa constant domain.
Construction of the CDR-crafted OKT4A Qenes Heavy and light chain CDR-grafted variable domains were constructed by the ligation of synthetic double-stranded DNA oligomers, similar to the method employed in [40].
The 5' end of the variable domains contain signal sequences of the light and heavy chains of the murine . monoclonal antibody B72.3 [41]. The signal sequence directs secretion of the antibody from mammalian cells. A
. Kazak sequence [42] immediately precedes the AUG start codon to enhance translation. The variable domains~were then ligated to DNA coding for.the human constant domains to create the CDR-grafted heavy and light chain genes.
CDR-Grafted OKT4A Heav~r Chain Construction SUBSTITUTE SHEET
WO 91/09966 PCT/l;B90/02015 ' '' :v f. ,..
Eight complementary pairs of oligomers, approximately 30 by in length were designed to have overlapping ends and to span the variable domain from a XhoI site located in framework 2 to a HindIII site at the beginning of the 5 first constant domain. These eight oligomer pairs were synthesized, ligated together in a step-wise manner and then ligated to the HindIII 5' end of the human IgG4 constant domain DNA. The IgG4 DNA was provided by Celltech, Ltd (Slough, U. K.) as genomic DNA. It is a 10 2153bp insert in an M13 phage DNA vector with a 5' EcoRI
and a 3' BamHI restriction site. The CH1, hinge, CH2 and CH3 domains are surrounded by four introns. The gene was modified by Celltech to have a C to A change at the penultimate base of the CH1 axon to create a new HindIII
15 site for CDR-grafted gene construction purposes.
The 5° end of the variable domain was constructed by ligating two complementary pairs of synthetic oligomers, each approximately 90bp in length. This fragment, which 20 had a 5' EcoRT end and a 3' XhoI end was ligated to the XhoI end of the fragment described above to yield the complete CDR-grafted heavy chain gene. This gene is 2364bp in length and has a 5' EcoRI end and a 3' BamHI
end. The DNA sequence with amino acid translation of the 25 gene is shown in Figure 7. The regions of interest, defined by nucleotide number are:
SUBSTITUTE SHEET
A
~'a n "~ ,, r; '.'1 :., i i.~-G. _ ..
1 - 14 EcoRI site and Kozak sequence 15 - 71 signal sequence 72 - 146 framework 1 177 - 218 framework 2 255 - 362 framework 3 393 - 431 framework 4 432 - 727 CH1 domain 728 - 1117 intron 118 - 1153 hinge domain 1154 - 1271 intron 1272 - 1599 CH2 domain 1600 - 1698 intron 1699 - 2016 CH3 domain 2017 - 2366 3' untranslated region CDR-drafted light chain giene construction Twelve complementary pairs of synthetic oligomers with overlapping ends were ligated simultaneously to assemble the CDR-grafted light chain variable domain. This fragment had a 5' EcoRI end and a 3' NarI end. This was ligated to the 5' NarI end of the human kappa constant domain DNA. Human kappa constant cDNA was modified by Celltech to include a NarI restriction site in the third and fourth codons. The resulting CDR-grafted light chain 'gene was 754bp in length and had EcoRI ends. The DNA
sequence with amino acid translation is shown in Figure 8.
The regions of interest defined by nucleotide number are:
SUBS'TITU'tE SHEET
WO 91/09966 PC'T/GB90/0201~
3 7 ~ ~, ', y , ,- r, :4i 1 8 EcoRI site and Kozak sequence 9 - 68 signal sequence 69 - 143 framework 1 165 - 215 framework 2 237 - 338 framework 3 357 - 404 framework 4 405 - 710 kappa constant domain 711 - 754 untranslated Expression of the CDR-crafted OKT4A antibody Construction of the Heavy Chain Expression Vector A CDR-grafted heavy chain expression vector was constructed by inserting the heavy chain gene into the expression plasmid pEe6HCMVBgI2 and the adding the GS
fragment, which is composed of the SV40 origin and glutamine synthetase minigene. These steps are diagrammed in Figure 9. pE26HCMVBgI2 and the GS fragment were provided by Celltech, Ltd.
pEe6HCMV was digested at the EcoRI and BclI sites. The pEe6HCMVBgI2 DNA had been demethylated by passaging it through the DAM' E. Coli strain GM242, which lacks the deoxyadenosine methylase. BclI will only restrict DNA
which does not contain N6-methylated deoxyadenosine at the ~ 'enzyme's recognition site. The overhang resulting from the BclI restriction is compatible with the BamHI
overhang. The EcoRI/BamHI CDR-grafted heavy chain gene (HCDR1) was then ligated to the EcoRI/BclI ends of pEe6HCMVBgI2 to produce pEe6HCDR1.
A 5500 by BamHI fragment containing the glutamine synthetase minigene and the SV40 origin of replication and ~SUBST~TUTE SHEET
w'0 91/09966 PCT/GB90/0201~
,~ n a~ '~, r~ °' 3 8 ' v , early and late promoters was inserted into the BamHI site of pEe6HCDR1 to produce pEe6HCDRlgs. The correct orientation of the GS fragment was verified by restriction analysis. pEe6HCDRlgs was prepared for mammalian cell transfection by the alkaline lysis method and cesium chloride gradient purification [43].
pEe6HCDRlgs is capable of expressing the CDR-grafted OKT4A
heavy chain in COS and CHO cells. The HCMV promoter lies 5' to the heavy chain gene and directs its transcription.
The SV40 polyadenylation signal sequence, which lies 3' to the gene, acts as a transcriptional terminator. For transient expression in COS cells, the SV40 origin of replication is present in the GS 5500 by fragment. The GS
minigene is present as a selectable marker for use following CHO cell transfections. Expression of the glutamine synthetase minigene is driven by the SV4o late promoter. The GS fragment is oriented such that the SV40 late promoter drives transcription in the same direction 2o as the HCMV promoter.
Several post-transcriptional events occur to produce the CDR-grafted heavy chain. Within the nucleus, the three intervening sequences of the IgG4 constant portion are removed and the exons are spliced together to create a mature mRNA. Following translation, the 19 amino acid signal sequence is removed in the rough endoplasmic reticulum (ER). A single carbohydrate is added to the CH2 domain of each chain in the ER and the Golgi apparatus.
~ ~ Each chain also contains four intrachain disulfide bonds.
When a light chain peptide is provided by a cotransfected light chain expression vector, a mature antibody is assembled by the binding together, via disulfide bonds, of two heavy and two light chains.
suesre°ruT~ sHEEr H'O 91/9966 PCf/G B90/0201~
sa , ;
f-:i ;
3 9 - ._ v Construction of the CDR-cxrafted OKT4A light chain expression vector:
The CDR-grafted OKT4A light chain expression vector was constructed by inserting the CDR-grafted light chain gene into the expression vector pEesHCMVBgI2 and then adding the SV40 origin and glutamine synthetase minigene-containing GS fragment. The light chain expression vector was constructed by essentially the same process that was l0 used for the heavy chain expression vector as illustrated in Figure 9. The light chain gene was ligated into the EcoRI site of pEe6HCMVBgI2 to produce pEe6LCDR1. The correct orientation of the light chain gene was verified by restriction analysis. The 5500 by GS fragment was inserted into the BamHI site to produce pEe6LCDRlgs. The correct orientation of the GS fragment was verified by restriction analysis. pEe6LCDRlgs prepared for mammalian cell transfection by the alkaline lysis method [43] and by cesium chloride gradient purification.
As with the CDR-grafted heavy chain gene, the transcription of the CDR-grafted light chain gene in pEe6LCDRgs is driven by the HCMV promoter and transcriptional termination is signalled by the Sv4o polyadenylation signal sequence. The SV40 origin of replication contained in the GS fragment allows for autonomous replication of this construct in COS cells.
The glutamine synthetase minicsene in the GS fragment provides a mechanism for selection and amplification in ' ~ CHO cells.
Post-transcriptional processing of the CDR-grafted light chain mRNA is not required prior to translation because no introns are present in the gene. Following translation, the leader sequence is removed in the rough ER. Two intrachain disulfide bonds are formed. Assembly of a mature antibody was discussed in the previous section.
~SUSS'TiTUTE SHEET
«
'O 91 /09966 PC'T/GB90/0201 ..
_ .
Transient expression of CDR-crafted OKT4A in COS-1 cells The transient expression of the CDR-grafted genes in CoS-1 cells provides a rapid and convenient system to test CDR-5 grafted OKT4A antibody expression and function. COS-1 cells constituitively express the SV40 large T antigen which supports the transient replication of episomes carrying the SV40 origin of replication [44]. The CDR-grafted gene expression vectors pEe6HCDRlgs and 10 pEe6I,CDRlgs contain the SV40 origin of replication as a portion of the GS fragment. Upon transfection into COS-1 cells, the expression vectors are replicated in the nucleus to a high copy number, resulting in relatively high expression levels.
COS-1 cells were obtained from the American Type Culture Collection (CRL 1650) and cultured in Dulbecco's Modified Eagle Medium (DMEM from GIBCO) with 10% fetal calf serum.
The CDR-grafted gene expression vectors were transfected into COS cells using the DEAF-dextran method followed by DMSO shock [45]. Briefly, 0.2 ml of 1 mg/ml DEAF-dextran in buffer is added to 15 mg vector DNA in 0.8 ml DMEM/Tris. This was added to 1 - 1.5 x 106 cells in a 60 mm tissue culture plate and incubated for approximately 6 hours. The DEAE-dextran/DNA complex is removed and 10%
DMSO in buffer is added to the plate for 2 minutes. This is removed, the cells are washed once with DMEM and then incubated with DMEM containing 10% fetal calf serum for 3-4 days. At that time supernatant from the wells is 30' ~ harvested and examined for antibody levels and ability to bind CDR positive lymphocytes.
Antibody levels were determined by ELISA. Wells were coated with a goat anti-human Fc specific antibody.
Various dilutions of the COS cell supernatant containing secreted antibody were added, incubated for one hour at room temperature in a humidity chamber and washed. A
SU~~T'1°fUTE SHE~'t ~1'O 91/09966 pCT/GB90/0201~
41 ;.~ .,, . ,., ., . ., . _ _ .
horse radish peroxidase-linked goat anti-human kappa chain antibody was added, incubated for one hour at room temperature and washed. Substrate for the horse radish peroxidase was added for detection. The CDR-grafted OKT4A
levels following co-transfection of pEe6HCDRlgs and pEe6LCDRlgs range from 200 to 1200 ng/ml of COS cell supernatant.
Antigen Binding Studies CDR-grafted OKT4A produced by COS cells was tested for its ability to bind to human peripheral blood lymphocytes (PBLs) or the CD4-positive HPBALL (human peripheral blood acute lymphocytic leukemia) cell line. It was also tested for its ability to block the binding of marine OKT4A to these cells. Binding was measured by the following procedure. PBLs were isolated from serum or HPBALL cells were harvested from tissue culture. Cells were incubated at 4°C for 1 hour with various dilutions of test antibody, positive control antibody or negative control antibody.
The cells were washed once and incubated at 4°C for 1 hour with an FITC-labeled goat anti-human IgG (Fc-specific, mouse absorbed). The cells were washed twice and analyzed by cytofluorography. chimeric OKT4A (described below) was used as a positive control. FITC-labeled marine OKT4A was used as a positive control for direct binding. Cells incubated with mock-transfected COS cell supernatant, followed by the FITC-labeled goat anti-human IgG, provided the negative control.
i ' To test the ability of CDR-grafted OKT4A to block marine OKT4A binding, the PBLs or HPBALL cells were incubated at 4°C for 1 hour with various dilutions of test antibody or control antibody. A fixed saturating amount of FITC-OKT4A
was added. The samples were incubated for 1 hour at 4°C, washed twice and analyzed by cytofluorography. Positive controls were FITC-labeled OKT4A t0 determine maximum SUSSTlTUTE SHEET
N'O 91 /09966 PC'T/GB90/0201 ,. . s~ :' r, ~. 4 2 ..
binding and unlabeled marine OKT4A as a reference standard for blocking. Negative controls were unstained cells with or without mock-transfected cell supernatant.
The ability of the CDR-grafted OKT4A light chain to bind CD4 positive cells and block the binding of marine OKT4A
was initially tested in combination with a chimeric OKT4A
heavy chain. The chimeric OKT4A heavy chain is composed of the marine OKT4AA variable domain and the human IgG4 constant portion. The chimeric heavy chain gene is expressed in the same expression vector used for the CDR-grafted genes. The CDR-grafted light chain expression vector and the chimeric heavy chain expression vector were co-transfected into COS cells. The full chimeric OKT4 antibody (chimeric light chain and chimeric heavy chain) was found to be fully capable of binding to CD4 positive cells and blocking the binding of marine OKT4 to these cells.
As Figure 10 illustrates, the CDR-grafted OKT4A light chain, LCDR1, in combination with the chimeric OKT4A heavy chain was unable to bind CD4 positive cells or block the binding of marine OKT4A to these cells.
Figure 11 shows the binding and blocking studies done with the CDR-grafted OKT4A heavy chain, HCDR1, combined with the chimeric OKT4A light chain. The chimeric OKT4A light chain is composed of a marine OKT4A variable domain and a human kappa constant domain. It is also expressed in the ~ same expression vector as is used for the CDR-grafted antibodies. COS cells were co-transfected with the CDR-grafted heavy chain expression vector and the chimeric light chain expression vector.
The CDR-grafted OKT4A heavy chain, HCDR1, in combination with the chimeric OKT4A light chain was also unable to ~SUBSTITUTS SHEET
.91/09966 CA 02046904 1999-12-06 PCT/G 890/0201:
bind CD4 positive cells or block the binding of murine OKT4A to these cells.
Modification of the CDR-Grafted Antibody The binding and blocking data clearly demonstrated that the initially designed~CDR-grafted OKT4A antibody was not capable of recognizing the C04 antigen:- Further modification of the antibody was necessary.- Either the murine OKT4A CDRs needed to be further expanded or critical framework residues involved in the positioning of CDRs, domain packing or light and heavy chain interactions needed to be changed from human to mouse.
Molecular modelling was used to identify the residues which appeared most critical for successful antigen interaction. Modelling was done at Celltech, Ltd with HYDRA'~software on a SiliconGraphics instrument.
Modification of the CDR-Grafted Licht Chain The crystal structure of OKT4A has not been determined, so a molecular model of OKT4A itself could not be used in the analysis. To analyze residues of the CDR-grafted light chain, a molecular model of the human REI light chain was superimposed with a mouse MOPC 603 Fab fragment. The MOPC
~. 603 light chain is similar in amino acid sequence to ~OKT4A. Also studies were done where the human REI light chain and the human KOL heavy chain were docked.
Decisions were made to extend CDR1 by converting residues 33 and 34 from the human leu and asp to the murine OKT4A
ile and ala. The human REI residue g1u38 was found to be involved in heavy chain and light chain packing. Changing this to the murine OKT4A his38 may be beneficial.
Residue 49 at the amino terminal edge of CDR2 directly impacts CDR2 and also makes contact with CDR3 of the heavy chain. Residue 89 near the amino terminal end of CDR3 *Trade-mark SUBSTITUTE SHEET
.V1'0 91 /09966 PCT/G 890/0201 ~ ' interacts with phe98 in CDR3 of the light chain and also contacts CDR3 of the heavy chain. The REI tyr49 and g1n89 were changed to the murine OKT4A his49 and 1eu89.
The new CDR-grafted OKT4A light chain gene that was generated by the above changes was designated I~CDR2. A
comparison of the amino acid sequence of the variable .domains of the human REI, LCDRijyLCDR2,~nnd_tha assumed murine OKT4A light chain is shown _in figure :12.-- The l0 changes were effected by altering codons by site-directed mutagenesis [46]. The bluescript'~phagemid vector from Stratagene Cloning Systems was used to generate single-stranded template for mutagenesis. The expression vector pEe6LCDR2gs was constructed in the same manner as for LCDRl. COS cells were co-transfected with pEe6LCDR2gs and the chimeric heavy chain expression vector.
The results of binding and.blocking studies are shown in Figure 10. The LCDR2 version of the CDR-grafted OKT4A
light chain, in combination with the chimeric ~KT4A heavy chain, is capable of binding to CD4 positive cells and of blocking the binding of murine OKT4A. These data show that LCDR2 is a functional CDR-grafted OKT4A light chain.
Modification of the CDR-crafted heavy chain . ' For modelling studies of the heavy~chain the molecular model of the human antibody KOL was used. All residue changes were made by site-directed mutagenesis to change codons. A decision was made to change g1u57 and his58 of KOL to thr57 and tyr58 of murine OKT4A. This revised CDR-grafted heavy chain was designated HCDR2. In addition to changes at residues 57 and 58, residue 24 lies near.CDRl and may be involved in positioning CDR1. Also residues 88 and 91 are involved in heavy chain variable domain packing and the interface between the heavy and light chains.
These three additional residue changes from KOL to murine *Trade-mark ci ~RSTITUTE SHEET
s:: : ..
OKT4A were incorporated into the heavy chain version HCDR3. An amino acid sequence comparison of the variable domains of KOL, HCDR1, HCDR2, HCDR3, marine OKT4A heavy chain, and versions to be described below is illustrated 5 in Figure 13.
Expression vectors pEe6HCDR2gs and pEe6HCDR3gs were co-transfected into COS cells with either the chimeric OKT4A
light chain expression vector or pEe6LCDR2gs. Binding and 10 blocking data are presented in Figures 11 and 14. Neither HCDR2 nor HCDR3 was able to effectively interact with antigen when combined with a chimeric or CDR-grafted OKT4A light chain.
15 Further modifications to the CDR-grafted heavy chain were explored. A decision to change KOL tyr35 to marine OKT4A
ser35 was made. Molecular modelling demonstrated that residue 42 was involved in positioning CDR2. Residue 44 is involved in light chain contacts. It may be beneficial 20 to change the KOL g1y42 and g1y44 to marine OKT4A g1u42 and arg44. KOL a1a60 was changed to the marine OKT4A
pro60. These changes were introduced in various combinations, while retaining the changes made at residues 24, 57, 58, 88, and 91 in the previous versions. These 25 latter versions were denoted HCDR4, HCDR5, HCDR6, HCDR7, HCDR8. The residue changes in each are described in Figure 13. The same expression vector was used as with the other constructions. COS cells were co-transfected with the new heavy chain expression vectors and 30 ~ ~ pEe6LCDR2gs.
The results of binding and blocking studies, in combination with LCDR2 (Figure 15), show positive interactions with the CD4. antigen in all of these versions 35 except HCDRB. Apparently the conversion of tyr35 to the marine ser35 is a critical change. The change to the 1.2 SUBSTITUTE SHEET
~i'O 91109966 c?
~r _ ~
murine residue at position 60 appears to enhance antigen interaction (compare HCDR6 vs HCDR4) while the change at position 44 appears to be slightly inhibitory (HCDR5 vs HCDR4, and HCDR7 vs HCDR6).
To determine if changes at residues 35 and 60 would be sufficient for antigen binding, HCDR9 (murine residues at positions 24, 35, 57, 58, 88, 91) and HCDR10 (murine residues at positions 24, 35, 57, 58, 60, 88, 91) were generated by site-directed mutagenesis. The same expression vector system was used for these versions of the CDR-grafted heavy chain. They were co-transfected into COS cells with pEe6LCDR2gs.
The results of binding and blocking experiments is illustrated in Figure 15 along with the prior versions of the CDR-grafted heavy chain. Clearly the changes made at residues 42 and 44 in previous versions were not necessary, contrary to the criteria set forth in PCT/US89/05857. The change at residue 60, present in HCDR10, but not in HCDR9, is beneficial.
A summary of the CDR-grafted OKT4A heavy chains and their activities in the binding and blocking assays is shown in Table 1. The most active CDR-grafted OKT4A antibody which contains the fewest murine residues is the combination of HCDR10 and LCDR2.
vUgSTI"CUTE SHEET
V1'O 91 /09966 PCT/GB90/0201 ' x .~ +
' + + I +
I I + + +
+ + + +
~ a c +~
~ U
~ I + + + + +
-I
1 I + + + + + l~
-~.
+ +
.-i N
0~ C
O
.~ co,~ .-i ~ COO~ N LT
d CO O CO
rdZO O O r"~ f-I
CW
N 0107 <T ~ x e-r ~ O CDO .>~Sa ~r sowD m vD~ co ~ O
com . . o~oo ~ 3 .
.~ o ~ ~ n ~ ~ o ~
* 0 ~
H +~ o * c>a c ~ c~- - o c~
a ~ ~ u~~ ~ ~ w ~
ri ~ CO N N ~' r4 If1 N d'~'C o r1 t!
O ~ l In O V!CY In la. . tnN - -. CL d ~
~ E ~ O ~ ~ ~ r9d'~ ~ O
r?
E t~ .1~
u, ~ - c, ~ ~ ro 'L~ N d'd' N N Z'~' Sl W
N
N N N N ro ro x o .
N a ~ ~
o - >, :
.-a ~ ~ro ~ ~
o ro N * Ov Vw0 cpv0 .C C
aC N ~ +~ o U G; CO 00N N N d' O
N
m m ~rv a ~r vo !r 3 ~ ~
I
d .CO r d'tnIn InN Il7In W
If1 i'G U ~ ll1N l'1M f'1d'M f'1 f"1 ~i o N
a c m b H
x ~
.o ~ ro N ar w w ~
o >a 'd N M ~ tf1 f~0001ri ..1 ~ ' tp i rx ~ x x a x x x x m a~
oc p; ~ D ~ A D D D D O D N
D
p D U U U U U U U U U U CG *
U
U U x ~ ~ x ~ S ~ ~ x ~ ~ *
?.
~r1 o ~n a ~SUSSTITUTE SHEET
N'O 91 /09966 PCT/G B90/0201 ,r: ~, °. r ".
v , Alternative Light Chain Constructs As is stated above, the present light chain constructs were produced on the assumption that at position 27 in the OKT4A light chain, there was a proline residue. Once it was appreciated that position 27 should be a glutamine residue, three new light chain constructs were produced and expressed. These were labelled LCDR2Q, LCDR3Q and LCDR4Q are identical to LCDR2, LCDR3 and LCDR4 respectively except that at position 27 there is a glutamine (Q) instead of a proline (P) residue. It has been shown that these light chains retained full activity.
The data showing this is presented in Figure 16.
It is to be noted that proline is significantly different from all other amino acids in that it has a planar structure. It is therefore commonly found at sites in peptide sequences where a change in orientation of the chain occurs. It is therefore likely that the structure of the light chain CDR1 having proline at residue 27 will be significantly different from that of the light chain CDR1 having glutamine at residue 27. Despite this, it has been demonstrated that the two light chains are equivalent from a functional standpoint. This supports the view expressed herein that it is not necessary to change all 6 CDRs in an antibody in order to produce a functional CDR-grafted antibody.
Alternative Modifications of the CDR-Grafted Liqht and i ' Heaw Chains Residue changes made in later versions of the CDR-grafted light and heavy chains were done based upon molecular modelling of REI, KOL and a related mouse antibody, MOPC
603, rather than of the CDR-grafted antibodies themselves.
Some of the alterations may be unnecessary for binding, especially at lower binding affinities. We have suesreTUTE s~~~
...
49 ~ ~'"~
,r,.,-...:.
constructed several~CDR-grafted light and heavy chain ' genes in which some of the framework residues previously switched to mouse residues have been changed back to the human. Generally those residues not directly involved in lengthening CDRs or positioning CDRs are being changed back to the human residues in various combinations. Table 2 lists these light and heavy chain genes with the residue numbers that revert from the marine to human. Site-directed mutagenesis was used to construct these genes.
They will be expressed in COS cells and their ability to recognize CD4 will be tested in the binding and blocking assays. The most desirable CDR--grafted antibody is the one with the fewest marine residues that is capable of recognizing CD4 with an affinity similar to that of marine OKT4A.
MODIFICATIONS TO THE CDR-GRAFTED LIGHT AND HEAVY CHAINS
Construct Residue Chanue* Total marine residues**
Light chain:
LCDR3 38 33,34,49,89 LCDR4 49 33,34,38,89 LCDR5 89 33,34,38,49 LCDR6 38,49,89 33,34 Heavy chain:
~ HCDR11 88,91 24,35,47,58,60 HCDR12 24,88,91 35,57,58,60 *Residues are denoted by their Kabat position number [2].
Noted residues will be changed from marine sequence to human sequence.
** Marine residues refer to residues in frameworks, not CDRs.
SUBSTITUTE SHEET
' CA 02046904 1999-12-06 6 PCT/GB90/02015 .
50 . ' Determination of Relative Binding Affinity The relative-binding affinities of CDR-grafted anti-CD4 monoclonal antibodies were determined-~y'competition binding [ 8 ] using the HPH-ALL human T cell :linewas., a source of CD4 antigen and fluorescein-conjugated marine OKT4A (F1-OKT4A) of known bindingaffinity :a:. ~a tracer antibody. The binding affinity~of ~1-ORT4A .tracer antibody was determined by.a direct~binding assay in which increasing amount of F1-OKT4A were incubated with HPB-ALL
(5 x 105) in PBS with 5~ fetal calf serum for '~60 min at 40~. Cells were washed, and the fluorescence -intensity was determined on a FACScari flow cytometer calibrated with quantative microbead stands (Flow Cytometry Standards, Research Triangle Park, NC). Florescence intensity per antibody molecule (F/P ratio) was determined by using microbeads which have a predetermined number of mouse IgG
antibody binding sites (Simply Cellular Beads; Flow Cytometry Standards). F/P equals the florescence intensity of beads saturated with F1-OKT4A divided by the number of binding sites per beads. The amount of bound and free F1-OKT4A was calculated from the mean fluorescence intensity per cell, and the ratio of bound/free was plotted against the number of moles of antibody bound. A linear fit was used to determine the affinity of binding (absolute value of the slope).
For competitive binding, increasing amounts of competitor antibody were added to a sub-saturating dose of Fl-OKT4A
and incubated with 5 x 105 HPB-ALL in 200 ~l of PBS with 5%
fetal calf serum for 60 min at 4C. The fluorescence intensities of the cells were measured on a FACScari flow cytometer calibrated with quantitative microbead standards. The concentrations of bound and free F1-OKT4A
were calculated. The affinities of competing antibodies were calculated.from the equation [X) -[ORT4A) _ (1/Kx) -(1/Ka), where Ka is the affinity of muting OKT4A, Kx is *Trade->zar. k SUBSTITUTE SHEET
WO 91/09966 PCT/GB90/0201~
51 r .-, .-. : ~ - v, ,, ...
n' the affinity of competitor X [ J is the concentration of -' competitor antibody at which bound/free binding is R/2, and R is the maximal bound/free binding.
Affinity Results The relative affinity constants of the humanized antibodies (Fig. 17, Table 3) were determined, and LCDR2 combined with HCDR10 retained 68% of the activity of the parent. LCDR2/HCDR5 (Table 1) retained only 13% of the murine antibody affinity. These results are in agreement with those obtained in blocking assays (Fig. 16a&b).
Comparison of HCDR5 with HCDR7 (Fig. 15) suggests that residue 60, while not critical for activity, is beneficial when converted to that in the donor sequence. In the same figure, the deleterious effect of the donor residue at position 44 can also be seen (HCDR4 vs. HCDRS).
Relative Affinity Constants of the CDR-grafted Antibodies Antibody Log conc. competitor Affinity Constant Constructs (pM) at 50% inhibition (Kx) Murine OKT4A 2.4 3 X 109 Chimeric OKT4A 2.9 1.1 x 109 LCDR2/HCDR10 2.6 2.1 x 109 LCDR2/HCDRS 3.4 0.4 x 109 ~Chimeric OKT3 No inhibition Murine OKT3 No inhibition Functional Studies It is believed that the CD4 antigen, which is recognised by OKT4A and its chimeric and GDR-grafted equivalents, is involved in the interactions whic?a~give rise to the SUSST~TUT~ SHEET
W~ 91/9966 CA 02046904 1999-12-06 p~~Gggp~02015 biological functions of T lymphocytes carrying the CD4 antigen. In particular, it is believed that the CD4 antigen is involved in the mixed lymphocyte reaction (MICR) and in the proliferation of peripheral blood mononuclear cells (PBMC) . In order to show that 'the _.CDR-grafted antibodies of the present invention are likely to have the same biological activity as murin~'DRT4Jl, the following functional studies were carried.out.-inhibition of MLR
Human PBMC were isolated by density gradient centrifugation with Ficoll*and resuspended in complete DMEM containing 1~ foetal calf serum (FCS). 2 x 105 responder PBMC and 1 x 105 irradiated (2 Mrad) allogeneic PBMC were added to each well of a 96 well tissue~culture plate, followed by serial dilutions of a purified anti-CD4 antibody. Cells were cultured for 6 days, pulsed with 3Fi thymidine for 24 hours and harvested. 3Fi-thymidine 2o incorporation was measured by liquid scintillation.
As a negative control, irradiated responder cells were used in place of the irradiated allogeneic PBMC and no antibody was added. As a positive control, the experiment was carried out without the addition of antibody. In the experiment, the antibodies used were murine OKT4A, chimeric OKT4A and the F(ab')2 fragment of murine OKT4A.
The results of the experiment are shown in Figure 18.
Both the chimeric OKT4A and the murine OKT4A showed similar inhibition of MLR.
Inhibition of Proliferation ' OKT3 (20 ng/ml), a murine MAb which recognises the CD3 antigen on T lymphocytes, vas immobilised on polystyrene 96 well tissue culture plates for d hours at 20~. The *Trade-r.~ark 'SUBSTITUTE SHEET
plates were washed ,three times with phosphate buffered saline (PBS) and 1 x 105 PMBC were added to each well.
Thereafter, serial dilutions of an anti-CD4 antibody were added. Cells were cultured for 72 hours, pulsed with 3H-thymidine for 24 hours and harvested. 3H-thymidine incorporation was measured by liquid scintillation.
As a negative control, proliferation was measured in the absence of both the OKT3 and anti-CD4 antibodies. As a positive control proliferation was measured in the presence of OKT3 alone. In this experiment, the antibodies used were marine OKT4A, chimeric OKT4A and the Flab°)Z fragment of marine OKT4A.
The results are given in Figure 19, which shows that chimeric OKT4A has substantially the same ability to inhibit proliferation as does marine OKT4A.
The above functional studies show that chimeric OKT4A has equivalent biological properties to marine OKT4A. Since the CDR-grafted anti-CD4 antibodies have substantially the same affinity for the CD4 antigen as the chimeric OKT4A
antibody and since the chimeric OKT4A antibody has the same constant domains as the CDR-grafted OKT4A antibodies, it can be expected that the CDR-grafted OKT4A antibodies will have the same biological functions as marine OKT4A
and will thus be of use in therapy.
l A number of different CDR-grafted OKT4A antibodies have been generated. Essentially, DNA encading the CDRs of the marine OKT4A heavy and light chains has been grafted onto the frameworks of the human heavy chain KOL and light chain REI antibody genes. These variable domains are ligated to the DNA encoding human kappa light chain and IgG4 heavy chain constant portion.' The resulting CDR-~suesT~TUTE s~E~r V1'O 91/09966 PCT/GB90/0201~
.. ~ ;~ ~; _ ~:
tr . ~ . . .. _: 54 grafted genes are expressed in COS-1 cells. Antibody secreted into the tissue culture media is collected, quantified by ELISA, and tested for its ability to bind to CD4 positive cells and to block the binding of murine OKT4A.
The initially designed CDR-grafted antibody was unable to interact with CD4. A number of modifications were made to the light chain where critical human framework residues in the REI sequence, identified by molecular modelling, were changed to the murine OKT4A residues. This new version of the light chain, LCDR2, was able to recognize the CD4 antigen. Similarly, a number of heavy chain human framework residues were changed to murine in various combinations to generate NCDR2 through HCDR10. Several of these heavy chains, in combination with LCDR2, competed well with the murine OKT4A antibody for CD4. Presently the CDR-grafted OKT4A of choice is the combination of LCDR2Q and HCDR10. Further versions of the light and heavy chains are currently being generated where framework residues that were previously switched to the murine residues are being changed back to human. These more humanized CDR-grafted antibodies will be tested for their ability to recognize CD4.
~SUBSTI'~UTE SHEET
WO 91/09966 PCT/GB90/0201~
F~ !s !~, .. . .. ._~
REFER ENCES
[1] Kabat et al., in Sequences of Proteins of Immun ological Interest, US Department of Health and Human Servi ces, 1987.
5 [2] Wu and Kabat, J. Exp. Med., 132, 211, 1970.
[3] Oi et al., PNAS-USA, 80, 825, 1983.
[4] Neuberger, EMBO J., _2, 1373, 1983.
[5] Ochi et al., PNAS-USA, ~Q, 6351, 1983.
[6] Verhoeyen et al., Science, X39, 1534, 1988.
10 [7] Reichmann et al., Nature, 332, 323, 1988.
[8] Queen et al., PNAS-USA, 86, 10029, 1989.
[9] Zoller and Smith, Nuc. Acids Res., ~, 6487, 1982.
[10] Norris et al., Nuc. Acids Res., 11, 5103, 1983.
15 [11] ZOller and Smith, DNA, 3, 479, 1984.
[12] Kramer et al., Nuc. Acids Res., 7~0, 6475, 1982.
[13] Mullis and Foloona, Meth. Enz., 155, 335, 1987.
[14] Higuchi et al., Nuc. Acids Res., 16, 7351, 1988.
[15] HO et al., Gene, 77, 51, 1989.
20 [16] Ho et al., in Engineering Hybridisation Restriction Genes without the Use of Restriction Enzymes:
Gene Splicing by Overlap Extension.
[17] Horton et al., Gene, 77, 61, 1989.
[18] Bolivar et al., Gene, ~,, 95, 1977.
25 [19] Chang et al., Nature, 7~5, 615, 1978.
[20] Itakura et al., Science, ~, 1056, 1978.
[21] Goedell et al., Nature, ,~,, 544, 1979.
[22] Goedell et al., Nuc. Acids Res., ~, 4057, 1980.
[23] Siebenlist et al., Cell, ~Q, 269, 1980.
30 , ~[24]Stinchcomb et al., Nature, ,~$~, 39, 1979.
[25] Kingsman et al., Gene, 7, 141, 1979.
[26] Tschemper et al., Gene, ~, 157, 1980.
[27] Jones, Genetics, 85, 12, 1977.
[28] Hitzeman et al., J. Biol. Chem., ~5 , 2073, 35 1980.
[29 ] Hess et al., J. Adv. Enzyme Reg., 7, 149, 1968.
[30 ] Holland et al., Biochemistry, ~7, 4900, 1978.
SUBSTITUTE SHEET
WO 91/099b6 PCT/GB90/02015 ,, 5 '.. n f~ ;~
:~.
.
E ; '. .. v __ . .
,.
[31] Kruse and'Patterson, in Tissue Culture, Academic Press, 1973.
[32] Fiers et al., Nature, 273, 113, 1978.
[33] Maniatis et al., in Molecular Cloning: A
Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1990.
[34] Scopes, in Protein Purification, Springer Verlag, NY, 1982.
[35] Lefkovite and Pernis, in Immunological Methods, Volumes I and II, Academic Press, NY, 1979 and 1981.
[36] Bernhard et al., in Leukocyte Typing, Springer Verlag, NY, 1984.
[37] Mack, in Remingtons Pharmaceutical Sciences, 16th ition, 1982.
Ed [38] Chirgwin et al., Biochemistry, ~,, 5294, 1979.
[39] Sanger et al., PNAS-USA, 74, 5463, 1977.
[40] Jones et al., Nature, 32~, 522, 1986.
[41] Whittle et al., Protein Engineering, ~, 499, 1987.
[42] Kozak et al., J. Mol. Biol., 196, 947, 1987.
[43] Birnboim and Doly, Nuc. Acids Res., ~4, 1513, 1979.
[44] Gluzman, Cell, 23, 175, 1981.
[45] Lopata et al., Nuc. Acids Res., ~4, 5707, 1984.
[46] Kunkel, PNAS-USA, ~?,, 488, 1985.
[47] Chotia and Lesk, J. Mol. Biol., 96, 4, 901, 1987.
[48] Baranov et al., Gene, ~, 2, 463, 1989.
~gUBSTITUTE SHEET
A comparison of the hypervariable regions, as determined by sequence analysis, and the CDRs, as determined by structural studies, shows that there is some, but not complete, correspondence between these regions.
In the present application, the term "antibody" is used to describe Igs or any fragments thereof, light chain or heavy chain monomers or dimers, and single chain antibodies, such as a single chain Fvs in which the heavy and light chain variable domains are joined by a peptide linker, whether natural or produced by recombinant DNA
technology or otherwise, provided that the antibody includes at least one antigen binding site. The remainder of the antibody need not comprise only Ig-derived protein sequences. For instance, a gene may be constructed in which a DNA sequence encoding part of a human Ig chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule. Thus, "antibody" encompasses hybrid antibodies (see below).
The abbreviation "MAb" is used to indicate a monoclonal antibody as produced by a hybridoma or derivative cell line.
The term "recombinant antibody'° is used to describe an antibody produced by a process involving the use of recombinant DNA technology.
The term "chimeric antibody" is used to describe an ~ 'antibody in which the variable domains as a whole are derived _rom an antibody from a first mammalian species 1 and have been fused onto at least one constant domain from an antibody from a different mammalian species.
The term "hybrid antibody" is used to describe a protein comprising at least the antigen binding portion of an Ig attached by peptide linkage to at Least part of another SU~STI'i'UTE SHEET
~'O 91/0996b pCT/GB90/02015 ~~ 'y' ~ ~ ~'~ 4 protein. It will be appreciated that certain skilled workers may also use the word '~chimeric" to describe such constructs, but in the present specification such constructs are referred to as hybrid antibodies and the term chimeric antibodies is used in the sense defined above.
The term "CDR-grafted antibody" is used to describe an antibody having at least one, and preferably two or three, of its CDRs in one or both of the variable domains derived from an antibody from a first species, the remaining Ig-derived parts of the antibody being derived from one or more different antibodies. The variable domains may be made by use of recombinant DNA technology or by peptide synthesis.
"Rxpression vector" includes vectors which are capable of expressing DNA sequences contained therein, i.e. the coding sequences are operably linked to other sequences capable of effecting their expression. A useful, but not always necessary (i.e. insect cells), element of an effective expression vector is a marker encoding sequence, i:e. a sequence encoding a vector sequence which results in a phenotypic property (e. g. neomycin resistance, methionine sulfoximine resistance or tryptophan prototrophy) of the cells containing the protein which permits those cells to be readily identified. In sum, "expression vector" is given a functional definition and zany DNA sequence which is capable of effecting expression 30~ of a specified contained DNA code is included in this term as it is applied to the specified sequence. As at present, such vectors are frequently in the form of plasmids. Thus "plasmid" and "expression vector" are often used interchangeably. However, the invention is intended to include such other forms of expression vectors , which serve equivalent functions and which may, from time ~SUSST~TUTE SHEET
WO 91 /09966 PC'T/GB90/0201 c~.., ,n;,, d ~:.~;:..;~a;;
.. ._ . _.
to time, become known in the art, including retroviruses, in vitro systems [48) and the like.
As stated previously, the DNA sequences will be expressed 5 in host cells after the sequences have been operably linked to (i.e. positioned to ensure the functioning of) an expression control sequence. These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
"Recombinant host cells" refers to cells which have been transformed with vectors constructed using recombinant DNA
techniques. By virtue of this transformation, the host cell is able to produce the desired product in useful quantities, rather than in lesser amounts, or more commonly, in less than detectable amounts, as one would expect to be produced by the untransformed host. The antibody of the present invention may be produced by a recombinant host cell in quantities useful to carry out additional experimentation or in commercial quantities such as about a kilogram or more:
In descriptions of processes for isolation of antibodies from recombinant hosts, the terms '°cell" and "cell culture" are used interchangeably to denote the source of antibody unless it is clearly specified otherwise. In other words, recovery of antibody from the "cells" may mean either from spun down whole cells, or from the cell ~ culture containing both the medium and the suspended cells, or, additionally, as is possible in the case of myeloma cell lines, from ascites culture.
Natural Igs have been used in assay, diagnosis and, to a more limited extent, therapy. However, such uses, especially in therapy, have been hindered by the polyclonal nature of natural Igs. ~A significant step SU~ST~TI.JTS SHEEP
V1'O 91 /09966 PC'T/G B90/OZ01 towards the realization of the potential of Igs as therapeutic agents was the discovery of techniques for the preparation of MAbs of defined specificity. MAbs are generally produced by fusions of rodent spleen cells with rodent myeloma cells, and thus are essentially rodent proteins. However, there are very few reports of the successful production of human MAbs.
A series of MAbs having specificities for antigens on T
lymphocytes and subsets of T lymphocytes is described in EP-A-0 017 381, EP-A-0 018 794, EP-A°0 019 195, EP-A-0 025 722, EP-A-0 030 450, EP-A-0 030 814 and EP-A-0 033 578.
Since most available MAbs are entirely of rodent origin, they are naturally antigenic in humans and thus can give rise to an undesirable immune response, such as one response termed the Human Anti-Mouse Antibody,(HAMA) response. Therefore, the use of rodent MAbs as therapeutic agents in humans is inherently limited by the fact that the human subject may mount an immunological response to the MAb and will either remove it entirely or at least reduce its effectiveness. Thus, in practice, MAbs of rodent origin are not generally recommended for use in patients for more than one or a few treatments, as a HAMA response may develop, rendering the MAb ineffective as well as giving rise to undesirable side reactions.
i Proposals have therefore been made to render non-human 30. . MAbs less antigenic in humans. Such techniques can be generically termed "humanization" techniques. These techniques generally involve the use of recombinant DNA
technology to manipulate DNA sequences encoding the polypeptide chains of the antibody molecule.
In recent years advances in molecular biology based on ~SUBST~TUTE SHEET
~'O 91/09966 PC'1'/GB90/0201~
s~ ;~ - n ~' ,,, ;..
i-:: l.' .. :> .:'~ ;, production of a wide range of heterologous polypeptides by transformation of host cells with heterologous DNA
sequences which code for the production of the desired products.
EP-A-0 088 994 (Schering Corporation) proposes the construction of recombinant DNA vectors comprising a ds DNA sequence which codes for the variable domain of a light or a heavy chain of an Ig specific for a l0 predetermined ligand. The ds DNA sequence is provided with initiation and termination codons at its 5'- and 3'-termini respectively but lacks any nucleotides coding for amino acids superfluous to the variable domain. The ds DNA sequence is used to transform bacterial cells. The application does not contemplate variations in the sequence of the variable domain.
EP-A-0 102 634 (Takeda Chemical Industries Limited) describes the cloning and expression in bacterial host organisms of genes coding for the whole or a part of a human IgE heavy chain polypeptide, but does not contemplate variations in the sequence of the polypeptide.
EP-A-0 125 023 (Genentech Inc.) proposes the use of recombinant DNA techniques in bacterial cells to produce Igs which are analagous to those normally found in vertebrate systems and to take advantage of the gene modification techniques proposed therein to construct chimeric antibodies or other modified forms of antibody.
It is believed that the proposals set out in the above Genentech application did not lead to the expression of any significant quantities of Ig polypeptide chains, nor to the production of Ig activity, nor to the secretion and assembly of the chains into the desired chimeric antibodies.
SUBSTITUTE SHEET
N'O 91/09966 PCT/G B90/0201~
S'' ' ~_. ~;iG
The recent emergence of techniques allowing the stable introduction of Ig gene DNA into mammalian cells [3] to [5) has opened up the possibility of using in vitro mutagenesis and DNA transfection to construct recombinant antibodies possessing novel properties.
However, it is known that the function of an antibody molecule is dependent on its three dimensional structure, which in turn is dependent on its primary amino acid sequence. Thus, changing the amino acid sequence of an antibody may adversely affect its activity. Moreover, a change in the DNA sequence coding for the antibody may affect the ability of the cell containing the DNA sequence to express, secrete or assemble the antibody.
It is therefore not at all clear that it will be possible to produce functional altered antibodies by recombinant DNA techniques. However, colleagues of the present inventors have devised a process whereby hybrid antibodies in which both parts of the protein are functional can be secreted. This process is disclosed in International Patent Application No. PCT/GB85/00392. However, the above PCT application only shows the production of hybrid antibodies in which complete variable domains are coded for by the first part of the DNA sequence. It does not show hybrid antibodies in which the sequence of the variable domain has been altered.
EP-A-0 239 400 describes a process in which the CDRs of a ~mousa MAb have been grafted onto the framework regions of the variable domains of a human Ig by site directed mutagenesis using long oligonucleotides. The inventors allude to the possibility of altering the natural amino acid sequence of the framework regions as well.
The earliest work on altering MAbs by CDR-grafting was carried out on MAbs recognizing syf~thetic antigens, such SUBSTITUTE SHEET
WO 9i/09966 PCT/G890/0201~
c, ;, , " " , . i E::: .~ __ ,~ .. _ ._ as the NP or NIP antigens. However, examples in which a , mouse MAb recognizing lysozyme and a rat MAb recognizing an antigen on human T-cells respectively were humanized by CDR-grafting have been described [6] and [7].
Reference [7] shows that transfer of the CDRs alone (as defined in that paper) was not sufficient to provide satisfactory antigen binding activity in the CDR-grafted product. Reference [7] shows that it was necessary to convert a serine residue at position 27 of the human sequence to the corresponding rat phenylalanine residue to obtain a CDR-grafted product having satisfactory antigen binding activity. This residue at position 27 of the heavy chain is within the structural loop adjacent to CDR1. A further construct which additionally contained a human serine to rat tyrosine change at position 30 of the heavy chain did not have a significantly altered binding activity over the CDR-grafted antibody with the serine to phenylalanine change at position 27 alone. These results indicate that, for CDR-grafted antibodies which recognize more complex antigens, changes to residues of the human sequence outside the CDR regions, in particular in the loop adjacent to CDR1, may be necessary to obtain effective antigen binding activity.
Techniques have also recently been described for altering an anti-TAC monoclonal antibody by CDR-grafting. Human framework regions were chosen to maximize homology with the anti-TAC antibody sequence, while several additional ~ amino acids outside the CDRs were retained. The anti-TAC
antibody so altered has an affinity for the p55 chain of human interleukin-2 of about one third that of marine anti-TAC [8].
PCT/US89/05857 also describes CDR-grafted antibodies which are specific for the p55 TAC protein of the IL-2 receptor.
It is therein stated that the CDR-grafted antibody may ~sues~ro~uTE sHE~
N'O 91 /09966 PCT/G 1390/0201 ,, ,~ n, ;°~ 1 Q
c~ ,1 ~ '..' '~..:
_ <,~ '.
require that 3 or more amino acid residues from the donor Ig in addition to the CDRs, usually at least one of which is immediately adjacent to a CDR in the danor Ig, be changed to correspond to that of the donor antibody in order to obtain antigen binding activity.
It is therefore readily apparent that it is not a simple matter to produce a CDR-grafted antibody. It is often not sufficient merely to graft the CDRs from a donor Ig.onto the framework regions from an acceptor Ig. It may also be necessary to alter residues in the framework regions of the acceptor antibody in order to obtain binding activity.
However, it is not possible to predict, on the basis of the available prior art, which, if any, framework residues will need to be altered.
EF-A-0 018 794 describes a murine MAb which recognises an antigen characteristic of human helper T cells. A
particular example of such an MAb is described in the application and is designated OKT~. The antigen it recognises is generally referred to as the CD4 antigen.
The MAb is commercially available from Ortho Diagnostic Systems Inc. of Raritan, New Jersey, USA. Also available from the same supplier is a murine MAb known as 0KT4A.
This recognises a different eptiope on the CD4 antigen from the one recognised by OKT4.
Transplantation experiments in primates have indicated that both OKT4 and OKT4A can extend graft survival and may . gibe useful as an immunomodulator in humans. Experience ' from the treatment of renal transplant patients with the 1 murine MfAb OKT3 has shown that sometimes a population of patients develops neutralizing antibodies to OKT3. This .
immune response precludes repeat administration. To diminish the anticipated immune response to murine anti-CD4 MAbs, it would be desirable to produce a CDR-grafted SUBSTITUTE SHEET
WO 91/09966 PCT/GB90/0201~
1 ~ ~ ' ' :', r, ~, '.' ':' _ version of OKT4A having murine CDRs and human framework and other Ig derived regions.
However, as described above, the simple approach to constructing a CDR-grafted antibody does not always result in an antibody which effectively binds the antigen. The exact residues which comprise the CDRs are difficult to define and do not necessarily correspond to all the residues in the hypervariable regions. There may also be critical framework residues which are important in positioning the CDRs for interaction with antigen or which are involved in interactions between-the heavy and light chains. It may be necessary to alter certain framework residues so that they correspond to the murine residues at these positions, rendering the CDR-grafted antibody less ''human°° in character.
Despite the problems which. are inherent in attempting to produce a specific CDR-grafted antibody, in a preferred embodiment the present inventors have succeeded in producing a CDR-grafted antibody based on human framework regions and having an antigen binding site which recognises the CD4 antigen. In certain particularly preferred embodiment, the CDR-grafted antibody has an affinity for the CD4 antigen similar to that of the murine MAb OKT4A.
Therefore, according to the present invention, there is provided a CDR-grafted antibody having at least one chain . wherein the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (donor), the CDR-grafted antibody being capable of binding to the CD4 antigen.
Preferably, the CDR-grafted chain has two and, most preferably, all three CDRs derived from the donor antibody.
SUBSTITUTE SHEET
W'O 91/09966 5a ,_ d~ p PCT/GB90/0201~
v !.S
Advanta eousl g y, in the CDR-grafted chain, the or each CDR
comprises a composite CDR comprising all the residues from the CDR and all the residues in the corresponding hypervariable region of the donor antibody.
Preferably, at least one residue in the framework regions of the CDR-grafted chain has been altered so that it corresponds to the equivalent residue in the antibody.
Preferably, the framework regions of the CDR-grafted chain are derived from a human antibody.
Advantageously, the framework regions of the CDR-grafted chain are derived from a human Ig heavy chain. For such heavy chains, it is preferred that residue 35 in the heavy chain framework regions be altered so that it corresponds to the equivalent residue in the donor antibody.
Advantageously, for such heavy chains, at least one composite CDR comprising residues 26 to 35, 50 to 65 or 95 to 102 respectively is grafted onto the human framework.
It will be appreciated in this case that residue 35 will already correspond to the equivalent residue in the donor antibody.
Preferably, residues 23, 24 and 49 in such heavy chains correspond to the equivalent residues in the antibody. It is more preferred that residues 6, 23, 24, 48 and 49 in such heavy chains correspond to the donor antibody in . equivalent residue positions. If desired, residues 71, 73 and 79 can also so correspond.
To further optimise affinity, any one or any combination of residues 57, 58, 60, 88 and 91 may correspond to the equivalent residue in the donor antibody.
SUBSTITUTE SHEET
W'O 91 /09966 PCT/G B90/0201 s (, ~. n ~. ; -7 ~-. ~ .7 ,,. ..,...- :.;
1:. '._ . .. _ ' The heavy chain is preferably derived from the human KOL
heavy chain. However, it may also be derived from the human NEWM or EU heavy chain.
Alternatively, the framework regions of the CDR-grafted chain may be derived from a human kappa or lambda light chain. For such a light chain, advantageously at least one composite CDR comprising residues 24 to 39, 50 to 56 or 89 to 97 respectively is grafted onto the human framework. Preferably, residue 49 also corresponds to the equivalent residue in the donor antibody.
To further optimise affinity, it is preferable to ensure that residues 49 and 89 correspond to the equivalent residues in the donor antibody. It may also be desirable to select equivalent donor residues that form salt bridges.
The light chain is preferably derived from the human REI
light chain. However, it may also be derived from the human EU light chain.
Preferably, the CDR-grafted antibody of the present invention comprises a light chain and.a heavy chain, one or, preferably, both of which have been CDR-grafted in accordance with the principles set out above for the individual light and heavy chains.
In the preferred case, it is advantageous that all three ~ ~CDRs on the heavy chain are altered and that minimal ~ alteration is made to the light chain. It may be possible to alter none, one or two of the light chain CDRs and still retain binding affinity at a reasonable level.
It will be appreciated that in some cases, for both heavy and light chains, the donor and acceptor residues may be SUBSTITUTE SHEET
~1'O 91 /09966 pC'T/G)390/0201 :~ _ ..
identical at a particular position and thus no change of acceptor framework residue will be required.
It will also be appreciated that in order to retain as far as possible the human nature of the CDR-grafted antibody, as few residue changes as possible should be made. It is envisaged that in many cases, it will not be necessary to change more than the CDRs and a small number of framework residues. Only in exceptional cases will it be necessary to change a larger number of framework residues.
Preferably, the CDR-grafted antibody.is a complete Ig, for example of isotype IgG~ or IgG'.
If desired, one or more residues in the constant domains of the Ig may be altered in order to alter the effector functions of the constant domains.
Preferably, the CDR-grafted antibody has an affinity for the CD4 antigen of between about 105.M-~ to about 10 ~z.M'~, more preferably at least l0a.Ml. and most preferably the affinity is similar to that of MAb OKT4 or OKT4A.
Advantageously, the or each CDR is derived from a mammalian antibody and preferably is derived from a murine MAb.
Advantageously, the CDR-grafted antibody of the present invention is produced by use of recombinant DNA
~ ' technology.
1 According to a second aspect of the present invention, there is provided a method for producing a CDR-grafted antibody according to the first aspect of the present invention, which method comprises:
providing a first DNA sequence, encoding a first antibody chain in which the framework regioP~s axe predominantly SUBSTITUTE SHEET
WO 91/09966 PCT/G B90/0201~
c~,~ ~ ~~~:?
v F:: ';, __ . , .. _ _..
derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (acceptor), under the control of suitable upstream and downstream elements;
transforming a host cell with the first DNA sequence; and 5 culturing the transformed host cell so that a CDR-grafted antibody according to the first aspect of the invention is produced.
Preferably, the method further comprises:
10 providing a second DNA sequence, encoding a second antibody chain complementary to the first chain, under the control of suitable upstream and downstream elements; and transforming the host cell with both the first and second DNA sequences.
Advantageously, the second DNA sequence encodes a second antibody chain in which the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from the second antibody (donor).
The first and second DNA sequences may be present on the same vector. In this case, the sequences may be under the control of the same or different upstream and/or downstream elements.
Alternatively, the first and second DNA sequences may be present on different vectors.
' ~ According to a third aspect of the present invention, there is provided a nucleotide sequence which encodes an antibody chain in which the framework regions are predominantly derived from a first antibody (acceptor) and at least one CDR is derived from a second antibody (donor), the antibody chain being capable of forming a CDR-grafted antibody according to the first aspect of the present invention.
~StJSSTI'~l)TE SHEET
~f'O 91 /09966 pCT/G B90/0201 b : .. . r : , ,. :, ..~' 16 ., . ~ _.
It is envisaged that the CDR-grafted antibodies of the present invention will be of particular use in therapy, in particular in treating graft rejections or in treating helper T cell disorders.
The CDR-grafted antibodies of the present invention may be produced by a variety of techniques, with expression in transfected cells, such as yeast, insect, CHO or myeloma cells, being preferred. Most preferably, the host cell is a CHO host cell.
To design a CDR-grafted antibody, it is first necessary to ascertain the variable domain sequence of an antibody having the desired binding properties. Suitable source cells for such DNA sequences include avian, mammalian or other vertebrate sources such as chickens, mice, rats and rabbits, and preferably mice. The variable domain sequences (VH and V~) may be determined from heavy and light chain cDNA, synthesized from the respective mRNA by techniques generally known to the art. The hypervariable regions may then be determined using the Kabat method [2].
The CDRs may be determined by structural analysis using X-ray crystallography or molecular modelling techniques. A
composite CDR may then be defined as-containing all the residues in one CDR and all the residues in the corresponding hypervariable region. These composite CDRs along with certain select residues from the framework region are preferably transferred as the "antigen binding sites", while the remainder of the antibody, such as the ~ heavy and light chain constant domains and remaining . framework regions, may be based on human antibodies of different classes. Constant domains may be selected to have desired effector functions appropriate to the intended use of the antibody so constructed. For example, human IgG isotypes, IgG~ and IgG3 are effective for complement fixation and cell mediated lysis. For other SUBSTITUTE SHEET
v purposes other isotypes, such as IgG2 and IgG', or other classes, such as IgM and IgE, may be more suitable.
For human therapy, it is particularly desirable to use human isotypes, to minimize antiglobulin responses during therapy. Human constant domain DNA sequences, preferably in conjunction with their variable domain framework bases can be prepared in accordance with well-known procedures.
An example of this is CAMPATH 1H available from Burroughs Wellcome Ltd.
In accordance with preferred embodiments of the present invention, certain CDR-grafted antibodies are provided which contain select alterations to the human-like framework region (in other words, outside of the CDRs of the variable domains), resulting in a CDR-grafted antibody with satisfactory binding affinity. Such binding affinity is preferably from about lOS.M'~ to about 10~2.M'~ and is more preferably at least about lOa.M'~. Most preferably the binding affinity is about equal to that of marine MAb OKT4A.
In constructing the CDR-grafted antibodies of the present invention, the VH and/or V~ gene segments may be altered by mutagenesis. One skilled in the art will also understand that various other nucleotides coding for amino acid residues or sequences contained in the Fc portion or other areas of the antibody may be altered in like manner (see, for example, PCT/US89/00297).
Exemplary techniques include the addition, deletion or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, provided that the proper reading frame is maintained.
SUB~iTU'~E SHEET
W'O 91/09966 PCT/GB90/0201~
;, c~ % ~, .
Substitutions, deletions, insertions or any subcombination may be used to arrive at a final construct. Since there are 64 possible codon sequences but only twenty known amino acids, the genetic code is degenerate in the sense that different codons may yield the same amino acid.
However, the code is precise for each amino acid. Thus there is at least one codon for each amino acid, i.e. each codon yields a single amino acid and no other. It will be apparent that during translation, the proper reading frame must be maintained in order to obtain the proper amino acid sequence in the polypeptide ultimately produced.
Techniques for additions, deletions or substitutions at predetermined amino acid sites having a known sequence are well known. Exemplary techniques include oligonucleotide-mediated site-directed mutagenesis and the polymerase chain reaction.
Oligonucleotide site-directed mutagenesis in essence involves hybridizing an oligonucleotide coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the single strand as a template for extension of the oligonucleotide to produce a strand containing the mutation. This technique, in various forms, is described in references [9] to [12].
Polymerase chain reaction (PCR) in essence involves exponentially amplifying DNA in vitro using sequence specific oligonucleotides. The oligonucleotides can 30., incorporate sequence alterations if desired. The ' polymerase chain reaction technique is described in reference [13]. Examples of mutagenesis using PCR are described in references [14] to [17].
The nucleotide sequences of the present invention, capable of ultimately expressing the desired CDR-grafted antibodies, can be formed from a variety of different SUBSTITUTE SHEEN' WO 91/09966 P~CT/GB90/0201:
c/nr~;:'an"'~ j v , polynucleotides (genomic DNA, cDNA, ~2NA or synthetic oligonucleotides). At present, it is preferred that the polynucleotide sequence comprises a fusion of cDNA and genomic DNA. The polynucleotide sequence may encode various Ig components (e. g. V, J, D, and C domains). They may be constructed by a variety of different techniques.
Joining appropriate genomic and cDNA sequences is presently the most common method of production, but cDNA
sequences may also be utilized (see EP-A-0 239 400 and [7J).
Certain suitable expression vectors and host cells are described in US-A-4 816 567.
The vectors and methods disclosed herein are suitable for use in host cells over a wide range of prokaryotic and eukaryotic organisms.
In general, of course, prokaryotes are preferred for cloning of DNA sequences for constructing the vectors useful in the invention. For example, E. coli DH5a is particularly useful. This example is, of course, intended to be illustrative rather than limiting.
Prokaryotes may also be used for expression. The aforementioned E. Coli strains, bacilli such as Bacillus subtilus, and other enterobacteriaceae, such as Salmonella typhimurium or Serratia marcesans, and various Pseudomonas species may be used.
30, In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site as well as marking sequences which are capable of providing phenotypic selection in transformed cells. For example, E. Coli is typically transformed using one of the ~~E~'ITIJTE SHEET
~ O 91 /(?9966 PCT/(y B90/0201 n '": '' ' ~ ~ _ ..
many derivatives of pBR322, a plasmid derived from an E.
Coli species [18]. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, 5 its descendents or other microbial plasmids may also contain, or be modified to contain, promoters which can be used by the microbial organism for the expression of recombinant proteins. Those promoters commonly used in recombinant 'DNA construction include lactose promoter 10 systems [19] to [21] and tryptophan (trp) promoter systems [22] and EP-A-0 036 776. While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling a 15 skilled worker to ligate them functionally into plasmid vectors [23].
In addition to prokaryotes, eukaryotic microbes, such as yeast cultures, may also be used. Saccharomyces 20 cerevisiae, or common baker°s yeast, is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, [24] to [26]
is commonly used. This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 [27]. The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for ~ ~datecting transformation by growth in the absence of tryptophan.
Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase [28] or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, suB~oTUTS sHE~'~' « 'O 91/09966 PCT/G 890/0201 c : .-. -21 ~:% '...- ... .. ' _ ....
v , glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase [29] and [30]. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and .termination. Other promoters, which have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, an enzyme responsible for maltose and galactose utilization [30].
Any plasmid vector containing a yeast compatible promoter, origin of replication and termination sequences is suitable.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts.
In principle, any such cell culture is workable, whether from a vertebrate or an invertebrate organism. However, to date, interest has been greatest in vertebrate cells, and propogation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [31]. Examples of such useful host cell lines are VERO, HeLa, Chinese hamster ovary (CHO), W138, BHK, COS-7, MDCK
and myeloma cell lines. Expression vectors for such cells may include (if necessary) an appropriate origin of ' ~ replication, as well as a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation sites and transcriptional terminator sequences.
For use in mammalian cells, the control functions on the expression vectors are often provided by viral material.
For example, commonly used promoters are derived from ~SUgSTITUTE SHEET
V1'O 91/09966 PCT/GB90/0201:
.. 2 2 v , human Cytomegalovirus (HCMV), Polyoma virus, Adenovirus 2 and, most frequently, Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (32]. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell system.
An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e. g.
Polyoma virus, Adeno virus, VSV or BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
The vectors containing the DNA segments of interest (e. g.
the heavy and light chain encoding sequences and expression control sequences) can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, lipofection or electroporation may be used for other cellular hosts (33].
. Once expressed, the CDR-grafted antibodies of the present ,.invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography and gel electrophoresis (34]. Binding affinities of the constructs so expressed may be ascertained by techniques known to the art, as more fully exemplified in the example section of this specification.
SUBSTITUTE SHEET
2 3 s; ~ ,' n .°, , ., YR ;~i ... . :.J '_' -S
Substantiall ure,CDR
y p -grafted antibodies of at least 90 to 95~ homogeneity are preferred, and 98 to 99~ or more homogeneity is most preferred for pharmaceutical uses.
Once purified, partially or to homogeneity as desired, the CDR-grafted antibodies may then be used diagnostically or therapeutically (including extracorporeally) or in developing and performing assay procedures, immunofluorescent stainings and the like [35].
l0 The CDR-grafted antibodies of the present invention will typically find use in treating T-cell mediated disorders.
For example, typical disease states suitable for treatment include graft versus host disease and transplant rejection in patients undergoing an organ, such as heart, lung, kidney or liver, transplant, Other diseases include autoimmune diseases, such as Type I diabetes, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus and myasthenia gravis.
T cells are clonal expansions from single cells expressing only one T sell antigen receptor capable of recognizing a peptide bound to a specific HLA, molecule on specialized antigen presenting cells, such as a macrophages, and on other tissues. The activation of these T cells can be blocked by antibodies recognizing the T cell receptor complex or the peptide-HLA complex. OKT3 recognizes the CD3 molecule which is comprised of several subunits physically complexed with the T cell receptor. Several other molecules on the T cell, including the CD4 and CDS
~ ' molecules, are also involved in T cell activation by binding to the HLA molecules at sites that are distinct from the T cell receptor binding site.
CD4 is found on the subpopulation of T cells with T cell receptors that recognize HLA class II molecules.
Therefore, one approach to immunosuppression involves the use of monoclonal antibodies, such'as OKT4 or OKT4A that ~5UB5TITU?E SHEET
W'O 91/09966 PCT/GB90/0201~
v , ~ , are immunosuppressive because they inhibit the interaction of the CD4 molecule with the HLA class II molecule.
Antibody binding to CD4 can result in immunosuppression by a number of mechanisms including the inhibition of a normal activation signal, the triggering of a down regulation signal pathway, or modulating this receptor from the cell surface. It could also induce a subpopulation of T cells capable of suppressing other alloreactive or autoreactive subpopulations. Anti-CD4 antibodies may also act by inducing complement or antibody-dependent T cell lysis or by removal of the T
cells from the blood stream or site of inflammation.
Therefore the Fc-recptor binding characteristics of each antibody may be important to their function. Alternative strategies include the use of anti-CD4 antibodies that have been radiolabeled or coupled to toxins.
These immunosuppressive properties of these anti-CD4 antibodies provide a therapeutic use in the suppression of activated T lymphocytes that mediate the diseases associated with transplanation and autoimmunity. The CD4 molecule is also the receptor for the gp120 subunit of the HIV virus. Since OKT4A inhibits the binding of gp120 to CD4, this antibody or fragments thereof may block viral infection.
The CD4 molecule is normally involved in providing a co-stimulatory signal to the T cell as a result of its binding to the HLA class II molecule. Therefore it is ~ also possible that anti-CD4 antibodies can provide a co-stimulatory function in combination with other signal inducing reagents. This therapeutic strategy may be useful in the treatment of immunocompromised patients.
The CDR-grafted antibodies of the present invention may also be used in combination with other antibodies, particularly MAbs reactive with otfier markers on human sussTe~uT~ sH~~' E~ ,.
:; :..
... ~ :_ cells responsible for the diseases. For'example, suitable T-cell markers can include those grouped into the so-called "Clusters of Differentiation," as named by the First International Leukocyte Differentiation Workshop 5 [36].
Generally, the present CDR-grafted antibodies will be utilized in purified form together with pharmacologically appropriate carriers. Typically, these carriers include 10 aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer°s. Suitable physiologically acceptable 15 adjuvants, if necessary to keep the complex in suspension, may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates.
20 Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, can also be present [37].
The CDR-grafted antibodies of the present invention may be used as separately administered compositions or ~n conjunction with other agents. These can include various immunotherapeutic drugs, such as cyclosporine, ~ ~ methotrexate, adriamycin or cisplatinum, and immunotoxins.
Pharmaceutical compositions can include "cocktails°' of various cytotoxic or other agents in conjunction with the CDR-grafted antibodies of the present invention, or even combinations of CDR-grafted antibodies according to the present invention and CDR-grafted antibodies having different specificities.
~SUBSTiTUTE SHEET
dfO 9x/09966 PCT/GB90/0201~
a :~.~a ,...
~~', '~~ ''i ' 2 6 The route of administration of pharmaceutical compositions according to the invention may be any of those commanly known to those of ordinary skill in the art. For therapy, including without limitation immunotherapy, the CDR-grafted antibodies of the invention can be administered to any patient in accordance with standard techniques. The administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, or also, appropriately, by direct infusion with a catheter. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter indications and other parameters to be taken into account by the clinician.
The CDR-grafted antibodies of this invention can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective with conventional immunoglobulins and art-known lyophilization and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilization and reconstitution can lead to varying degrees of antibody activity loss (e. g. with conventional immunoglobulins, IgM antibodies tend to have greater activity loss than IgG antibodies) and that use levels may have to be adjusted to compensate.
The compositions containing the present CDR-grafted antibodies or a cocktail thereof can be administered for . prophylactic and/or therapeutic treatments. In certain ' therapeutic applications, an adequate amount to accomplish at least partial inhibition or killing of a population of selected cells is defined as a "therapeutically-effective dose". Amounts needed to achieve this dosage will depend upon the severity of the disease and the general state of the patient's own immune system, but generally range from 0.005 to 5.0 mg of CDR-grafted antibody per kilogram of SUBSTITUTE SHEET
WO 91 /09966 PCT/G>390/0201 2 7 c~. ., ~ ,., ~, G:. .~ ... . ': ., .> ' body weight, with doses of 0.05 to 2.0 mg/kg/dose being more commonly used. For prophylactic applications, compositions containing the present CDR-grafted antibody or cocktails thereof may also be administered in similar or slightly lower dosages.
A composition containing a CDR-grafted antibody according to the present invention may be utilized in prophylactic and therapeutic settings to aid in the alteration, inactivation, killing or removal of a select T cell target population in a mammal.
In another embodiment, the constructs described herein may be used extracorporeally or in vitr~ selectively to kill, deplete or otherwise effectively remove the target cell population from a heterogenous collection of cells. Blood from the mammal may be combined extracorporeally with the CDR-grafted antibodies whereby the undesired cells are killed or otherwise removed from the blood for return to the mammal in accordance with standard techniques.
In addition to the therapeutic uses, the CDR-grafted antibodies will find use in diagnostic assays. The CDR-grafted antibodies may be labelled in accordance with techniques known to the art. The CDR-grafted antibodies are also suitable for other in vivo purposes. For example, the CDR-grafted antibodies can be used for selective cell treatment of peripheral blood cells where it is desired to eliminate only target T lymphocytes or ~ similarly in cell culture to eliminate unwanted T
lymphocytes.
The present invention is now described, by way of example only, with reference to the accompanying drawings, in which;
~SUBST!'fUTE SHEET
WO 9l/09966 PCT/G B90/0201~
1 !~ 2~ ~ i 4~.
-~ 2 8 v , Figure 1 depicts the nucleotide sequence of the OKT4A
heavy chain variable domain;
Figure 2 depicts the nucleotide sequence of the OKT4A
light chain variable domain;
Figure 3 depicts the OKT4A heavy chain variable domain amino acid sequence in which the CDRs are underlined;
Figure 4 depicts the OKT4A light chain variable domain amino acid sequence in which the CDRs are underlined;
Figure 5 depicts the alignment of KOL with the OKT4A CDR
grafted heavy chain amino acid sequence in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
Figure 6 depicts the alignment of REI with the OKT4A CDR
grafted light chain amino acid sequence in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
Figure 7 depicts the DNA sequence and amino acid translation of a GDR-grafted heavy chain;
Figure 8 depicts the DNA sequence and amino acid translation of a CDR-grafted light chain;
Figure 9 depicts the construction of a CDR-grafted OKT4A
. heavy chain expression vector;
Figure 10 depicts binding and blocking assays of CDR-grafted OKT4A light chain constructs in combination'with a chimeric OKT4A heavy chain;
SUESTiTUTE SHEET
WO 91/09966 PCT/GB90/0201~
r .. ,., .3 ~" . . ... .i : ~ _ Figure 11 depicts binding and blocking assays of the OKT4A
heavy chain constructs, HCDR1, HCDR2 and HCDR3, in combination with OKT4A light chain;
Figure 12 depicts the alignment of REI with the CDR-grafted OKT4A light chains, LCDR1 and LCDR2, and the murine OKT4A light chain amino acid sequences in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
to Figure 13 depicts the alignment of KOL with the CDR-grafted OKT4A heavy chains, HCDR1 through HCDR10, and the murine OKT4A heavy chain amino acid sequences in which the CDRs are underlined, human sequences are in upper case and murine sequences are in lower case;
Figure 14 depicts binding and blocking assays of the CDR-grafted heavy chain constructs, HCDR1, HCDR2 and HCDR3 in combination with the CDR-grafted light chain LCDR2;
Figure 15 depicts binding and blocking assays of the CDR-grafted heavy chain constructs HCDR4 through HCDR10 in combination with the light chain LCDR2;
Figure 16 (A&13) depicts blocking assays of the OKT4A heavy chain constructs HCDR5, HCDR6, and HCDR10 in combination with light chain constructs LCDR2, LCDR3, LCDR2Q, LCDR3Q, and LCDR4Q, and the chimeric form of OKT4A;
Figure 17 depicts relative affinity assays of the OKT4A
~ ' heavy chain constructs HCDR5 and HCDR10 in combination with light chain construct LCDR2 and the chimeric and murine forms of OKT4A using the murine and chimeric forms of OKT3 as negative controls;
Figure 1B depicts the results of studies on inhibition of MLR by various antibodies using T6 as negative control;
and ~SUSSTI~'UTE SHEE°f 1V0 91/09966 PCT/GB90/0201~
,. r 3~. ~ " E' .z'~ '~ 4:"~ ' . . 3 0 ..
.y Figure 19 depicts the results of studies on inhibition of proliferation by various antibodies.
Humanization of OKT4A
OKT4A is a marine monoclonal antibody which recognizes the CD4 antigen located primarily on helper T lymphocytes.
CDR-grafted antibodies have been constructed in which the CDRs of the variable domains of both heavy and light chains were derived from the marine OKT4A sequence. The variable domain frameworks and constant domains were derived from human antibody sequences.
The three CDRs that lie on both heavy and light chains are composed of those residues which structural studies have shown to be involved in antigen binding. Theoretically, if the CDRs of the marine OKT4A antibody were grafted onto human frameworks to form a CDR-grafted variable domain, and this variable domain were attached to human constant domains, the resulting CDR-grafted antibody would essentially be a human antibody with the specificity of marine OKT4A to bind the human CD4 antigen. Given the highly "human°° nature of this antibody, it would be expected to be far less immunogenic than marine OKT4 when administered to patients.
Following testing for antigen binding of a CDR-grafted OKT4A antibody in which only the CDRs were grafted onto the human framework, it was shown that this did not ~ produce a CDR-grafted antibody having reasonable affinity for the CD4 antigen. It was therefore decided that additional residues adjacent to some of the CDRs and critical framework residues needed to be switched from the human to the corresponding marine OKT4A residues in order to generate a functional antibody.
SUBSTITUTE ShISE'T
WO 91/09966 PCT/G B90/0201~
31 ~3 ~; ;.n a, , a ,: _ ._ Isolation of the OKT4A heavy- and light chain cDNA and DNA
sequence analysis of the variable domain.
To design the CDR-grafted OKT4A antibody, it was first necessary to determine the sequence of the variable domain of the murine OKT4A heavy and light chains. The sequence was determined from heavy and light chain cDNA that had been synthesized from the respective mRNA.
mRNA was prepared from OKT4A-producing hybridoma cells by guanidinium thiocyanate extraction followed by cesium chloride gradient purification [38].- cDNA.was synthesized and libraries were prepared and screened in Dr. J. Rosen's laboratory at The R.W. Johnson Pharmaceutical Research Institute in La Jolla, California. cDNA was synthesized from the mRNA, EcoRI linkers were added, and it was then ligated into the EcoRI site of the lgti0 cloning vector.
The recombinant phage was packaged into infectious particles which were used to infect E. Coli 0600.
This library was screened for OKT4A heavy chain sequences using oligonucleotide probes Cg and FR3. Cg (the mRNA
sequencing primer from Pharmacia LKB Biotechnologies, Inc) has the sequence 5' GGCCAGTGGATAGAC 3' and binds to the murine IgG constant domain. Probe FR3 has the sequence 5' GGCCGTGTCCTCAGACCT 3' and binds to the third framework region of the variable ~ domain of murine heavy chains. Five positive clones were evaluated by southern transfer and hybridization to probes . Cg, FR3 and a cDNA to mouse IgG2a CH3. A single clone with a 1600 by EcoRI insert which hybridized to all three probes was selected.
~gUBSTITUTE SHEET
~~'O 91/09966 PCT/GB90/02015 .~ : . ~ ~ ~; I:'.
' ' The library was screened for the OKT4A light chain sequence using an oligonucleotide probe Ck (the mRNA
sequencing primer from Pharmacia) with a sequence of 5' GGCTCCAGGTTGCTGATGCTGAAGG 3' and which binds to the mouse kappa constant domain. Six positive clones were further assessed by southern transfer and hybridization to oligonucleotide probes T4AK, whose sequence is 5' GGCTCCAGGTTGCTGATGCTGAAGG 3' l0 and which binds to mouse kappa chain framework region 3, and Ck. A single clone which contained a 900 by EcoRI
insert and hybridized to both probes was chosen.
The 1600 by heavy chain cDNA was subcloned into the EcoRI
sites of the pBluescript plasmid vector (Stratagene Cloning Systems) and the M13mp8 sequencing vector (Pharmacia LKB Biotechnologies, Inc). The 900 by light chain cDNA was subcloned into the EcoRI sites of the plasmid vector pUC8 (Pharmacia LKB Biotechnologies, Inc) and the M13mp19 sequencing vector.
The dideoxy-nucleotide chain termination method of DNA
sequence analysis [39) was used to determine sequence of both single-stranded (M13) and double-stranded (plasmid) templates. The sequence of the 5' untranslated regions, signal sequences, variable domains and a portion of the constant domains were determined for both heavy and light chain cDNA. The DNA sequence for heavy and light chains is illustrated in Figures 1 and 2. The amino acid . ~ translation of the heavy chain variable domain sequence is - presented in Figure 3. A translation of the light chain . variable domain is presented in Figure 4.
It is to be noted that the nucleotide sequence given for the light chain has an A residue at position 163, towards the beginning of the CDR1 coding sequence (see Figure 2).
SUBSTITUTE SHEET
~'O 91 /09966 PCT/G1390/0201 33 ~n .~,~, ~i~. 7.; -.. ~ , Translation of this sequence gives a glutamine residue at~
position 27 in the light chain (see Figure 4).
When the sequencing of the OKT4 light chain was originally carried out, nucleotide residue 163 was thought to be a C
residue, giving a proline residue at position 27 in the light chain. The first CDR-grafted antibodies produced by the present inventors were constructed on the assumption that light chain residue 27 was a proline residue. This can be seen from Figures 6, 8 and 12.
Desicrn of the CDR-cLafted OKT~A Antibody To design the CDR-grafted OKT4A antibody, it was necessary to determine which residues of murine OKT4A comprise the CDRs of the light and heavy chains. Examination of antibody X-ray crystal structures shows the antigen binding surface to be located on a series of three loops extending from the b-barrel framework of the variable domain. These loops can thus be used to define the CDRs.
Since the crystal structure of murine OKT4A is not available, the structure of a similar murine antibody of known crystal structure was used to define the residues of the loops.
Three regions of hypervariability amid the less variable framework sequences are found on both light and heavy chains [2]. In most cases these hypervariable regions correspond to, but may extend beyond, the CDRs. It was ~ ' decided that a combination of those murine OKT4A residues in the CDRs and those in the hypervariable regions would 1 comprise composite CDRs to be grafted onto the human antibody framework. The amino acid sequences of the murine OKT4A heavy and light chains are presented in Figures 3 and 4, with the selected composite CDRs underlined.
StJESTITUTE SHEET
W'O 91 /09966 ;s , ;~ ,~ ; ~; °, PCT/G B90/0201 c;.
' ' The human antibody framework sequence for the heavy chain is that of the human antibody KOL. KOL was chosen because its X-ray crystallographic structure had been determined to a high degree of resolution. This should allow for accurate molecular modelling of the antibody. For the same reason, the framework sequence of the human light chain dimer, REI, was used for the light chain frameworks.
The amino acid sequences of KOL arid REI are shown in Figures 5 and 6 in comparison to those of the CDR--grafted OKT4A heavy (HCDR1) and light (LCDR1) chain variable domains.
The CDR-grafted heavy chain was designed to have a human IgG4 constant portion. The IgG4 subclass was selected based on experience with the murine anti-CD3 monoclonal antibody, OKT3, which is used to treat renal graft rejection. OKT3 has a murine IgG2a isotype and does not fix complement in humans. The human IgG4 isotype also does not fix complement. The CDR-grafted OKT4A light chain was constructed with the human kappa constant domain.
Construction of the CDR-crafted OKT4A Qenes Heavy and light chain CDR-grafted variable domains were constructed by the ligation of synthetic double-stranded DNA oligomers, similar to the method employed in [40].
The 5' end of the variable domains contain signal sequences of the light and heavy chains of the murine . monoclonal antibody B72.3 [41]. The signal sequence directs secretion of the antibody from mammalian cells. A
. Kazak sequence [42] immediately precedes the AUG start codon to enhance translation. The variable domains~were then ligated to DNA coding for.the human constant domains to create the CDR-grafted heavy and light chain genes.
CDR-Grafted OKT4A Heav~r Chain Construction SUBSTITUTE SHEET
WO 91/09966 PCT/l;B90/02015 ' '' :v f. ,..
Eight complementary pairs of oligomers, approximately 30 by in length were designed to have overlapping ends and to span the variable domain from a XhoI site located in framework 2 to a HindIII site at the beginning of the 5 first constant domain. These eight oligomer pairs were synthesized, ligated together in a step-wise manner and then ligated to the HindIII 5' end of the human IgG4 constant domain DNA. The IgG4 DNA was provided by Celltech, Ltd (Slough, U. K.) as genomic DNA. It is a 10 2153bp insert in an M13 phage DNA vector with a 5' EcoRI
and a 3' BamHI restriction site. The CH1, hinge, CH2 and CH3 domains are surrounded by four introns. The gene was modified by Celltech to have a C to A change at the penultimate base of the CH1 axon to create a new HindIII
15 site for CDR-grafted gene construction purposes.
The 5° end of the variable domain was constructed by ligating two complementary pairs of synthetic oligomers, each approximately 90bp in length. This fragment, which 20 had a 5' EcoRT end and a 3' XhoI end was ligated to the XhoI end of the fragment described above to yield the complete CDR-grafted heavy chain gene. This gene is 2364bp in length and has a 5' EcoRI end and a 3' BamHI
end. The DNA sequence with amino acid translation of the 25 gene is shown in Figure 7. The regions of interest, defined by nucleotide number are:
SUBSTITUTE SHEET
A
~'a n "~ ,, r; '.'1 :., i i.~-G. _ ..
1 - 14 EcoRI site and Kozak sequence 15 - 71 signal sequence 72 - 146 framework 1 177 - 218 framework 2 255 - 362 framework 3 393 - 431 framework 4 432 - 727 CH1 domain 728 - 1117 intron 118 - 1153 hinge domain 1154 - 1271 intron 1272 - 1599 CH2 domain 1600 - 1698 intron 1699 - 2016 CH3 domain 2017 - 2366 3' untranslated region CDR-drafted light chain giene construction Twelve complementary pairs of synthetic oligomers with overlapping ends were ligated simultaneously to assemble the CDR-grafted light chain variable domain. This fragment had a 5' EcoRI end and a 3' NarI end. This was ligated to the 5' NarI end of the human kappa constant domain DNA. Human kappa constant cDNA was modified by Celltech to include a NarI restriction site in the third and fourth codons. The resulting CDR-grafted light chain 'gene was 754bp in length and had EcoRI ends. The DNA
sequence with amino acid translation is shown in Figure 8.
The regions of interest defined by nucleotide number are:
SUBS'TITU'tE SHEET
WO 91/09966 PC'T/GB90/0201~
3 7 ~ ~, ', y , ,- r, :4i 1 8 EcoRI site and Kozak sequence 9 - 68 signal sequence 69 - 143 framework 1 165 - 215 framework 2 237 - 338 framework 3 357 - 404 framework 4 405 - 710 kappa constant domain 711 - 754 untranslated Expression of the CDR-crafted OKT4A antibody Construction of the Heavy Chain Expression Vector A CDR-grafted heavy chain expression vector was constructed by inserting the heavy chain gene into the expression plasmid pEe6HCMVBgI2 and the adding the GS
fragment, which is composed of the SV40 origin and glutamine synthetase minigene. These steps are diagrammed in Figure 9. pE26HCMVBgI2 and the GS fragment were provided by Celltech, Ltd.
pEe6HCMV was digested at the EcoRI and BclI sites. The pEe6HCMVBgI2 DNA had been demethylated by passaging it through the DAM' E. Coli strain GM242, which lacks the deoxyadenosine methylase. BclI will only restrict DNA
which does not contain N6-methylated deoxyadenosine at the ~ 'enzyme's recognition site. The overhang resulting from the BclI restriction is compatible with the BamHI
overhang. The EcoRI/BamHI CDR-grafted heavy chain gene (HCDR1) was then ligated to the EcoRI/BclI ends of pEe6HCMVBgI2 to produce pEe6HCDR1.
A 5500 by BamHI fragment containing the glutamine synthetase minigene and the SV40 origin of replication and ~SUBST~TUTE SHEET
w'0 91/09966 PCT/GB90/0201~
,~ n a~ '~, r~ °' 3 8 ' v , early and late promoters was inserted into the BamHI site of pEe6HCDR1 to produce pEe6HCDRlgs. The correct orientation of the GS fragment was verified by restriction analysis. pEe6HCDRlgs was prepared for mammalian cell transfection by the alkaline lysis method and cesium chloride gradient purification [43].
pEe6HCDRlgs is capable of expressing the CDR-grafted OKT4A
heavy chain in COS and CHO cells. The HCMV promoter lies 5' to the heavy chain gene and directs its transcription.
The SV40 polyadenylation signal sequence, which lies 3' to the gene, acts as a transcriptional terminator. For transient expression in COS cells, the SV40 origin of replication is present in the GS 5500 by fragment. The GS
minigene is present as a selectable marker for use following CHO cell transfections. Expression of the glutamine synthetase minigene is driven by the SV4o late promoter. The GS fragment is oriented such that the SV40 late promoter drives transcription in the same direction 2o as the HCMV promoter.
Several post-transcriptional events occur to produce the CDR-grafted heavy chain. Within the nucleus, the three intervening sequences of the IgG4 constant portion are removed and the exons are spliced together to create a mature mRNA. Following translation, the 19 amino acid signal sequence is removed in the rough endoplasmic reticulum (ER). A single carbohydrate is added to the CH2 domain of each chain in the ER and the Golgi apparatus.
~ ~ Each chain also contains four intrachain disulfide bonds.
When a light chain peptide is provided by a cotransfected light chain expression vector, a mature antibody is assembled by the binding together, via disulfide bonds, of two heavy and two light chains.
suesre°ruT~ sHEEr H'O 91/9966 PCf/G B90/0201~
sa , ;
f-:i ;
3 9 - ._ v Construction of the CDR-cxrafted OKT4A light chain expression vector:
The CDR-grafted OKT4A light chain expression vector was constructed by inserting the CDR-grafted light chain gene into the expression vector pEesHCMVBgI2 and then adding the SV40 origin and glutamine synthetase minigene-containing GS fragment. The light chain expression vector was constructed by essentially the same process that was l0 used for the heavy chain expression vector as illustrated in Figure 9. The light chain gene was ligated into the EcoRI site of pEe6HCMVBgI2 to produce pEe6LCDR1. The correct orientation of the light chain gene was verified by restriction analysis. The 5500 by GS fragment was inserted into the BamHI site to produce pEe6LCDRlgs. The correct orientation of the GS fragment was verified by restriction analysis. pEe6LCDRlgs prepared for mammalian cell transfection by the alkaline lysis method [43] and by cesium chloride gradient purification.
As with the CDR-grafted heavy chain gene, the transcription of the CDR-grafted light chain gene in pEe6LCDRgs is driven by the HCMV promoter and transcriptional termination is signalled by the Sv4o polyadenylation signal sequence. The SV40 origin of replication contained in the GS fragment allows for autonomous replication of this construct in COS cells.
The glutamine synthetase minicsene in the GS fragment provides a mechanism for selection and amplification in ' ~ CHO cells.
Post-transcriptional processing of the CDR-grafted light chain mRNA is not required prior to translation because no introns are present in the gene. Following translation, the leader sequence is removed in the rough ER. Two intrachain disulfide bonds are formed. Assembly of a mature antibody was discussed in the previous section.
~SUSS'TiTUTE SHEET
«
'O 91 /09966 PC'T/GB90/0201 ..
_ .
Transient expression of CDR-crafted OKT4A in COS-1 cells The transient expression of the CDR-grafted genes in CoS-1 cells provides a rapid and convenient system to test CDR-5 grafted OKT4A antibody expression and function. COS-1 cells constituitively express the SV40 large T antigen which supports the transient replication of episomes carrying the SV40 origin of replication [44]. The CDR-grafted gene expression vectors pEe6HCDRlgs and 10 pEe6I,CDRlgs contain the SV40 origin of replication as a portion of the GS fragment. Upon transfection into COS-1 cells, the expression vectors are replicated in the nucleus to a high copy number, resulting in relatively high expression levels.
COS-1 cells were obtained from the American Type Culture Collection (CRL 1650) and cultured in Dulbecco's Modified Eagle Medium (DMEM from GIBCO) with 10% fetal calf serum.
The CDR-grafted gene expression vectors were transfected into COS cells using the DEAF-dextran method followed by DMSO shock [45]. Briefly, 0.2 ml of 1 mg/ml DEAF-dextran in buffer is added to 15 mg vector DNA in 0.8 ml DMEM/Tris. This was added to 1 - 1.5 x 106 cells in a 60 mm tissue culture plate and incubated for approximately 6 hours. The DEAE-dextran/DNA complex is removed and 10%
DMSO in buffer is added to the plate for 2 minutes. This is removed, the cells are washed once with DMEM and then incubated with DMEM containing 10% fetal calf serum for 3-4 days. At that time supernatant from the wells is 30' ~ harvested and examined for antibody levels and ability to bind CDR positive lymphocytes.
Antibody levels were determined by ELISA. Wells were coated with a goat anti-human Fc specific antibody.
Various dilutions of the COS cell supernatant containing secreted antibody were added, incubated for one hour at room temperature in a humidity chamber and washed. A
SU~~T'1°fUTE SHE~'t ~1'O 91/09966 pCT/GB90/0201~
41 ;.~ .,, . ,., ., . ., . _ _ .
horse radish peroxidase-linked goat anti-human kappa chain antibody was added, incubated for one hour at room temperature and washed. Substrate for the horse radish peroxidase was added for detection. The CDR-grafted OKT4A
levels following co-transfection of pEe6HCDRlgs and pEe6LCDRlgs range from 200 to 1200 ng/ml of COS cell supernatant.
Antigen Binding Studies CDR-grafted OKT4A produced by COS cells was tested for its ability to bind to human peripheral blood lymphocytes (PBLs) or the CD4-positive HPBALL (human peripheral blood acute lymphocytic leukemia) cell line. It was also tested for its ability to block the binding of marine OKT4A to these cells. Binding was measured by the following procedure. PBLs were isolated from serum or HPBALL cells were harvested from tissue culture. Cells were incubated at 4°C for 1 hour with various dilutions of test antibody, positive control antibody or negative control antibody.
The cells were washed once and incubated at 4°C for 1 hour with an FITC-labeled goat anti-human IgG (Fc-specific, mouse absorbed). The cells were washed twice and analyzed by cytofluorography. chimeric OKT4A (described below) was used as a positive control. FITC-labeled marine OKT4A was used as a positive control for direct binding. Cells incubated with mock-transfected COS cell supernatant, followed by the FITC-labeled goat anti-human IgG, provided the negative control.
i ' To test the ability of CDR-grafted OKT4A to block marine OKT4A binding, the PBLs or HPBALL cells were incubated at 4°C for 1 hour with various dilutions of test antibody or control antibody. A fixed saturating amount of FITC-OKT4A
was added. The samples were incubated for 1 hour at 4°C, washed twice and analyzed by cytofluorography. Positive controls were FITC-labeled OKT4A t0 determine maximum SUSSTlTUTE SHEET
N'O 91 /09966 PC'T/GB90/0201 ,. . s~ :' r, ~. 4 2 ..
binding and unlabeled marine OKT4A as a reference standard for blocking. Negative controls were unstained cells with or without mock-transfected cell supernatant.
The ability of the CDR-grafted OKT4A light chain to bind CD4 positive cells and block the binding of marine OKT4A
was initially tested in combination with a chimeric OKT4A
heavy chain. The chimeric OKT4A heavy chain is composed of the marine OKT4AA variable domain and the human IgG4 constant portion. The chimeric heavy chain gene is expressed in the same expression vector used for the CDR-grafted genes. The CDR-grafted light chain expression vector and the chimeric heavy chain expression vector were co-transfected into COS cells. The full chimeric OKT4 antibody (chimeric light chain and chimeric heavy chain) was found to be fully capable of binding to CD4 positive cells and blocking the binding of marine OKT4 to these cells.
As Figure 10 illustrates, the CDR-grafted OKT4A light chain, LCDR1, in combination with the chimeric OKT4A heavy chain was unable to bind CD4 positive cells or block the binding of marine OKT4A to these cells.
Figure 11 shows the binding and blocking studies done with the CDR-grafted OKT4A heavy chain, HCDR1, combined with the chimeric OKT4A light chain. The chimeric OKT4A light chain is composed of a marine OKT4A variable domain and a human kappa constant domain. It is also expressed in the ~ same expression vector as is used for the CDR-grafted antibodies. COS cells were co-transfected with the CDR-grafted heavy chain expression vector and the chimeric light chain expression vector.
The CDR-grafted OKT4A heavy chain, HCDR1, in combination with the chimeric OKT4A light chain was also unable to ~SUBSTITUTS SHEET
.91/09966 CA 02046904 1999-12-06 PCT/G 890/0201:
bind CD4 positive cells or block the binding of murine OKT4A to these cells.
Modification of the CDR-Grafted Antibody The binding and blocking data clearly demonstrated that the initially designed~CDR-grafted OKT4A antibody was not capable of recognizing the C04 antigen:- Further modification of the antibody was necessary.- Either the murine OKT4A CDRs needed to be further expanded or critical framework residues involved in the positioning of CDRs, domain packing or light and heavy chain interactions needed to be changed from human to mouse.
Molecular modelling was used to identify the residues which appeared most critical for successful antigen interaction. Modelling was done at Celltech, Ltd with HYDRA'~software on a SiliconGraphics instrument.
Modification of the CDR-Grafted Licht Chain The crystal structure of OKT4A has not been determined, so a molecular model of OKT4A itself could not be used in the analysis. To analyze residues of the CDR-grafted light chain, a molecular model of the human REI light chain was superimposed with a mouse MOPC 603 Fab fragment. The MOPC
~. 603 light chain is similar in amino acid sequence to ~OKT4A. Also studies were done where the human REI light chain and the human KOL heavy chain were docked.
Decisions were made to extend CDR1 by converting residues 33 and 34 from the human leu and asp to the murine OKT4A
ile and ala. The human REI residue g1u38 was found to be involved in heavy chain and light chain packing. Changing this to the murine OKT4A his38 may be beneficial.
Residue 49 at the amino terminal edge of CDR2 directly impacts CDR2 and also makes contact with CDR3 of the heavy chain. Residue 89 near the amino terminal end of CDR3 *Trade-mark SUBSTITUTE SHEET
.V1'0 91 /09966 PCT/G 890/0201 ~ ' interacts with phe98 in CDR3 of the light chain and also contacts CDR3 of the heavy chain. The REI tyr49 and g1n89 were changed to the murine OKT4A his49 and 1eu89.
The new CDR-grafted OKT4A light chain gene that was generated by the above changes was designated I~CDR2. A
comparison of the amino acid sequence of the variable .domains of the human REI, LCDRijyLCDR2,~nnd_tha assumed murine OKT4A light chain is shown _in figure :12.-- The l0 changes were effected by altering codons by site-directed mutagenesis [46]. The bluescript'~phagemid vector from Stratagene Cloning Systems was used to generate single-stranded template for mutagenesis. The expression vector pEe6LCDR2gs was constructed in the same manner as for LCDRl. COS cells were co-transfected with pEe6LCDR2gs and the chimeric heavy chain expression vector.
The results of binding and.blocking studies are shown in Figure 10. The LCDR2 version of the CDR-grafted OKT4A
light chain, in combination with the chimeric ~KT4A heavy chain, is capable of binding to CD4 positive cells and of blocking the binding of murine OKT4A. These data show that LCDR2 is a functional CDR-grafted OKT4A light chain.
Modification of the CDR-crafted heavy chain . ' For modelling studies of the heavy~chain the molecular model of the human antibody KOL was used. All residue changes were made by site-directed mutagenesis to change codons. A decision was made to change g1u57 and his58 of KOL to thr57 and tyr58 of murine OKT4A. This revised CDR-grafted heavy chain was designated HCDR2. In addition to changes at residues 57 and 58, residue 24 lies near.CDRl and may be involved in positioning CDR1. Also residues 88 and 91 are involved in heavy chain variable domain packing and the interface between the heavy and light chains.
These three additional residue changes from KOL to murine *Trade-mark ci ~RSTITUTE SHEET
s:: : ..
OKT4A were incorporated into the heavy chain version HCDR3. An amino acid sequence comparison of the variable domains of KOL, HCDR1, HCDR2, HCDR3, marine OKT4A heavy chain, and versions to be described below is illustrated 5 in Figure 13.
Expression vectors pEe6HCDR2gs and pEe6HCDR3gs were co-transfected into COS cells with either the chimeric OKT4A
light chain expression vector or pEe6LCDR2gs. Binding and 10 blocking data are presented in Figures 11 and 14. Neither HCDR2 nor HCDR3 was able to effectively interact with antigen when combined with a chimeric or CDR-grafted OKT4A light chain.
15 Further modifications to the CDR-grafted heavy chain were explored. A decision to change KOL tyr35 to marine OKT4A
ser35 was made. Molecular modelling demonstrated that residue 42 was involved in positioning CDR2. Residue 44 is involved in light chain contacts. It may be beneficial 20 to change the KOL g1y42 and g1y44 to marine OKT4A g1u42 and arg44. KOL a1a60 was changed to the marine OKT4A
pro60. These changes were introduced in various combinations, while retaining the changes made at residues 24, 57, 58, 88, and 91 in the previous versions. These 25 latter versions were denoted HCDR4, HCDR5, HCDR6, HCDR7, HCDR8. The residue changes in each are described in Figure 13. The same expression vector was used as with the other constructions. COS cells were co-transfected with the new heavy chain expression vectors and 30 ~ ~ pEe6LCDR2gs.
The results of binding and blocking studies, in combination with LCDR2 (Figure 15), show positive interactions with the CD4. antigen in all of these versions 35 except HCDRB. Apparently the conversion of tyr35 to the marine ser35 is a critical change. The change to the 1.2 SUBSTITUTE SHEET
~i'O 91109966 c?
~r _ ~
murine residue at position 60 appears to enhance antigen interaction (compare HCDR6 vs HCDR4) while the change at position 44 appears to be slightly inhibitory (HCDR5 vs HCDR4, and HCDR7 vs HCDR6).
To determine if changes at residues 35 and 60 would be sufficient for antigen binding, HCDR9 (murine residues at positions 24, 35, 57, 58, 88, 91) and HCDR10 (murine residues at positions 24, 35, 57, 58, 60, 88, 91) were generated by site-directed mutagenesis. The same expression vector system was used for these versions of the CDR-grafted heavy chain. They were co-transfected into COS cells with pEe6LCDR2gs.
The results of binding and blocking experiments is illustrated in Figure 15 along with the prior versions of the CDR-grafted heavy chain. Clearly the changes made at residues 42 and 44 in previous versions were not necessary, contrary to the criteria set forth in PCT/US89/05857. The change at residue 60, present in HCDR10, but not in HCDR9, is beneficial.
A summary of the CDR-grafted OKT4A heavy chains and their activities in the binding and blocking assays is shown in Table 1. The most active CDR-grafted OKT4A antibody which contains the fewest murine residues is the combination of HCDR10 and LCDR2.
vUgSTI"CUTE SHEET
V1'O 91 /09966 PCT/GB90/0201 ' x .~ +
' + + I +
I I + + +
+ + + +
~ a c +~
~ U
~ I + + + + +
-I
1 I + + + + + l~
-~.
+ +
.-i N
0~ C
O
.~ co,~ .-i ~ COO~ N LT
d CO O CO
rdZO O O r"~ f-I
CW
N 0107 <T ~ x e-r ~ O CDO .>~Sa ~r sowD m vD~ co ~ O
com . . o~oo ~ 3 .
.~ o ~ ~ n ~ ~ o ~
* 0 ~
H +~ o * c>a c ~ c~- - o c~
a ~ ~ u~~ ~ ~ w ~
ri ~ CO N N ~' r4 If1 N d'~'C o r1 t!
O ~ l In O V!CY In la. . tnN - -. CL d ~
~ E ~ O ~ ~ ~ r9d'~ ~ O
r?
E t~ .1~
u, ~ - c, ~ ~ ro 'L~ N d'd' N N Z'~' Sl W
N
N N N N ro ro x o .
N a ~ ~
o - >, :
.-a ~ ~ro ~ ~
o ro N * Ov Vw0 cpv0 .C C
aC N ~ +~ o U G; CO 00N N N d' O
N
m m ~rv a ~r vo !r 3 ~ ~
I
d .CO r d'tnIn InN Il7In W
If1 i'G U ~ ll1N l'1M f'1d'M f'1 f"1 ~i o N
a c m b H
x ~
.o ~ ro N ar w w ~
o >a 'd N M ~ tf1 f~0001ri ..1 ~ ' tp i rx ~ x x a x x x x m a~
oc p; ~ D ~ A D D D D O D N
D
p D U U U U U U U U U U CG *
U
U U x ~ ~ x ~ S ~ ~ x ~ ~ *
?.
~r1 o ~n a ~SUSSTITUTE SHEET
N'O 91 /09966 PCT/G B90/0201 ,r: ~, °. r ".
v , Alternative Light Chain Constructs As is stated above, the present light chain constructs were produced on the assumption that at position 27 in the OKT4A light chain, there was a proline residue. Once it was appreciated that position 27 should be a glutamine residue, three new light chain constructs were produced and expressed. These were labelled LCDR2Q, LCDR3Q and LCDR4Q are identical to LCDR2, LCDR3 and LCDR4 respectively except that at position 27 there is a glutamine (Q) instead of a proline (P) residue. It has been shown that these light chains retained full activity.
The data showing this is presented in Figure 16.
It is to be noted that proline is significantly different from all other amino acids in that it has a planar structure. It is therefore commonly found at sites in peptide sequences where a change in orientation of the chain occurs. It is therefore likely that the structure of the light chain CDR1 having proline at residue 27 will be significantly different from that of the light chain CDR1 having glutamine at residue 27. Despite this, it has been demonstrated that the two light chains are equivalent from a functional standpoint. This supports the view expressed herein that it is not necessary to change all 6 CDRs in an antibody in order to produce a functional CDR-grafted antibody.
Alternative Modifications of the CDR-Grafted Liqht and i ' Heaw Chains Residue changes made in later versions of the CDR-grafted light and heavy chains were done based upon molecular modelling of REI, KOL and a related mouse antibody, MOPC
603, rather than of the CDR-grafted antibodies themselves.
Some of the alterations may be unnecessary for binding, especially at lower binding affinities. We have suesreTUTE s~~~
...
49 ~ ~'"~
,r,.,-...:.
constructed several~CDR-grafted light and heavy chain ' genes in which some of the framework residues previously switched to mouse residues have been changed back to the human. Generally those residues not directly involved in lengthening CDRs or positioning CDRs are being changed back to the human residues in various combinations. Table 2 lists these light and heavy chain genes with the residue numbers that revert from the marine to human. Site-directed mutagenesis was used to construct these genes.
They will be expressed in COS cells and their ability to recognize CD4 will be tested in the binding and blocking assays. The most desirable CDR--grafted antibody is the one with the fewest marine residues that is capable of recognizing CD4 with an affinity similar to that of marine OKT4A.
MODIFICATIONS TO THE CDR-GRAFTED LIGHT AND HEAVY CHAINS
Construct Residue Chanue* Total marine residues**
Light chain:
LCDR3 38 33,34,49,89 LCDR4 49 33,34,38,89 LCDR5 89 33,34,38,49 LCDR6 38,49,89 33,34 Heavy chain:
~ HCDR11 88,91 24,35,47,58,60 HCDR12 24,88,91 35,57,58,60 *Residues are denoted by their Kabat position number [2].
Noted residues will be changed from marine sequence to human sequence.
** Marine residues refer to residues in frameworks, not CDRs.
SUBSTITUTE SHEET
' CA 02046904 1999-12-06 6 PCT/GB90/02015 .
50 . ' Determination of Relative Binding Affinity The relative-binding affinities of CDR-grafted anti-CD4 monoclonal antibodies were determined-~y'competition binding [ 8 ] using the HPH-ALL human T cell :linewas., a source of CD4 antigen and fluorescein-conjugated marine OKT4A (F1-OKT4A) of known bindingaffinity :a:. ~a tracer antibody. The binding affinity~of ~1-ORT4A .tracer antibody was determined by.a direct~binding assay in which increasing amount of F1-OKT4A were incubated with HPB-ALL
(5 x 105) in PBS with 5~ fetal calf serum for '~60 min at 40~. Cells were washed, and the fluorescence -intensity was determined on a FACScari flow cytometer calibrated with quantative microbead stands (Flow Cytometry Standards, Research Triangle Park, NC). Florescence intensity per antibody molecule (F/P ratio) was determined by using microbeads which have a predetermined number of mouse IgG
antibody binding sites (Simply Cellular Beads; Flow Cytometry Standards). F/P equals the florescence intensity of beads saturated with F1-OKT4A divided by the number of binding sites per beads. The amount of bound and free F1-OKT4A was calculated from the mean fluorescence intensity per cell, and the ratio of bound/free was plotted against the number of moles of antibody bound. A linear fit was used to determine the affinity of binding (absolute value of the slope).
For competitive binding, increasing amounts of competitor antibody were added to a sub-saturating dose of Fl-OKT4A
and incubated with 5 x 105 HPB-ALL in 200 ~l of PBS with 5%
fetal calf serum for 60 min at 4C. The fluorescence intensities of the cells were measured on a FACScari flow cytometer calibrated with quantitative microbead standards. The concentrations of bound and free F1-OKT4A
were calculated. The affinities of competing antibodies were calculated.from the equation [X) -[ORT4A) _ (1/Kx) -(1/Ka), where Ka is the affinity of muting OKT4A, Kx is *Trade->zar. k SUBSTITUTE SHEET
WO 91/09966 PCT/GB90/0201~
51 r .-, .-. : ~ - v, ,, ...
n' the affinity of competitor X [ J is the concentration of -' competitor antibody at which bound/free binding is R/2, and R is the maximal bound/free binding.
Affinity Results The relative affinity constants of the humanized antibodies (Fig. 17, Table 3) were determined, and LCDR2 combined with HCDR10 retained 68% of the activity of the parent. LCDR2/HCDR5 (Table 1) retained only 13% of the murine antibody affinity. These results are in agreement with those obtained in blocking assays (Fig. 16a&b).
Comparison of HCDR5 with HCDR7 (Fig. 15) suggests that residue 60, while not critical for activity, is beneficial when converted to that in the donor sequence. In the same figure, the deleterious effect of the donor residue at position 44 can also be seen (HCDR4 vs. HCDRS).
Relative Affinity Constants of the CDR-grafted Antibodies Antibody Log conc. competitor Affinity Constant Constructs (pM) at 50% inhibition (Kx) Murine OKT4A 2.4 3 X 109 Chimeric OKT4A 2.9 1.1 x 109 LCDR2/HCDR10 2.6 2.1 x 109 LCDR2/HCDRS 3.4 0.4 x 109 ~Chimeric OKT3 No inhibition Murine OKT3 No inhibition Functional Studies It is believed that the CD4 antigen, which is recognised by OKT4A and its chimeric and GDR-grafted equivalents, is involved in the interactions whic?a~give rise to the SUSST~TUT~ SHEET
W~ 91/9966 CA 02046904 1999-12-06 p~~Gggp~02015 biological functions of T lymphocytes carrying the CD4 antigen. In particular, it is believed that the CD4 antigen is involved in the mixed lymphocyte reaction (MICR) and in the proliferation of peripheral blood mononuclear cells (PBMC) . In order to show that 'the _.CDR-grafted antibodies of the present invention are likely to have the same biological activity as murin~'DRT4Jl, the following functional studies were carried.out.-inhibition of MLR
Human PBMC were isolated by density gradient centrifugation with Ficoll*and resuspended in complete DMEM containing 1~ foetal calf serum (FCS). 2 x 105 responder PBMC and 1 x 105 irradiated (2 Mrad) allogeneic PBMC were added to each well of a 96 well tissue~culture plate, followed by serial dilutions of a purified anti-CD4 antibody. Cells were cultured for 6 days, pulsed with 3Fi thymidine for 24 hours and harvested. 3Fi-thymidine 2o incorporation was measured by liquid scintillation.
As a negative control, irradiated responder cells were used in place of the irradiated allogeneic PBMC and no antibody was added. As a positive control, the experiment was carried out without the addition of antibody. In the experiment, the antibodies used were murine OKT4A, chimeric OKT4A and the F(ab')2 fragment of murine OKT4A.
The results of the experiment are shown in Figure 18.
Both the chimeric OKT4A and the murine OKT4A showed similar inhibition of MLR.
Inhibition of Proliferation ' OKT3 (20 ng/ml), a murine MAb which recognises the CD3 antigen on T lymphocytes, vas immobilised on polystyrene 96 well tissue culture plates for d hours at 20~. The *Trade-r.~ark 'SUBSTITUTE SHEET
plates were washed ,three times with phosphate buffered saline (PBS) and 1 x 105 PMBC were added to each well.
Thereafter, serial dilutions of an anti-CD4 antibody were added. Cells were cultured for 72 hours, pulsed with 3H-thymidine for 24 hours and harvested. 3H-thymidine incorporation was measured by liquid scintillation.
As a negative control, proliferation was measured in the absence of both the OKT3 and anti-CD4 antibodies. As a positive control proliferation was measured in the presence of OKT3 alone. In this experiment, the antibodies used were marine OKT4A, chimeric OKT4A and the Flab°)Z fragment of marine OKT4A.
The results are given in Figure 19, which shows that chimeric OKT4A has substantially the same ability to inhibit proliferation as does marine OKT4A.
The above functional studies show that chimeric OKT4A has equivalent biological properties to marine OKT4A. Since the CDR-grafted anti-CD4 antibodies have substantially the same affinity for the CD4 antigen as the chimeric OKT4A
antibody and since the chimeric OKT4A antibody has the same constant domains as the CDR-grafted OKT4A antibodies, it can be expected that the CDR-grafted OKT4A antibodies will have the same biological functions as marine OKT4A
and will thus be of use in therapy.
l A number of different CDR-grafted OKT4A antibodies have been generated. Essentially, DNA encading the CDRs of the marine OKT4A heavy and light chains has been grafted onto the frameworks of the human heavy chain KOL and light chain REI antibody genes. These variable domains are ligated to the DNA encoding human kappa light chain and IgG4 heavy chain constant portion.' The resulting CDR-~suesT~TUTE s~E~r V1'O 91/09966 PCT/GB90/0201~
.. ~ ;~ ~; _ ~:
tr . ~ . . .. _: 54 grafted genes are expressed in COS-1 cells. Antibody secreted into the tissue culture media is collected, quantified by ELISA, and tested for its ability to bind to CD4 positive cells and to block the binding of murine OKT4A.
The initially designed CDR-grafted antibody was unable to interact with CD4. A number of modifications were made to the light chain where critical human framework residues in the REI sequence, identified by molecular modelling, were changed to the murine OKT4A residues. This new version of the light chain, LCDR2, was able to recognize the CD4 antigen. Similarly, a number of heavy chain human framework residues were changed to murine in various combinations to generate NCDR2 through HCDR10. Several of these heavy chains, in combination with LCDR2, competed well with the murine OKT4A antibody for CD4. Presently the CDR-grafted OKT4A of choice is the combination of LCDR2Q and HCDR10. Further versions of the light and heavy chains are currently being generated where framework residues that were previously switched to the murine residues are being changed back to human. These more humanized CDR-grafted antibodies will be tested for their ability to recognize CD4.
~SUBSTI'~UTE SHEET
WO 91/09966 PCT/GB90/0201~
F~ !s !~, .. . .. ._~
REFER ENCES
[1] Kabat et al., in Sequences of Proteins of Immun ological Interest, US Department of Health and Human Servi ces, 1987.
5 [2] Wu and Kabat, J. Exp. Med., 132, 211, 1970.
[3] Oi et al., PNAS-USA, 80, 825, 1983.
[4] Neuberger, EMBO J., _2, 1373, 1983.
[5] Ochi et al., PNAS-USA, ~Q, 6351, 1983.
[6] Verhoeyen et al., Science, X39, 1534, 1988.
10 [7] Reichmann et al., Nature, 332, 323, 1988.
[8] Queen et al., PNAS-USA, 86, 10029, 1989.
[9] Zoller and Smith, Nuc. Acids Res., ~, 6487, 1982.
[10] Norris et al., Nuc. Acids Res., 11, 5103, 1983.
15 [11] ZOller and Smith, DNA, 3, 479, 1984.
[12] Kramer et al., Nuc. Acids Res., 7~0, 6475, 1982.
[13] Mullis and Foloona, Meth. Enz., 155, 335, 1987.
[14] Higuchi et al., Nuc. Acids Res., 16, 7351, 1988.
[15] HO et al., Gene, 77, 51, 1989.
20 [16] Ho et al., in Engineering Hybridisation Restriction Genes without the Use of Restriction Enzymes:
Gene Splicing by Overlap Extension.
[17] Horton et al., Gene, 77, 61, 1989.
[18] Bolivar et al., Gene, ~,, 95, 1977.
25 [19] Chang et al., Nature, 7~5, 615, 1978.
[20] Itakura et al., Science, ~, 1056, 1978.
[21] Goedell et al., Nature, ,~,, 544, 1979.
[22] Goedell et al., Nuc. Acids Res., ~, 4057, 1980.
[23] Siebenlist et al., Cell, ~Q, 269, 1980.
30 , ~[24]Stinchcomb et al., Nature, ,~$~, 39, 1979.
[25] Kingsman et al., Gene, 7, 141, 1979.
[26] Tschemper et al., Gene, ~, 157, 1980.
[27] Jones, Genetics, 85, 12, 1977.
[28] Hitzeman et al., J. Biol. Chem., ~5 , 2073, 35 1980.
[29 ] Hess et al., J. Adv. Enzyme Reg., 7, 149, 1968.
[30 ] Holland et al., Biochemistry, ~7, 4900, 1978.
SUBSTITUTE SHEET
WO 91/099b6 PCT/GB90/02015 ,, 5 '.. n f~ ;~
:~.
.
E ; '. .. v __ . .
,.
[31] Kruse and'Patterson, in Tissue Culture, Academic Press, 1973.
[32] Fiers et al., Nature, 273, 113, 1978.
[33] Maniatis et al., in Molecular Cloning: A
Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1990.
[34] Scopes, in Protein Purification, Springer Verlag, NY, 1982.
[35] Lefkovite and Pernis, in Immunological Methods, Volumes I and II, Academic Press, NY, 1979 and 1981.
[36] Bernhard et al., in Leukocyte Typing, Springer Verlag, NY, 1984.
[37] Mack, in Remingtons Pharmaceutical Sciences, 16th ition, 1982.
Ed [38] Chirgwin et al., Biochemistry, ~,, 5294, 1979.
[39] Sanger et al., PNAS-USA, 74, 5463, 1977.
[40] Jones et al., Nature, 32~, 522, 1986.
[41] Whittle et al., Protein Engineering, ~, 499, 1987.
[42] Kozak et al., J. Mol. Biol., 196, 947, 1987.
[43] Birnboim and Doly, Nuc. Acids Res., ~4, 1513, 1979.
[44] Gluzman, Cell, 23, 175, 1981.
[45] Lopata et al., Nuc. Acids Res., ~4, 5707, 1984.
[46] Kunkel, PNAS-USA, ~?,, 488, 1985.
[47] Chotia and Lesk, J. Mol. Biol., 96, 4, 901, 1987.
[48] Baranov et al., Gene, ~, 2, 463, 1989.
~gUBSTITUTE SHEET
Claims (22)
1. An antibody molecule capable of binding to the CD4 antigen comprising a composite heavy chain and a complementary light chain wherein, in the variable domain of said composite heavy chain, the framework regions are predominantly derived from a first human antibody (acceptor) and at least residues 23, 24, 26 to 35, 49 to 65 and 95 to 102 (according to the Kabat numbering system) correspond to the equivalent residues in mouse monoclonal antibody OKT4A
(donor) as shown in Fig. 3.
(donor) as shown in Fig. 3.
2. The antibody molecule of claim 1, wherein residues 6 and 48 in the composite heavy chain additionally correspond to the equivalent residues in the donor antibody.
3. The antibody molecule of claim 1 or claim 2, wherein residues 71, 73 and 79 in the composite heavy chain additionally correspond to the equivalent residues in the donor antibody.
4. The antibody molecule of any one of claims 1 to 3, wherein any one of any combination of residues 57, 58, 60, 88 and 91 in the composite heavy chain correspond to the equivalent residues in the donor antibody.
5. The antibody molecule of any one of claims 1 to 4, wherein the acceptor residues in the composite heavy chain correspond to the equivalent residues in the human antibody KOL heavy chain as shown in Fig. 5.
6. The antibody molecule of any one of claims 1 to 5, wherein the complementary light chain is a composite light chain wherein, in the variable domain of said composite light chain, the framework regions are predominantly derived from a first human antibody (acceptor) and at least residues 24 to 34, 49 to 56 and 89 to 97 (according to the Kabat numbering system) correspond to the equivalent resides in mouse monoclonal antibody OKT4A (donor) as shown in Fig. 4.
7. An antibody molecule capable of binding to the CD4 antigen comprising a composite light chain and a complementary heavy chain wherein, in the variable domain of said composite light chain, the framework regions are predominantly derived from a first human antibody (acceptor) and at least residues 24 to 34, 49 to 56 and 89 to 97 (according to the Kabat numbering system) correspond to the equivalent residues in mouse monoclonal antibody OKT4A
(donor) as shown in Fig. 4.
(donor) as shown in Fig. 4.
8. The antibody molecule of claim 6 or claim 7, wherein residue 89 in the composite light chain additionally corresponds to the equivalent residue in the donor antibody.
9. The antibody molecule of any one of claims 6 to 8, wherein the acceptor residues in the composite light chain correspond to the equivalent residues in the human REI light chain as shown in Fig. 6.
10. The antibody molecule of any one of claims 1 to 9, which has an affinity for the CD4 antigen of from to 10 5.M-1 to 10 12.M-1.
11 . The antibody molecule of claim 10, which has an affinity for the CD4 antigen of at least about 10 8.M-1.
12. The antibody molecule of claim 10 or claim 11, which has an affinity for the CD4 antigen similar to that of OKT4A.
13. The antibody molecule of any one of claims 1 to 12, which is a complete Ig.
14. The antibody molecule of claim 13, which is of isotype IgG4.
15. The antibody molecule of claim 13 or claim 14, wherein one or more residues in tree constant domains of the Ig has been altered in order to alter tile effector functions of the constant domains.
16. The antibody molecule of any one of claims 1 to 15 which is produced by use of recombinant DNA technology.
17. A method for producing an antibody molecule according to any one of claims 1 to 16, which method comprises:
a) providing a first DNA sequence, encoding a composite heavy chain as defined in any one of claims 1 to 5 or a composite light chain as defined in any one of claims 6 to 9, under the control of suitable upstream and downstream elements;
b) transforming a host cell with the first DNA
sequence; and c) culturing the transformed host cell so that an antibody molecule according to any once of claims 1 to 16 is produced.
a) providing a first DNA sequence, encoding a composite heavy chain as defined in any one of claims 1 to 5 or a composite light chain as defined in any one of claims 6 to 9, under the control of suitable upstream and downstream elements;
b) transforming a host cell with the first DNA
sequence; and c) culturing the transformed host cell so that an antibody molecule according to any once of claims 1 to 16 is produced.
18. The method of claim 17, which further comprises:
providing a second DNA sequence, encoding an antibody light or heavy chain complementary to the first chain, under the control of suitable upstream and downstream elements; and transforming the host cell with both the first and second DNA sequences.
providing a second DNA sequence, encoding an antibody light or heavy chain complementary to the first chain, under the control of suitable upstream and downstream elements; and transforming the host cell with both the first and second DNA sequences.
19. A nucleotide sequence which encodes a composite antibody chain as defined in any one of claims 1 to 9.
20. An antibody molecule according to any one of claims 1 to 16, for use in treating graft rejections or helper T cell disorders.
21. A pharmaceutical composition comprising an antibody molecule according to any one of claims 1 to 16 in combination with a pharmaceutically acceptable excipient.
22. Use of an antibody molecule according to any one of claims 1 to 16 or a composition according to claim 21 in an effective amount for treating a graft rejection or a helper T cell disorder in a patient in need of such treatment.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB898928874A GB8928874D0 (en) | 1989-12-21 | 1989-12-21 | Humanised antibodies |
GB8928874.0 | 1989-12-21 | ||
PCT/GB1990/002015 WO1991009966A1 (en) | 1989-12-21 | 1990-12-21 | Cd4 specific recombinant antibody |
Publications (2)
Publication Number | Publication Date |
---|---|
CA2046904A1 CA2046904A1 (en) | 1991-06-22 |
CA2046904C true CA2046904C (en) | 2003-12-02 |
Family
ID=10668300
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002050479A Expired - Lifetime CA2050479C (en) | 1989-12-21 | 1990-12-21 | Cd3 specific recombinant antibody |
CA002046904A Expired - Lifetime CA2046904C (en) | 1989-12-21 | 1990-12-21 | Cd4 specific recombinant antibody |
CA002037607A Expired - Lifetime CA2037607C (en) | 1989-12-21 | 1991-03-06 | Humanised antibodies |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002050479A Expired - Lifetime CA2050479C (en) | 1989-12-21 | 1990-12-21 | Cd3 specific recombinant antibody |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002037607A Expired - Lifetime CA2037607C (en) | 1989-12-21 | 1991-03-06 | Humanised antibodies |
Country Status (21)
Country | Link |
---|---|
US (10) | US5929212A (en) |
EP (5) | EP0626390B1 (en) |
JP (4) | JPH04505398A (en) |
KR (3) | KR100197956B1 (en) |
AT (4) | ATE129017T1 (en) |
AU (4) | AU631481B2 (en) |
BG (1) | BG60462B1 (en) |
BR (1) | BR9007197A (en) |
CA (3) | CA2050479C (en) |
DE (4) | DE69020544T2 (en) |
DK (4) | DK0460171T3 (en) |
ES (4) | ES2074701T3 (en) |
FI (4) | FI108776B (en) |
GB (4) | GB8928874D0 (en) |
GR (2) | GR3017734T3 (en) |
HU (4) | HU215383B (en) |
NO (5) | NO316076B1 (en) |
RO (3) | RO114232B1 (en) |
RU (1) | RU2112037C1 (en) |
WO (3) | WO1991009966A1 (en) |
ZA (1) | ZA9110129B (en) |
Families Citing this family (1293)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5800815A (en) * | 1903-05-05 | 1998-09-01 | Cytel Corporation | Antibodies to P-selectin and their uses |
CU22545A1 (en) * | 1994-11-18 | 1999-03-31 | Centro Inmunologia Molecular | OBTAINING A CHEMICAL AND HUMANIZED ANTIBODY AGAINST THE RECEPTOR OF THE EPIDERMAL GROWTH FACTOR FOR DIAGNOSTIC AND THERAPEUTIC USE |
US6054561A (en) * | 1984-02-08 | 2000-04-25 | Chiron Corporation | Antigen-binding sites of antibody molecules specific for cancer antigens |
US6548640B1 (en) | 1986-03-27 | 2003-04-15 | Btg International Limited | Altered antibodies |
US5449760A (en) * | 1987-12-31 | 1995-09-12 | Tanox Biosystems, Inc. | Monoclonal antibodies that bind to soluble IGE but do not bind IGE on IGE expressing B lymphocytes or basophils |
US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
US6406696B1 (en) | 1989-10-27 | 2002-06-18 | Tolerance Therapeutics, Inc. | Methods of stimulating the immune system with anti-CD3 antibodies |
WO1991006319A1 (en) * | 1989-10-27 | 1991-05-16 | Arch Development Corporation | Methods and compositions for promoting immunopotentiation |
US5859205A (en) | 1989-12-21 | 1999-01-12 | Celltech Limited | Humanised antibodies |
US6750325B1 (en) * | 1989-12-21 | 2004-06-15 | Celltech R&D Limited | CD3 specific recombinant antibody |
GB8928874D0 (en) * | 1989-12-21 | 1990-02-28 | Celltech Ltd | Humanised antibodies |
US7037496B2 (en) | 1989-12-27 | 2006-05-02 | Centocor, Inc. | Chimeric immunoglobulin for CD4 receptors |
GB9014932D0 (en) | 1990-07-05 | 1990-08-22 | Celltech Ltd | Recombinant dna product and method |
US5770429A (en) * | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
GB9020282D0 (en) * | 1990-09-17 | 1990-10-31 | Gorman Scott D | Altered antibodies and their preparation |
GB9021679D0 (en) * | 1990-10-05 | 1990-11-21 | Gorman Scott David | Antibody preparation |
GB9022543D0 (en) * | 1990-10-17 | 1990-11-28 | Wellcome Found | Antibody production |
US6399062B1 (en) * | 1990-11-06 | 2002-06-04 | The United States Of America As Represented By The Secretary Of The Navy | Murine monoclonal antibody protective against Plasmodium vivax malaria |
WO1992009305A1 (en) * | 1990-11-27 | 1992-06-11 | Biogen, Inc. | Anti cd-4 antibodies blocking hiv-induced syncytia |
US5994510A (en) * | 1990-12-21 | 1999-11-30 | Celltech Therapeutics Limited | Recombinant antibodies specific for TNFα |
GB9109645D0 (en) * | 1991-05-03 | 1991-06-26 | Celltech Ltd | Recombinant antibodies |
GB9104498D0 (en) * | 1991-03-04 | 1991-04-17 | Ks Biomedix Ltd | Antibody |
EP1857554A1 (en) * | 1991-03-18 | 2007-11-21 | New York University | Monoclonal and chimeric antibodies specific for human tumor necrosis factor |
US7192584B2 (en) | 1991-03-18 | 2007-03-20 | Centocor, Inc. | Methods of treating psoriasis with anti-TNF antibodies |
US5919452A (en) * | 1991-03-18 | 1999-07-06 | New York University | Methods of treating TNFα-mediated disease using chimeric anti-TNF antibodies |
US5656272A (en) * | 1991-03-18 | 1997-08-12 | New York University Medical Center | Methods of treating TNF-α-mediated Crohn's disease using chimeric anti-TNF antibodies |
US5698195A (en) * | 1991-03-18 | 1997-12-16 | New York University Medical Center | Methods of treating rheumatoid arthritis using chimeric anti-TNF antibodies |
US6284471B1 (en) * | 1991-03-18 | 2001-09-04 | New York University Medical Center | Anti-TNFa antibodies and assays employing anti-TNFa antibodies |
US6277969B1 (en) | 1991-03-18 | 2001-08-21 | New York University | Anti-TNF antibodies and peptides of human tumor necrosis factor |
DE122009000019I1 (en) | 1991-04-25 | 2009-07-16 | Chugai Seiyaku K K 5 1 | RECOMBINED HUMAN ANTIBODIES AGAINST THE HUMAN INTERLEUKIN-6 RECEPTOR |
US6797492B2 (en) | 1991-05-17 | 2004-09-28 | Merck & Co., Inc. | Method for reducing the immunogenicity of antibody variable domains |
US6800738B1 (en) * | 1991-06-14 | 2004-10-05 | Genentech, Inc. | Method for making humanized antibodies |
WO1994004679A1 (en) * | 1991-06-14 | 1994-03-03 | Genentech, Inc. | Method for making humanized antibodies |
DE122004000008I1 (en) | 1991-06-14 | 2005-06-09 | Genentech Inc | Humanized heregulin antibody. |
GB9115364D0 (en) | 1991-07-16 | 1991-08-28 | Wellcome Found | Antibody |
US6685939B2 (en) | 1991-08-14 | 2004-02-03 | Genentech, Inc. | Method of preventing the onset of allergic disorders |
US6329509B1 (en) * | 1991-08-14 | 2001-12-11 | Genentech, Inc. | Anti-IgE antibodies |
DE69230545T2 (en) * | 1991-08-21 | 2000-07-06 | Novartis Ag | Antibody derivatives |
AU669124B2 (en) * | 1991-09-18 | 1996-05-30 | Kyowa Hakko Kirin Co., Ltd. | Process for producing humanized chimera antibody |
GB9120467D0 (en) * | 1991-09-26 | 1991-11-06 | Celltech Ltd | Anti-hmfg antibodies and process for their production |
GB9122820D0 (en) * | 1991-10-28 | 1991-12-11 | Wellcome Found | Stabilised antibodies |
JPH05244982A (en) * | 1991-12-06 | 1993-09-24 | Sumitomo Chem Co Ltd | Humanized b-b10 |
GB9125979D0 (en) * | 1991-12-06 | 1992-02-05 | Wellcome Found | Antibody |
AU3236793A (en) * | 1991-12-12 | 1993-07-19 | Berlex Laboratories, Inc. | Recombinant and chimeric antibodies to c-erbB-2 |
US5635177A (en) | 1992-01-22 | 1997-06-03 | Genentech, Inc. | Protein tyrosine kinase agonist antibodies |
US5837822A (en) * | 1992-01-27 | 1998-11-17 | Icos Corporation | Humanized antibodies specific for ICAM related protein |
ATE295420T1 (en) * | 1992-02-06 | 2005-05-15 | Chiron Corp | MARKER FOR CANCER AND BIOSYNTHETIC BINDING PROTEIN FOR IT |
GB9206422D0 (en) | 1992-03-24 | 1992-05-06 | Bolt Sarah L | Antibody preparation |
US7381803B1 (en) * | 1992-03-27 | 2008-06-03 | Pdl Biopharma, Inc. | Humanized antibodies against CD3 |
EP0563487A1 (en) | 1992-03-31 | 1993-10-06 | Laboratoire Europeen De Biotechnologie S.A. | Monoclonal antibodies against the interferon receptor, with neutralizing activity against type I interferon |
US5646253A (en) * | 1994-03-08 | 1997-07-08 | Memorial Sloan-Kettering Cancer Center | Recombinant human anti-LK26 antibodies |
US6033667A (en) * | 1992-05-05 | 2000-03-07 | Cytel Corporation | Method for detecting the presence of P-selectin |
DE4225853A1 (en) * | 1992-08-05 | 1994-02-10 | Behringwerke Ag | Granulocyte-binding antibody fragments, their production and use |
US6042828A (en) * | 1992-09-07 | 2000-03-28 | Kyowa Hakko Kogyo Co., Ltd. | Humanized antibodies to ganglioside GM2 |
US5639641A (en) * | 1992-09-09 | 1997-06-17 | Immunogen Inc. | Resurfacing of rodent antibodies |
US5958708A (en) * | 1992-09-25 | 1999-09-28 | Novartis Corporation | Reshaped monoclonal antibodies against an immunoglobulin isotype |
US6066718A (en) * | 1992-09-25 | 2000-05-23 | Novartis Corporation | Reshaped monoclonal antibodies against an immunoglobulin isotype |
GB9221654D0 (en) * | 1992-10-15 | 1992-11-25 | Scotgen Ltd | Recombinant human anti-cytomegalovirus antibodies |
GB9223377D0 (en) * | 1992-11-04 | 1992-12-23 | Medarex Inc | Humanized antibodies to fc receptors for immunoglobulin on human mononuclear phagocytes |
US5804187A (en) * | 1992-11-16 | 1998-09-08 | Cancer Research Fund Of Contra Costa | Modified antibodies with human milk fat globule specificity |
WO1994016094A2 (en) * | 1993-01-12 | 1994-07-21 | Biogen, Inc. | Recombinant anti-vla4 antibody molecules |
US6491916B1 (en) | 1994-06-01 | 2002-12-10 | Tolerance Therapeutics, Inc. | Methods and materials for modulation of the immunosuppresive activity and toxicity of monoclonal antibodies |
US5885573A (en) * | 1993-06-01 | 1999-03-23 | Arch Development Corporation | Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies |
US6180377B1 (en) * | 1993-06-16 | 2001-01-30 | Celltech Therapeutics Limited | Humanized antibodies |
WO1995001997A1 (en) * | 1993-07-09 | 1995-01-19 | Smithkline Beecham Corporation | RECOMBINANT AND HUMANIZED IL-1β ANTIBODIES FOR TREATMENT OF IL-1 MEDIATED INFLAMMATORY DISORDERS IN MAN |
EP0728017A1 (en) * | 1993-11-10 | 1996-08-28 | Bristol-Myers Squibb Company | Treatment of bacterially-induced inflammatory diseases |
EP0729976A1 (en) * | 1993-11-19 | 1996-09-04 | Chugai Seiyaku Kabushiki Kaisha | Reconstituted human antibody against human medulloblastomatous cell |
GB9325182D0 (en) * | 1993-12-08 | 1994-02-09 | T Cell Sciences Inc | Humanized antibodies or binding proteins thereof specific for t cell subpopulations exhibiting select beta chain variable regions |
WO1995023865A1 (en) * | 1994-03-03 | 1995-09-08 | Genentech, Inc. | Anti-il-8 monoclonal antibodies for treatment of inflammatory disorders |
US5597710A (en) * | 1994-03-10 | 1997-01-28 | Schering Corporation | Humanized monoclonal antibodies against human interleukin-4 |
ATE240395T1 (en) | 1994-03-29 | 2003-05-15 | Celltech Therapeutics Ltd | ANTIBODIES AGAINST E-SELECTIN |
WO1995031546A1 (en) * | 1994-04-28 | 1995-11-23 | Scotgen Biopharmaceuticals, Inc. | Recombinant human anti-varicella zoster virus antibodies |
US5773001A (en) * | 1994-06-03 | 1998-06-30 | American Cyanamid Company | Conjugates of methyltrithio antitumor agents and intermediates for their synthesis |
GB9412230D0 (en) | 1994-06-17 | 1994-08-10 | Celltech Ltd | Interleukin-5 specific recombiant antibodies |
USRE39548E1 (en) * | 1994-06-17 | 2007-04-03 | Celltech R&D Limited | Interleukin-5 specific recombinant antibodies |
US8771694B2 (en) * | 1994-08-12 | 2014-07-08 | Immunomedics, Inc. | Immunoconjugates and humanized antibodies specific for B-cell lymphoma and leukemia cells |
US5874540A (en) * | 1994-10-05 | 1999-02-23 | Immunomedics, Inc. | CDR-grafted type III anti-CEA humanized mouse monoclonal antibodies |
GB9424449D0 (en) * | 1994-12-02 | 1995-01-18 | Wellcome Found | Antibodies |
EP0746619A1 (en) * | 1994-12-23 | 1996-12-11 | Celltech Therapeutics Limited | Human phosphodiesterase type ivc, and its production and use |
PT796280E (en) * | 1994-12-28 | 2003-08-29 | Univ Kentucky | ANTI-IDIOTIPIC MONOCLONAL 3H1 ANTIBODY OF MURINOS |
US6949244B1 (en) * | 1995-12-20 | 2005-09-27 | The Board Of Trustees Of The University Of Kentucky | Murine monoclonal anti-idiotype antibody 11D10 and methods of use thereof |
US6551593B1 (en) | 1995-02-10 | 2003-04-22 | Millennium Pharmaceuticals, Inc. | Treatment of Inflammatory bowel disease by inhibiting binding and/or signalling through α 4 β 7 and its ligands and madcam |
US7803904B2 (en) | 1995-09-01 | 2010-09-28 | Millennium Pharmaceuticals, Inc. | Mucosal vascular addressing and uses thereof |
US5795961A (en) * | 1995-02-14 | 1998-08-18 | Ludwig Institute For Cancer Research | Recombinant human anti-Lewis b antibodies |
US5705154A (en) * | 1995-03-08 | 1998-01-06 | Schering Corporation | Humanized monoclonal antibodies against human interleukin-4 |
US7429646B1 (en) | 1995-06-05 | 2008-09-30 | Human Genome Sciences, Inc. | Antibodies to human tumor necrosis factor receptor-like 2 |
EP1161955A3 (en) * | 1995-05-18 | 2001-12-19 | Ortho Pharmaceutical Corporation | Induction of immunological tolerance for graft transplantation by the use of humanized non-depleting anti-cd4 antibodies in combination with specific donor bone marrow cells |
US7060808B1 (en) | 1995-06-07 | 2006-06-13 | Imclone Systems Incorporated | Humanized anti-EGF receptor monoclonal antibody |
US5712374A (en) * | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
WO1996040921A1 (en) | 1995-06-07 | 1996-12-19 | Ortho Farmaceutical Corporation | Cdr-grafted anti-tissue factor antibodies and methods of use thereof |
WO1997000271A1 (en) * | 1995-06-14 | 1997-01-03 | The Regents Of The University Of California | Novel high affinity human antibodies to tumor antigens |
DE19543039C1 (en) * | 1995-11-08 | 1996-11-21 | Medac Klinische Spezialpraep | DNA mols. encoding CD30-specific immunoglobulin variable regions |
US6090382A (en) | 1996-02-09 | 2000-07-18 | Basf Aktiengesellschaft | Human antibodies that bind human TNFα |
US7888466B2 (en) | 1996-01-11 | 2011-02-15 | Human Genome Sciences, Inc. | Human G-protein chemokine receptor HSATU68 |
MA24512A1 (en) * | 1996-01-17 | 1998-12-31 | Univ Vermont And State Agrienl | PROCESS FOR THE PREPARATION OF ANTICOAGULATING AGENTS USEFUL IN THE TREATMENT OF THROMBOSIS |
WO1997029131A1 (en) | 1996-02-09 | 1997-08-14 | Basf Aktiengesellschaft | HUMAN ANTIBODIES THAT BIND HUMAN TNF$g(a) |
US6635743B1 (en) | 1996-03-22 | 2003-10-21 | Human Genome Sciences, Inc. | Apoptosis inducing molecule II and methods of use |
US7964190B2 (en) | 1996-03-22 | 2011-06-21 | Human Genome Sciences, Inc. | Methods and compositions for decreasing T-cell activity |
US6136311A (en) * | 1996-05-06 | 2000-10-24 | Cornell Research Foundation, Inc. | Treatment and diagnosis of cancer |
US6107090A (en) * | 1996-05-06 | 2000-08-22 | Cornell Research Foundation, Inc. | Treatment and diagnosis of prostate cancer with antibodies to extracellur PSMA domains |
CA2257357C (en) | 1996-06-07 | 2010-04-13 | Neorx Corporation | Humanized antibodies with modified glycosylation |
US7147851B1 (en) | 1996-08-15 | 2006-12-12 | Millennium Pharmaceuticals, Inc. | Humanized immunoglobulin reactive with α4β7 integrin |
US20030017147A1 (en) * | 1996-09-20 | 2003-01-23 | Guy L Reed | Composition and method for enhancing fibrinolysis |
UA76934C2 (en) * | 1996-10-04 | 2006-10-16 | Chugai Pharmaceutical Co Ltd | Reconstructed human anti-hm 1.24 antibody, coding dna, vector, host cell, method for production of reconstructed human antibody, pharmaceutical composition and drug for treating myeloma containing reconstructed human anti-hm 1.24 antibody |
US7883872B2 (en) | 1996-10-10 | 2011-02-08 | Dyadic International (Usa), Inc. | Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose |
US6037454A (en) * | 1996-11-27 | 2000-03-14 | Genentech, Inc. | Humanized anti-CD11a antibodies |
US6737057B1 (en) * | 1997-01-07 | 2004-05-18 | The University Of Tennessee Research Corporation | Compounds, compositions and methods for the endocytic presentation of immunosuppressive factors |
US6455040B1 (en) | 1997-01-14 | 2002-09-24 | Human Genome Sciences, Inc. | Tumor necrosis factor receptor 5 |
US8329179B2 (en) | 1997-01-28 | 2012-12-11 | Human Genome Sciences, Inc. | Death domain containing receptor 4 antibodies and methods |
US7452538B2 (en) | 1997-01-28 | 2008-11-18 | Human Genome Sciences, Inc. | Death domain containing receptor 4 antibodies and methods |
EP1862548A1 (en) | 1997-01-28 | 2007-12-05 | Human Genome Sciences, Inc. | Death domain containing receptor 4 (DR4 : death receptor 4), member of the TNF-receptor superfamily and binding to trail (APO2-L) |
US6433147B1 (en) | 1997-01-28 | 2002-08-13 | Human Genome Sciences, Inc. | Death domain containing receptor-4 |
US6541212B2 (en) | 1997-03-10 | 2003-04-01 | The Regents Of The University Of California | Methods for detecting prostate stem cell antigen protein |
US6872568B1 (en) | 1997-03-17 | 2005-03-29 | Human Genome Sciences, Inc. | Death domain containing receptor 5 antibodies |
CA2644454A1 (en) * | 1997-03-17 | 1998-09-24 | Human Genome Sciences, Inc. | Death domain containing receptor 5 |
US20020032315A1 (en) | 1997-08-06 | 2002-03-14 | Manuel Baca | Anti-vegf antibodies |
JP3957765B2 (en) * | 1997-04-07 | 2007-08-15 | ジェネンテク・インコーポレイテッド | Anti-VEGF antibody |
ES2361267T3 (en) * | 1997-04-07 | 2011-06-15 | Genentech Inc. | PROCEDURE FOR THE PRODUCTION OF HUMANIZED ANTIBODIES THROUGH RANDOM MUTAGENESIS. |
US6884879B1 (en) | 1997-04-07 | 2005-04-26 | Genentech, Inc. | Anti-VEGF antibodies |
US20070059302A1 (en) | 1997-04-07 | 2007-03-15 | Genentech, Inc. | Anti-vegf antibodies |
EP0983303B1 (en) | 1997-05-21 | 2006-03-08 | Biovation Limited | Method for the production of non-immunogenic proteins |
RU2221809C2 (en) | 1997-10-03 | 2004-01-20 | Тугаи Сейяку Кабусики Кайся | Method for preparing natural humanized antibody |
TWI239847B (en) * | 1997-12-02 | 2005-09-21 | Elan Pharm Inc | N-terminal fragment of Abeta peptide and an adjuvant for preventing and treating amyloidogenic disease |
US6761888B1 (en) * | 2000-05-26 | 2004-07-13 | Neuralab Limited | Passive immunization treatment of Alzheimer's disease |
US7790856B2 (en) | 1998-04-07 | 2010-09-07 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
US7964192B1 (en) | 1997-12-02 | 2011-06-21 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidgenic disease |
US20080050367A1 (en) | 1998-04-07 | 2008-02-28 | Guriq Basi | Humanized antibodies that recognize beta amyloid peptide |
US7179892B2 (en) * | 2000-12-06 | 2007-02-20 | Neuralab Limited | Humanized antibodies that recognize beta amyloid peptide |
CA2323776C (en) | 1998-03-19 | 2010-04-27 | Human Genome Sciences, Inc. | Cytokine receptor common gamma chain like |
AU752730B2 (en) * | 1998-04-03 | 2002-09-26 | Chugai Seiyaku Kabushiki Kaisha | Humanized antibody against human tissue factor (TF) and process for constructing humanized antibody |
ES2203141T3 (en) * | 1998-04-21 | 2004-04-01 | Micromet Ag | POLYPEPTIDES CD19 X CD3 SPECIFICS AND ITS USE. |
US7244826B1 (en) | 1998-04-24 | 2007-07-17 | The Regents Of The University Of California | Internalizing ERB2 antibodies |
CA2327505A1 (en) * | 1998-04-28 | 1999-11-04 | Smithkline Beecham Corporation | Monoclonal antibodies with reduced immunogenicity |
US6455677B1 (en) * | 1998-04-30 | 2002-09-24 | Boehringer Ingelheim International Gmbh | FAPα-specific antibody with improved producibility |
GB9812545D0 (en) | 1998-06-10 | 1998-08-05 | Celltech Therapeutics Ltd | Biological products |
GB9815909D0 (en) * | 1998-07-21 | 1998-09-16 | Btg Int Ltd | Antibody preparation |
US6727349B1 (en) | 1998-07-23 | 2004-04-27 | Millennium Pharmaceuticals, Inc. | Recombinant anti-CCR2 antibodies and methods of use therefor |
US6312689B1 (en) | 1998-07-23 | 2001-11-06 | Millennium Pharmaceuticals, Inc. | Anti-CCR2 antibodies and methods of use therefor |
US6696550B2 (en) | 1998-07-23 | 2004-02-24 | Millennium Pharmaceuticals, Inc. | Humanized anti-CCR2 antibodies and methods of use therefor |
KR100618495B1 (en) | 1998-10-06 | 2006-08-31 | 마크 아론 에말파브 | Transformation system in the field of filamentous fungal hosts: in chrysosporium |
US6160099A (en) * | 1998-11-24 | 2000-12-12 | Jonak; Zdenka Ludmila | Anti-human αv β3 and αv β5 antibodies |
NZ552959A (en) | 1998-11-27 | 2008-06-30 | Darwin Discovery Ltd | Compositions and methods for increasing bone mineralization |
US20040009535A1 (en) | 1998-11-27 | 2004-01-15 | Celltech R&D, Inc. | Compositions and methods for increasing bone mineralization |
EP2357192A1 (en) | 1999-02-26 | 2011-08-17 | Human Genome Sciences, Inc. | Human endokine alpha and methods of use |
US6492497B1 (en) * | 1999-04-30 | 2002-12-10 | Cambridge Antibody Technology Limited | Specific binding members for TGFbeta1 |
US20030086924A1 (en) * | 1999-06-25 | 2003-05-08 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
US20040013667A1 (en) * | 1999-06-25 | 2004-01-22 | Genentech, Inc. | Treatment with anti-ErbB2 antibodies |
US6949245B1 (en) * | 1999-06-25 | 2005-09-27 | Genentech, Inc. | Humanized anti-ErbB2 antibodies and treatment with anti-ErbB2 antibodies |
TR200201530T2 (en) * | 1999-09-22 | 2003-03-21 | Ortho-Mcneil Pharmaceutical, Inc. | Cell-based assay. |
EP1238985B1 (en) * | 1999-09-30 | 2008-03-05 | Kyowa Hakko Kogyo Co., Ltd. | Human type complementarity determining region transplantation antibody against ganglioside gd3 and derivatives of antibody against ganglioside gd3 |
US6346249B1 (en) * | 1999-10-22 | 2002-02-12 | Ludwig Institute For Cancer Research | Methods for reducing the effects of cancers that express A33 antigen using A33 antigen specific immunoglobulin products |
US6342587B1 (en) * | 1999-10-22 | 2002-01-29 | Ludwig Institute For Cancer Research | A33 antigen specific immunoglobulin products and uses thereof |
CU22921A1 (en) * | 1999-11-16 | 2004-02-20 | Centro Inmunologia Molecular | CHEMICAL, HUMANIZED ANTIBODIES AND THE SIMPLE CHAIN FV TYPE FRAGMENT RECOGNIZING ANTIGEN C2. ITS USE IN THE DIAGNOSIS AND TREATMENT OF COLORECTURAL TUMORS |
GB0001448D0 (en) | 2000-01-21 | 2000-03-08 | Novartis Ag | Organic compounds |
WO2001055217A1 (en) * | 2000-01-27 | 2001-08-02 | Medimmune, Inc. | Ultra high affinity neutralizing antibodies |
US7229619B1 (en) | 2000-11-28 | 2007-06-12 | Medimmune, Inc. | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
EP1783227A1 (en) * | 2000-02-03 | 2007-05-09 | Millennium Pharmaceuticals, Inc. | Humanized anti-CCR2 antibodies and methods of use therefor |
ES2293973T3 (en) * | 2000-02-03 | 2008-04-01 | Millennium Pharm Inc | ANTIBODIES ANTI-CCR2 HUMANIZED AND METHODS OF USE OF THE SAME. |
WO2001058949A2 (en) | 2000-02-11 | 2001-08-16 | Biogen, Inc. | Heterologous polypeptide of the tnf family |
EP1257584B2 (en) | 2000-02-24 | 2013-03-06 | Washington University St. Louis | Humanized antibodies that sequester amyloid beta peptide |
JP2003525061A (en) * | 2000-03-01 | 2003-08-26 | メディミューン,インコーポレイテッド | High potency recombinant antibody and method for producing the same |
US20030143226A1 (en) * | 2000-03-02 | 2003-07-31 | Yuko Kobayashi | Human monoclonal antibodies against oxidized ldl receptor and medicinal use thereof |
WO2001070266A2 (en) | 2000-03-17 | 2001-09-27 | Millennium Pharmaceuticals, Inc. | Method of inhibiting stenosis and restenosis with a mixture of antibodies anti cd18 and anti ccr2 |
CA2405912A1 (en) | 2000-04-12 | 2001-10-18 | Human Genome Sciences, Inc. | Albumin fusion proteins |
EP1881004B1 (en) | 2000-04-21 | 2012-07-25 | Fuso Pharmaceutical Industries, Ltd. | Novel collectin |
US20030031675A1 (en) | 2000-06-06 | 2003-02-13 | Mikesell Glen E. | B7-related nucleic acids and polypeptides useful for immunomodulation |
GB0013810D0 (en) | 2000-06-06 | 2000-07-26 | Celltech Chiroscience Ltd | Biological products |
AU2001282856A1 (en) | 2000-06-15 | 2001-12-24 | Human Genome Sciences, Inc. | Human tumor necrosis factor delta and epsilon |
WO2002002641A1 (en) | 2000-06-16 | 2002-01-10 | Human Genome Sciences, Inc. | Antibodies that immunospecifically bind to blys |
UA81743C2 (en) * | 2000-08-07 | 2008-02-11 | Центокор, Инк. | HUMAN MONOCLONAL ANTIBODY WHICH SPECIFICALLY BINDS TUMOR NECROSIS FACTOR ALFA (TNFα), PHARMACEUTICAL MIXTURE CONTAINING THEREOF, AND METHOD FOR TREATING ARTHRITIS |
GB0020685D0 (en) | 2000-08-22 | 2000-10-11 | Novartis Ag | Organic compounds |
US7060802B1 (en) * | 2000-09-18 | 2006-06-13 | The Trustees Of Columbia University In The City Of New York | Tumor-associated marker |
TR200602095T2 (en) | 2000-10-13 | 2007-02-21 | Biogen Idec Ma Inc. | Humanized Anti-LT-Beta-R antibodies |
US7179900B2 (en) * | 2000-11-28 | 2007-02-20 | Medimmune, Inc. | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
US6989247B2 (en) | 2000-11-28 | 2006-01-24 | Celltech R & D, Inc. | Compositions and methods for diagnosing or treating psoriasis |
US6855493B2 (en) | 2000-11-28 | 2005-02-15 | Medimmune, Inc. | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
JP4434580B2 (en) | 2000-11-28 | 2010-03-17 | メディミューン,エルエルシー | Methods for administering / prescribing anti-RSV antibodies for prevention and treatment |
PE20020574A1 (en) * | 2000-12-06 | 2002-07-02 | Wyeth Corp | HUMANIZED ANTIBODIES THAT RECOGNIZE THE AMYLOID PEPTIDE BETA |
US7700751B2 (en) | 2000-12-06 | 2010-04-20 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize β-amyloid peptide |
EP2354149B1 (en) | 2000-12-12 | 2017-08-30 | MedImmune, LLC | Molecules with extended half-lives, compositions and uses thereof |
CA2433800C (en) | 2001-01-05 | 2016-09-13 | Pfizer Inc. | Antibodies to insulin-like growth factor i receptor |
US7754208B2 (en) | 2001-01-17 | 2010-07-13 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
US20020147312A1 (en) * | 2001-02-02 | 2002-10-10 | O'keefe Theresa | Hybrid antibodies and uses thereof |
WO2002064612A2 (en) | 2001-02-09 | 2002-08-22 | Human Genome Sciences, Inc. | Human g-protein chemokine receptor (ccr5) hdgnr10 |
EP1366455B1 (en) | 2001-02-19 | 2008-07-02 | MERCK PATENT GmbH | Method for identification of t-cell epitopes and use for preparing molecules with reduced immunogenicity |
CA2441042A1 (en) * | 2001-03-15 | 2002-09-26 | International Bioimmune Systems, Inc. | Monoclonal antibody therapy for pancreas cancer |
US8981061B2 (en) | 2001-03-20 | 2015-03-17 | Novo Nordisk A/S | Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof |
US8231878B2 (en) | 2001-03-20 | 2012-07-31 | Cosmo Research & Development S.P.A. | Receptor trem (triggering receptor expressed on myeloid cells) and uses thereof |
ATE470676T1 (en) | 2001-04-13 | 2010-06-15 | Human Genome Sciences Inc | ANTI-VEGF-2 ANTIBODIES |
US7361341B2 (en) | 2001-05-25 | 2008-04-22 | Human Genome Sciences, Inc. | Methods of treating cancer using antibodies that immunospecifically bind to trail receptors |
US7348003B2 (en) | 2001-05-25 | 2008-03-25 | Human Genome Sciences, Inc. | Methods of treating cancer using antibodies that immunospecifically bind to TRAIL receptors |
MXPA03010747A (en) | 2001-05-25 | 2004-03-02 | Human Genome Sciences Inc | Antibodies that immunospecifically bind to trail receptors. |
CA2385745C (en) | 2001-06-08 | 2015-02-17 | Abbott Laboratories (Bermuda) Ltd. | Methods of administering anti-tnf.alpha. antibodies |
US6867189B2 (en) | 2001-07-26 | 2005-03-15 | Genset S.A. | Use of adipsin/complement factor D in the treatment of metabolic related disorders |
TWI327597B (en) | 2001-08-01 | 2010-07-21 | Centocor Inc | Anti-tnf antibodies, compositions, methods and uses |
JP4729717B2 (en) † | 2001-08-03 | 2011-07-20 | 株式会社医学生物学研究所 | Antibody that recognizes GM1 ganglioside-binding amyloid β protein, and DNA encoding the antibody |
US7771722B2 (en) | 2001-08-17 | 2010-08-10 | Eli Lilly And Company | Assay method for alzheimer's disease |
US8129504B2 (en) | 2001-08-30 | 2012-03-06 | Biorexis Technology, Inc. | Oral delivery of modified transferrin fusion proteins |
WO2003025124A2 (en) * | 2001-09-14 | 2003-03-27 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Immunoglobulin having particular framework scaffold and methods of making and using |
GB0124317D0 (en) | 2001-10-10 | 2001-11-28 | Celltech R&D Ltd | Biological products |
IL161417A0 (en) * | 2001-10-15 | 2004-09-27 | Immunomedics Inc | Affinity enhancement agents |
JP4347694B2 (en) * | 2001-10-16 | 2009-10-21 | レイベン バイオテクノロジーズ,インコーポレイティド | Antibody binding to cancer-associated antigen CD46 and method of use thereof |
US20040151721A1 (en) | 2001-10-19 | 2004-08-05 | O'keefe Theresa | Humanized anti-CCR2 antibodies and methods of use therefor |
WO2003063768A2 (en) * | 2001-10-25 | 2003-08-07 | Euro-Celtique S.A. | Compositions and methods directed to anthrax toxin |
ES2307832T3 (en) * | 2001-12-03 | 2008-12-01 | Amgen Fremont Inc. | ANTIBODY CLASSIFICATION BASED ON THE CHARACTERISTICS OF UNION. |
JP2005512043A (en) * | 2001-12-03 | 2005-04-28 | アブジェニックス・インコーポレーテッド | Discovery of therapeutic products |
WO2003048730A2 (en) * | 2001-12-03 | 2003-06-12 | Abgenix, Inc. | Identification of high affinity molecules by limited dilution screening |
GB0129105D0 (en) | 2001-12-05 | 2002-01-23 | Celltech R&D Ltd | Expression control using variable intergenic sequences |
ES2545090T3 (en) | 2001-12-21 | 2015-09-08 | Human Genome Sciences, Inc. | Albumin and GCSF fusion proteins |
MY139983A (en) | 2002-03-12 | 2009-11-30 | Janssen Alzheimer Immunotherap | Humanized antibodies that recognize beta amyloid peptide |
WO2003086458A1 (en) | 2002-04-12 | 2003-10-23 | Medimmune, Inc. | Recombinant anti-interleukin-9 antibodies |
US20040009172A1 (en) * | 2002-04-26 | 2004-01-15 | Steven Fischkoff | Use of anti-TNFalpha antibodies and another drug |
ATE518884T1 (en) | 2002-05-01 | 2011-08-15 | Human Genome Sciences Inc | ANTIBODIES SPECIFICALLY BINDING TO CHEMOKIN BETA-4 |
AU2012244218C1 (en) * | 2002-05-02 | 2016-12-15 | Wyeth Holdings Llc. | Calicheamicin derivative-carrier conjugates |
GB0210121D0 (en) | 2002-05-02 | 2002-06-12 | Celltech R&D Ltd | Biological products |
SI1507556T1 (en) | 2002-05-02 | 2016-10-28 | Wyeth Holdings Llc | Calicheamicin derivative-carrier conjugates |
IL149820A0 (en) * | 2002-05-23 | 2002-11-10 | Curetech Ltd | Humanized immunomodulatory monoclonal antibodies for the treatment of neoplastic disease or immunodeficiency |
ATE518885T1 (en) | 2002-05-28 | 2011-08-15 | Ucb Pharma Sa | PEG POSITION ISOMER OF AN ANTIBODY TO TNFALPHA (CDP870) |
NZ537579A (en) | 2002-06-10 | 2006-10-27 | Vaccinex Inc | C35 peptide epitopes and their analogs |
US7425618B2 (en) | 2002-06-14 | 2008-09-16 | Medimmune, Inc. | Stabilized anti-respiratory syncytial virus (RSV) antibody formulations |
US7132100B2 (en) | 2002-06-14 | 2006-11-07 | Medimmune, Inc. | Stabilized liquid anti-RSV antibody formulations |
EP1551453A4 (en) | 2002-06-17 | 2007-04-25 | Us Gov Health & Human Serv | Specificity grafting of a murine antibody onto a human framework |
US9321832B2 (en) | 2002-06-28 | 2016-04-26 | Domantis Limited | Ligand |
EP1539793A4 (en) | 2002-07-01 | 2006-02-01 | Humanized anti-lymphotoyin beta receptor antibodies | |
PL213925B1 (en) * | 2002-07-19 | 2013-05-31 | Abbott Biotech Ltd | Treatment of tnf ó related disorders |
CA2495251C (en) | 2002-08-14 | 2018-03-06 | Macrogenics, Inc. | Fc.gamma.riib-specific antibodies and methods of use thereof |
EP1542609B8 (en) | 2002-08-29 | 2013-02-20 | CytoCure LLC | Pharmaceutical compositions comprising Interferon beta for use in treating melanoma |
CA2501616C (en) | 2002-10-08 | 2015-05-12 | Immunomedics, Inc. | Antibody therapy |
EP2298806A1 (en) | 2002-10-16 | 2011-03-23 | Purdue Pharma L.P. | Antibodies that bind cell-associated CA 125/0722P and methods of use thereof |
MY150740A (en) * | 2002-10-24 | 2014-02-28 | Abbvie Biotechnology Ltd | Low dose methods for treating disorders in which tnf? activity is detrimental |
EP1560597A4 (en) * | 2002-10-29 | 2007-06-27 | Pharmacia Corp | Differentially expressed genes involved in cancer, the polypeptides encoded thereby, and methods of using the same |
WO2004039845A1 (en) * | 2002-10-31 | 2004-05-13 | Universita'degli Studi Di Roma 'la Sapienza' | Antimicrobial lipase antibodies their nucleotide and aminoacid sequences and uses thereof |
EP1900753B1 (en) | 2002-11-08 | 2017-08-09 | Ablynx N.V. | Method of administering therapeutic polypeptides, and polypeptides therefor |
US20060228355A1 (en) | 2003-11-07 | 2006-10-12 | Toon Laeremans | Camelidae single domain antibodies vhh directed against epidermal growth factor receptor and uses therefor |
US7405061B2 (en) * | 2002-11-13 | 2008-07-29 | Raven Biotechnologies, Inc. | Antigen PIPA and antibodies that bind thereto |
AU2003300817A1 (en) | 2002-11-21 | 2004-06-18 | Celltech R And D, Inc. | Modulating immune responses |
AU2003298783B2 (en) | 2002-11-26 | 2010-11-04 | Abbvie Biotherapeutics Inc. | Chimeric and humanized antibodies to alpha5beta1 integrin that modulate angiogenesis |
US7276372B2 (en) | 2002-12-20 | 2007-10-02 | Pdl Biopharma, Inc. | Antibodies against GPR64 and uses thereof |
AU2004204494B2 (en) | 2003-01-09 | 2011-09-29 | Macrogenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
AU2004205684A1 (en) * | 2003-01-23 | 2004-08-05 | Genentech, Inc. | Methods for producing humanized antibodies and improving yield of antibodies or antigen binding fragments in cell culture |
DE10303974A1 (en) | 2003-01-31 | 2004-08-05 | Abbott Gmbh & Co. Kg | Amyloid β (1-42) oligomers, process for their preparation and their use |
RU2390350C2 (en) * | 2003-02-01 | 2010-05-27 | Ньюралаб Лимитед | Active immunisation for creating soluble a-beta antibodies |
DE602004027348D1 (en) * | 2003-02-10 | 2010-07-08 | Applied Molecular Evolution | ABETA-BINDING MOLECULES |
GB0303337D0 (en) | 2003-02-13 | 2003-03-19 | Celltech R&D Ltd | Biological products |
AU2004212953B2 (en) | 2003-02-14 | 2010-03-11 | The Curators Of The University Of Missouri | Contraceptive methods and compositions related to proteasomal interference |
ES2347959T3 (en) | 2003-02-20 | 2010-11-26 | Seattle Genetics, Inc. | ANTI-CD70-FARMACO ANTIBODIES CONJUGATES AND THEIR USE FOR CANCER TREATMENT. |
US7785829B2 (en) | 2003-03-19 | 2010-08-31 | Biogen Idec Ma, Inc. | Nogo receptor binding protein |
EP1460088A1 (en) | 2003-03-21 | 2004-09-22 | Biotest AG | Humanized anti-CD4 antibody with immunosuppressive properties |
KR20110094361A (en) | 2003-04-11 | 2011-08-23 | 메디뮨 엘엘씨 | Recombinant il-9 antibodies and uses thereof |
CN100409897C (en) | 2003-04-23 | 2008-08-13 | 梅达雷克斯公司 | Compositions and methods for the therapy of inflammatory bowel disease |
GB0312481D0 (en) | 2003-05-30 | 2003-07-09 | Celltech R&D Ltd | Antibodies |
TWI374893B (en) | 2003-05-30 | 2012-10-21 | Janssen Alzheimer Immunotherap | Humanized antibodies that recognize beta amyloid peptide |
US9708410B2 (en) | 2003-05-30 | 2017-07-18 | Janssen Biotech, Inc. | Anti-tissue factor antibodies and compositions |
US7605235B2 (en) | 2003-05-30 | 2009-10-20 | Centocor, Inc. | Anti-tissue factor antibodies and compositions |
AU2004242846A1 (en) | 2003-05-31 | 2004-12-09 | Micromet Ag | Pharmaceutical compositions comprising bispecific anti-CD3, anti-CD19 antibody constructs for the treatment of B-cell related disorders |
EP1636270B1 (en) | 2003-06-16 | 2016-07-20 | UCB Pharma S.A. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
CA2529945A1 (en) | 2003-06-27 | 2005-01-06 | Biogen Idec Ma Inc. | Use of hydrophobic-interaction-chromatography or hinge-region modifications for the production of homogeneous antibody-solutions |
EP1644408A1 (en) | 2003-07-15 | 2006-04-12 | Barros Research Institute | Eimeria tenella antigen for immunotherapy of coccidiosis |
TW201319088A (en) * | 2003-07-18 | 2013-05-16 | Amgen Inc | Specific binding agents to hepatocyte growth factor |
DK1660513T5 (en) * | 2003-07-21 | 2011-07-18 | Immunogen Inc | CA6 antigen-specific, cytotoxic conjugate and methods for its use |
US7834155B2 (en) | 2003-07-21 | 2010-11-16 | Immunogen Inc. | CA6 antigen-specific cytotoxic conjugate and methods of using the same |
US7727752B2 (en) | 2003-07-29 | 2010-06-01 | Life Technologies Corporation | Kinase and phosphatase assays |
WO2005014795A2 (en) | 2003-08-08 | 2005-02-17 | Genenews Inc. | Osteoarthritis biomarkers and uses thereof |
MXPA06001634A (en) | 2003-08-13 | 2006-04-28 | Pfizer Prod Inc | Modified human igf-1r antibodies. |
AU2004286198C1 (en) | 2003-08-18 | 2011-02-24 | Medimmune, Llc | Humanization of antibodies |
US20060228350A1 (en) * | 2003-08-18 | 2006-10-12 | Medimmune, Inc. | Framework-shuffling of antibodies |
WO2005035575A2 (en) * | 2003-08-22 | 2005-04-21 | Medimmune, Inc. | Humanization of antibodies |
GB0321100D0 (en) | 2003-09-09 | 2003-10-08 | Celltech R&D Ltd | Biological products |
EP1673398B1 (en) | 2003-10-16 | 2010-12-29 | Micromet AG | Multispecific deimmunized cd3-binders |
ES2393555T3 (en) | 2003-10-22 | 2012-12-26 | Keck Graduate Institute | Methods for the synthesis of hetero-multimeric polypeptides in yeasts using a haploid mating strategy. |
EP1695093A1 (en) * | 2003-12-05 | 2006-08-30 | multimmune GmbH | Compositions and methods for the treatment and diagnosis of neoplastic and infectious diseases |
PL1703893T3 (en) | 2003-12-23 | 2012-09-28 | Genentech Inc | Novel anti-il 13 antibodies and uses thereof |
EP3476861A1 (en) | 2004-01-07 | 2019-05-01 | Novartis Vaccines and Diagnostics, Inc. | M-csf-specific monoclonal antibody and uses thereof |
JPWO2005068504A1 (en) | 2004-01-19 | 2008-01-10 | 株式会社医学生物学研究所 | Inflammatory cytokine inhibitor |
AU2005211725B2 (en) | 2004-02-09 | 2010-07-15 | Human Genome Sciences, Inc. | Albumin fusion proteins |
WO2005077417A1 (en) | 2004-02-10 | 2005-08-25 | The Regents Of The University Of Colorado | Inhibition of factor b, the alternative complement pathway and methods related thereto |
KR20060132006A (en) | 2004-03-23 | 2006-12-20 | 비오겐 아이덱 엠에이 아이엔씨. | Receptor coupling agents and therapeutic uses thereof |
EP1786463A4 (en) | 2004-03-26 | 2009-05-20 | Human Genome Sciences Inc | Antibodies against nogo receptor |
TWI439284B (en) | 2004-04-09 | 2014-06-01 | Abbvie Biotechnology Ltd | Multiple-variable dose regimen for treating tnfα-related disorders |
ES2526194T3 (en) | 2004-06-21 | 2015-01-08 | E. R. Squibb & Sons, L.L.C. | Interferon alfa 1 receptor antibodies, and their uses |
BRPI0512500A (en) | 2004-06-24 | 2008-03-11 | Biogen Idec Inc | treatment or conditions involving demyelination |
AU2005259992A1 (en) * | 2004-06-25 | 2006-01-12 | Medimmune, Llc | Increasing the production of recombinant antibodies in mammalian cells by site-directed mutagenesis |
GB0414886D0 (en) | 2004-07-02 | 2004-08-04 | Neutec Pharma Plc | Treatment of bacterial infections |
BRPI0513200A (en) | 2004-07-16 | 2008-04-29 | Pfizer Prod Inc | use of an anti-igf-1r antibody in the preparation of a medicament for combined treatment for nonhematological malignancies |
CA2575901C (en) * | 2004-08-02 | 2015-01-27 | Amrad Operations Pty. Ltd. | A method of treating cancer comprising a vegf-b antagonist |
EP1789070B1 (en) | 2004-08-03 | 2012-10-24 | Biogen Idec MA Inc. | Taj in neuronal function |
CN101123994B (en) | 2004-08-16 | 2012-11-14 | 夸克医药公司 | Therapeutic uses of inhibitors of rtp801 |
US20060045877A1 (en) | 2004-08-30 | 2006-03-02 | Goldmakher Viktor S | Immunoconjugates targeting syndecan-1 expressing cells and use thereof |
WO2006034292A2 (en) | 2004-09-21 | 2006-03-30 | Medimmune, Inc. | Antibodies against and methods for producing vaccines for respiratory syncytial virus |
WO2006041970A2 (en) * | 2004-10-08 | 2006-04-20 | Abbott Biotechnology Ltd. | Treatment of respiratory syncytial virus (rsv) infection |
CA2585717A1 (en) | 2004-10-27 | 2006-05-04 | Medimmune Inc. | Modulation of antibody specificity by tailoring the affinity to cognate antigens |
JP2008518936A (en) * | 2004-10-29 | 2008-06-05 | メディミューン,インコーポレーテッド | Methods for preventing and treating RSV infections and related conditions |
GB0426146D0 (en) | 2004-11-29 | 2004-12-29 | Bioxell Spa | Therapeutic peptides and method |
WO2006061723A2 (en) | 2004-12-06 | 2006-06-15 | Kirin Beer Kabushiki Kaisha | Human monoclonal antibodies to influenza m2 protein and methods of making and using same |
AR051800A1 (en) * | 2004-12-15 | 2007-02-07 | Wyeth Corp | BETA ANTIBODIES USED TO IMPROVE COGNITION |
US7625560B2 (en) * | 2004-12-15 | 2009-12-01 | Janssen Alzheimer Immunotherapy | Humanized antibodies that recognize beta amyloid peptide |
CA2590337C (en) | 2004-12-15 | 2017-07-11 | Neuralab Limited | Humanized amyloid beta antibodies for use in improving cognition |
WO2006074399A2 (en) | 2005-01-05 | 2006-07-13 | Biogen Idec Ma Inc. | Multispecific binding molecules comprising connecting peptides |
EP2446897A1 (en) | 2005-01-06 | 2012-05-02 | Novo Nordisk A/S | Anti-KIR combination treatments and methods |
CN101495498B (en) | 2005-02-07 | 2013-09-18 | 基因信息公司 | Mild osteoarthritis biomarkers and uses thereof |
JP5651285B2 (en) | 2005-02-15 | 2015-01-07 | デューク ユニバーシティ | Anti-CD19 antibodies and use in oncology |
EP1858545A2 (en) | 2005-03-04 | 2007-11-28 | Curedm Inc. | Methods and pharmaceutical compositions for treating type 1 diabetes mellitus and other conditions |
CA2602035C (en) | 2005-03-18 | 2015-06-16 | Medimmune, Inc. | Framework-shuffling of antibodies |
EP1863531A1 (en) | 2005-03-19 | 2007-12-12 | Medical Research Council | Improvements in or relating to treatment and prevention of viral infections |
RS59399B1 (en) | 2005-03-23 | 2019-11-29 | Genmab As | Antibodies against cd38 for treatment of multiple myeloma |
ES2707152T3 (en) | 2005-04-15 | 2019-04-02 | Macrogenics Inc | Covalent diabodies and uses thereof |
DK1871418T3 (en) | 2005-04-19 | 2014-06-10 | Seattle Genetics Inc | Humanized anti-CD70 binding agents and uses thereof |
WO2006117910A1 (en) | 2005-04-28 | 2006-11-09 | Mochida Pharmaceutical Co., Ltd. | Monoclonal antibody against platelet membrane glycoprotein vi |
AU2006244445B2 (en) | 2005-05-05 | 2013-04-18 | Duke University | Anti-CD19 antibody therapy for autoimmune disease |
ES2561628T3 (en) | 2005-05-06 | 2016-02-29 | Zymogenetics, Inc. | IL-31 monoclonal antibodies and methods of use |
WO2006121159A1 (en) * | 2005-05-12 | 2006-11-16 | Kyowa Hakko Kogyo Co., Ltd. | Humanized cdr-grafted antibody specifically reacting with cd10 and antibody fragment of the same |
CA2903138A1 (en) | 2005-05-16 | 2006-11-23 | Abbvie Biotechnology Ltd. | Use of tnfa inhibitor for treatment of erosive polyarthritis |
EP2949668B1 (en) | 2005-05-18 | 2019-08-14 | Ablynx N.V. | Improved nanobodies tm against tumor necrosis factor-alpha |
EP1915394B1 (en) | 2005-05-20 | 2021-01-27 | Lonza Biologics plc. | High-level expression of recombinant antibody in a mammalian host cell |
CA2608873C (en) | 2005-05-20 | 2017-04-25 | Ablynx Nv | Single domain vhh antibodies against von willebrand factor |
JP2008545712A (en) | 2005-05-25 | 2008-12-18 | キュアーディーエム、インク. | Peptides, derivatives and analogs thereof, and methods of using them |
WO2006128006A1 (en) | 2005-05-26 | 2006-11-30 | The Regents Of The University Of Colorado | Inhibition of the alternative complement pathway for treatment of traumatic brain injury, spinal cord injury and related conditions |
EP3260465A1 (en) * | 2005-06-07 | 2017-12-27 | ESBATech, an Alcon Biomedical Research Unit LLC | Stable and soluble antibodies inhibiting tnf-alpha |
EP1893647A2 (en) | 2005-06-23 | 2008-03-05 | MedImmune, Inc. | Antibody formulations having optimized aggregation and fragmentation profiles |
CN101379085B (en) | 2005-06-30 | 2013-03-27 | Abbvie公司 | IL-12/P40 binding proteins |
BRPI0613387A2 (en) | 2005-07-08 | 2011-01-11 | Biogen Idec Inc | isolated antibody or antigen binding fragment thereof and its use, isolated polynucleotide, composition, vector, host cell, anti-sp35 antibody and method for producing the same, isolated polypeptide, in vitro method for reducing inhibition of axonal growth and in vitro method for inhibiting cone collapse growth |
WO2007008604A2 (en) | 2005-07-08 | 2007-01-18 | Bristol-Myers Squibb Company | Single nucleotide polymorphisms associated with dose-dependent edema and methods of use thereof |
US8663634B2 (en) | 2005-07-11 | 2014-03-04 | Macrogenics, Inc. | Methods for the treatment of autoimmune disorders using immunosuppressive monoclonal antibodies with reduced toxicity |
SI2298815T1 (en) | 2005-07-25 | 2015-08-31 | Emergent Product Development Seattle, Llc | B-cell reduction using CD37-specific and CD20-specific binding molecules |
WO2007016285A2 (en) | 2005-07-28 | 2007-02-08 | Novartis Ag | M-csf specific monoclonal antibody and uses thereof |
DK2573114T3 (en) | 2005-08-10 | 2016-07-04 | Macrogenics Inc | The identification and production of antibodies with variant Fc regions, and methods of using same |
EP2500359A3 (en) | 2005-08-19 | 2012-10-17 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
WO2007024715A2 (en) | 2005-08-19 | 2007-03-01 | Abbott Laboratories | Dual variable domain immunoglobin and uses thereof |
US7612181B2 (en) | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
US20070041905A1 (en) * | 2005-08-19 | 2007-02-22 | Hoffman Rebecca S | Method of treating depression using a TNF-alpha antibody |
BRPI0616438A2 (en) | 2005-09-29 | 2012-12-25 | Eisai R&D Man Co Ltd | protein, polynucleotide, antibody against a secretory or membrane protein, or a functional fragment thereof, hybridoma, therapeutic agent for an autoimmune disease, agent for inhibiting t-cell adhesion, and method for screening for a substance |
CA2624562A1 (en) | 2005-09-30 | 2007-04-12 | Abbott Gmbh & Co. Kg | Binding domains of proteins of the repulsive guidance molecule (rgm) protein family and functional fragments thereof, and their use |
ES2856451T3 (en) | 2005-10-11 | 2021-09-27 | Amgen Res Munich Gmbh | Compositions comprising specific antibodies for different species, and uses thereof |
CA2626604A1 (en) | 2005-10-21 | 2007-04-26 | Genenews Inc. | Method and apparatus for correlating levels of biomarker products with disease |
UA99591C2 (en) | 2005-11-04 | 2012-09-10 | Дженентек, Инк. | Use of complement pathway inhibitors to treat ocular diseases |
CA2628451A1 (en) | 2005-11-04 | 2007-05-18 | Biogen Idec Ma Inc. | Methods for promoting neurite outgrowth and survival of dopaminergic neurons |
CA2628238A1 (en) | 2005-11-07 | 2007-05-18 | The Scripps Research Institute | Compositions and methods for controlling tissue factor signaling specificity |
TWI461436B (en) | 2005-11-25 | 2014-11-21 | Kyowa Hakko Kirin Co Ltd | Human monoclonal antibody human cd134 (ox40) and methods of making and using same |
KR20180058863A (en) | 2005-11-30 | 2018-06-01 | 애브비 인코포레이티드 | Monoclonal antibodies against amyloid beta protein and uses thereof |
US8691224B2 (en) | 2005-11-30 | 2014-04-08 | Abbvie Inc. | Anti-Aβ globulomer 5F7 antibodies |
EP1965827B1 (en) | 2005-12-02 | 2015-02-25 | Biogen Idec MA Inc. | Treatment of conditions involving demyelination |
UA96141C2 (en) | 2005-12-09 | 2011-10-10 | Юсиби Фарма, С.А. | Neutralising antibody having specificity for human il-6 |
GB0525214D0 (en) * | 2005-12-12 | 2006-01-18 | Bioinvent Int Ab | Biological materials and uses thereof |
ES2595091T3 (en) | 2005-12-21 | 2016-12-27 | Amgen Research (Munich) Gmbh | Pharmaceutical compositions with soluble CEA resistance |
NZ569697A (en) | 2006-01-20 | 2012-01-12 | Women S & Children S Health Res Inst | Method of treatment, prophylaxis and diagnosis of pathologies of the bone by the modulation of GPC3 |
NL2000439C2 (en) | 2006-01-20 | 2009-03-16 | Quark Biotech | Therapeutic applications of inhibitors of RTP801. |
EP1981902B1 (en) | 2006-01-27 | 2015-07-29 | Biogen MA Inc. | Nogo receptor antagonists |
US8389688B2 (en) | 2006-03-06 | 2013-03-05 | Aeres Biomedical, Ltd. | Humanized anti-CD22 antibodies and their use in treatment of oncology, transplantation and autoimmune disease |
AR059809A1 (en) | 2006-03-10 | 2008-04-30 | Wyeth Corp | ANTI-5T4 ANTIBODIES AND THEIR USES |
PL1999152T3 (en) | 2006-03-27 | 2013-05-31 | Medimmune Ltd | Binding member for gm-csf receptor |
KR20090005315A (en) * | 2006-04-05 | 2009-01-13 | 애보트 바이오테크놀로지 리미티드 | Antibody purification |
EP2004231A4 (en) | 2006-04-07 | 2013-07-10 | Nektar Therapeutics | Conjugates of an anti-tnf-alpha antibody |
EP2666472A3 (en) | 2006-04-10 | 2014-04-02 | Abbott Biotechnology Ltd | Uses and compositions for treatment of psoriatic arthritis |
US20090317399A1 (en) * | 2006-04-10 | 2009-12-24 | Pollack Paul F | Uses and compositions for treatment of CROHN'S disease |
US20080118496A1 (en) * | 2006-04-10 | 2008-05-22 | Medich John R | Uses and compositions for treatment of juvenile rheumatoid arthritis |
US9399061B2 (en) | 2006-04-10 | 2016-07-26 | Abbvie Biotechnology Ltd | Methods for determining efficacy of TNF-α inhibitors for treatment of rheumatoid arthritis |
US9605064B2 (en) | 2006-04-10 | 2017-03-28 | Abbvie Biotechnology Ltd | Methods and compositions for treatment of skin disorders |
US8784810B2 (en) | 2006-04-18 | 2014-07-22 | Janssen Alzheimer Immunotherapy | Treatment of amyloidogenic diseases |
WO2009017467A1 (en) | 2007-07-27 | 2009-02-05 | Elan Pharma International Limited | Treatment of amyloidogenic diseases |
US20080131374A1 (en) * | 2006-04-19 | 2008-06-05 | Medich John R | Uses and compositions for treatment of rheumatoid arthritis |
US8377448B2 (en) | 2006-05-15 | 2013-02-19 | The Board Of Trustees Of The Leland Standford Junior University | CD47 related compositions and methods for treating immunological diseases and disorders |
JP2009539841A (en) * | 2006-06-06 | 2009-11-19 | トラークス,インコーポレイテッド | Administration of anti-CD3 antibodies in the treatment of autoimmune diseases |
AT503690A1 (en) | 2006-06-09 | 2007-12-15 | Biomay Ag | HYPOALLERGENIC MOLECULES |
EP2037961B1 (en) | 2006-06-14 | 2015-11-11 | MacroGenics, Inc. | Methods for the treatment of autoimmune disorders using monoclonal antibodies with reduced toxicity |
ES2599319T3 (en) * | 2006-06-26 | 2017-02-01 | Macrogenics, Inc. | Fc RIIB specific antibodies and their methods of use |
EP2032159B1 (en) | 2006-06-26 | 2015-01-07 | MacroGenics, Inc. | Combination of fcgammariib antibodies and cd20-specific antibodies and methods of use thereof |
CN103316403B (en) | 2006-06-30 | 2017-05-24 | 艾伯维生物技术有限公司 | Automatic injection device |
US7572618B2 (en) | 2006-06-30 | 2009-08-11 | Bristol-Myers Squibb Company | Polynucleotides encoding novel PCSK9 variants |
JP5829004B2 (en) | 2006-06-30 | 2015-12-09 | ノボ・ノルデイスク・エー/エス | Anti-NKG2A antibody and use thereof |
GB0613209D0 (en) * | 2006-07-03 | 2006-08-09 | Ucb Sa | Methods |
KR101528939B1 (en) | 2006-07-18 | 2015-06-15 | 사노피 | Antagonist antibody against epha2 for the treatment of cancer |
CA2658654A1 (en) | 2006-07-24 | 2008-01-31 | Biorexis Pharmaceutical Corporation | Exendin fusion proteins |
GB0614780D0 (en) | 2006-07-25 | 2006-09-06 | Ucb Sa | Biological products |
JP5406027B2 (en) | 2006-08-04 | 2014-02-05 | ノバルティス アーゲー | EphB3-specific antibodies and uses thereof |
TW200817438A (en) | 2006-08-17 | 2008-04-16 | Hoffmann La Roche | A conjugate of an antibody against CCR5 and an antifusogenic peptide |
AR062435A1 (en) | 2006-08-18 | 2008-11-05 | Xoma Technology Ltd | PRLR SPECIFIC ANTIBODY (PROLACTIN RECEPTOR) AND ITS USES |
EP2064243A2 (en) | 2006-08-28 | 2009-06-03 | Kyowa Hakko Kirin Co., Ltd. | Antagonistic human light-specific human monoclonal antibodies |
SI2594586T1 (en) | 2006-09-01 | 2014-11-28 | Zymogenetics, Inc. | IL-31 monoclonal antibodies and methods of use |
MY188368A (en) | 2006-09-08 | 2021-12-06 | Abbott Lab | Interleukin-13 binding proteins |
EP2407548A1 (en) | 2006-10-16 | 2012-01-18 | MedImmune, LLC | Molecules with reduced half-lives, compositions and uses thereof |
GB0620729D0 (en) | 2006-10-18 | 2006-11-29 | Ucb Sa | Biological products |
EP1914242A1 (en) | 2006-10-19 | 2008-04-23 | Sanofi-Aventis | Novel anti-CD38 antibodies for the treatment of cancer |
CN101626785A (en) | 2006-11-17 | 2010-01-13 | 财团法人阪大微生物病研究会 | Nerve elongation promoter and elongation inhibitor |
WO2008064306A2 (en) | 2006-11-22 | 2008-05-29 | Curedm, Inc. | Methods and compositions relating to islet cell neogenesis |
US20080199475A1 (en) | 2006-11-27 | 2008-08-21 | Patrys Limited | Novel glycosylated peptide target in neoplastic cells |
US8455626B2 (en) | 2006-11-30 | 2013-06-04 | Abbott Laboratories | Aβ conformer selective anti-aβ globulomer monoclonal antibodies |
TW200831528A (en) | 2006-11-30 | 2008-08-01 | Astrazeneca Ab | Compounds |
PT2099823E (en) | 2006-12-01 | 2014-12-22 | Seattle Genetics Inc | Variant target binding agents and uses thereof |
EP2687232A1 (en) | 2006-12-06 | 2014-01-22 | MedImmune, LLC | Methods of treating systemic lupus erythematosus |
MX2009006034A (en) | 2006-12-07 | 2009-10-12 | Novartis Ag | Antagonist antibodies against ephb3. |
EP2102366A4 (en) | 2006-12-10 | 2010-01-27 | Dyadic International Inc | Expression and high-throughput screening of complex expressed dna libraries in filamentous fungi |
EP2099827B1 (en) | 2006-12-18 | 2018-11-21 | Genentech, Inc. | Antagonist anti-notch3 antibodies and their use in the prevention and treatment of notch3-related diseases |
WO2008074839A2 (en) | 2006-12-19 | 2008-06-26 | Ablynx N.V. | Amino acid sequences directed against gpcrs and polypeptides comprising the same for the treatment of gpcr-related diseases and disorders |
EP2514767A1 (en) | 2006-12-19 | 2012-10-24 | Ablynx N.V. | Amino acid sequences directed against a metalloproteinase from the ADAM family and polypeptides comprising the same for the treatment of ADAM-related diseases and disorders |
US8128926B2 (en) | 2007-01-09 | 2012-03-06 | Biogen Idec Ma Inc. | Sp35 antibodies and uses thereof |
DK2068887T3 (en) | 2007-01-09 | 2014-05-19 | Biogen Idec Inc | SP35 antibodies and their applications |
JP5867795B2 (en) | 2007-02-01 | 2016-02-24 | テーツェーエフ ゲゼルシャフト ミット ベシュレンクテル ハフツング | Specific activation of regulatory T cells and their use for the treatment of asthma, allergic diseases, autoimmune diseases, graft rejection and induction of immune tolerance |
WO2008098139A2 (en) | 2007-02-07 | 2008-08-14 | The Regents Of The University Of Colorado | Axl tyrosine kinase inhibitors and methods of making and using the same |
EP1958645A1 (en) | 2007-02-13 | 2008-08-20 | Biomay AG | Peptides derived from the major allergen of ragweed (Ambrosia artemisiifolia) and uses thereof |
AR065368A1 (en) | 2007-02-15 | 2009-06-03 | Astrazeneca Ab | ANTIBODIES FOR IGE MOLECULES |
WO2008101184A2 (en) | 2007-02-16 | 2008-08-21 | The Board Of Trustees Of Southern Illinois University | Arl-1 specific antibodies |
US8685666B2 (en) | 2007-02-16 | 2014-04-01 | The Board Of Trustees Of Southern Illinois University | ARL-1 specific antibodies and uses thereof |
US20100311767A1 (en) | 2007-02-27 | 2010-12-09 | Abbott Gmbh & Co. Kg | Method for the treatment of amyloidoses |
TW200902544A (en) | 2007-03-13 | 2009-01-16 | Hoffmann La Roche | Peptide-complement conjugates |
DK2125894T3 (en) | 2007-03-22 | 2019-03-18 | Biogen Ma Inc | BINDING PROTEINS, INCLUDING ANTIBODIES, ANTIBODY DERIVATIVES AND ANTIBODY FRAGMENTS, SPECIFICALLY BINDING CD154 AND APPLICATIONS THEREOF |
US8557588B2 (en) * | 2007-03-27 | 2013-10-15 | Schlumberger Technology Corporation | Methods and apparatus for sampling and diluting concentrated emulsions |
US20100209434A1 (en) | 2007-03-30 | 2010-08-19 | Medimmune, Llc | Antibody formulation |
US8003097B2 (en) | 2007-04-18 | 2011-08-23 | Janssen Alzheimer Immunotherapy | Treatment of cerebral amyloid angiopathy |
ES2540807T3 (en) | 2007-05-04 | 2015-07-13 | Technophage, Investigação E Desenvolvimento Em Biotecnologia, Sa | Variable domains of rabbit antibodies modified by genetic engineering and uses thereof |
WO2008143666A2 (en) | 2007-05-17 | 2008-11-27 | Genentech, Inc. | Crystal structures of neuropilin fragments and neuropilin-antibody complexes |
NZ599278A (en) | 2007-05-14 | 2013-12-20 | Medimmune Llc | Methods of reducing eosinophil levels |
US9701747B2 (en) | 2007-05-21 | 2017-07-11 | Alderbio Holdings Llc | Method of improving patient survivability and quality of life by anti-IL-6 antibody administration |
US8252286B2 (en) | 2007-05-21 | 2012-08-28 | Alderbio Holdings Llc | Antagonists of IL-6 to prevent or treat thrombosis |
US7906117B2 (en) | 2007-05-21 | 2011-03-15 | Alderbio Holdings Llc | Antagonists of IL-6 to prevent or treat cachexia, weakness, fatigue, and/or fever |
PT3187506T (en) | 2007-05-21 | 2019-04-24 | Alderbio Holdings Llc | Antibodies to il-6 and use thereof |
US8062864B2 (en) | 2007-05-21 | 2011-11-22 | Alderbio Holdings Llc | Nucleic acids encoding antibodies to IL-6, and recombinant production of anti-IL-6 antibodies |
US8404235B2 (en) | 2007-05-21 | 2013-03-26 | Alderbio Holdings Llc | Antagonists of IL-6 to raise albumin and/or lower CRP |
NZ601583A (en) * | 2007-05-21 | 2013-08-30 | Bristol Myers Squibb Co | Novel rabbit antibody humanization methods and humanized rabbit antibodies |
US8178101B2 (en) | 2007-05-21 | 2012-05-15 | Alderbio Holdings Inc. | Use of anti-IL-6 antibodies having specific binding properties to treat cachexia |
EP1997830A1 (en) | 2007-06-01 | 2008-12-03 | AIMM Therapeutics B.V. | RSV specific binding molecules and means for producing them |
US8999337B2 (en) | 2007-06-11 | 2015-04-07 | Abbvie Biotechnology Ltd. | Methods for treating juvenile idiopathic arthritis by inhibition of TNFα |
US8613923B2 (en) | 2007-06-12 | 2013-12-24 | Ac Immune S.A. | Monoclonal antibody |
US8048420B2 (en) | 2007-06-12 | 2011-11-01 | Ac Immune S.A. | Monoclonal antibody |
EP3424951A1 (en) | 2007-06-21 | 2019-01-09 | MacroGenics, Inc. | Covalent diabodies and uses thereof |
GB0712503D0 (en) | 2007-06-27 | 2007-08-08 | Therapeutics Pentraxin Ltd | Use |
AR067584A1 (en) | 2007-07-20 | 2009-10-14 | Hoffmann La Roche | A CONJUGATE OF AN ANTIBODY AGAINST CD4 AND ANTIFUSOGENIC PEPTIDES |
US8551751B2 (en) | 2007-09-07 | 2013-10-08 | Dyadic International, Inc. | BX11 enzymes having xylosidase activity |
CN111909273B (en) | 2007-08-29 | 2024-03-26 | 塞诺菲-安万特股份有限公司 | humanized anti-CXCR 5 antibodies, derivatives thereof and uses thereof |
MY165889A (en) | 2007-08-30 | 2018-05-18 | Curedm Group Holdings Llc | Compositions and methods of using proislet peptides and analogs thereof |
KR20100072228A (en) * | 2007-08-31 | 2010-06-30 | 유니버시티 오브 시카고 | Methods and compositions related to immunizing against staphylococcal lung diseases and conditions |
GB0717337D0 (en) | 2007-09-06 | 2007-10-17 | Ucb Pharma Sa | Method of treatment |
WO2009039310A2 (en) | 2007-09-18 | 2009-03-26 | La Jolla Institute For Allergy And Immunology | Light inhibitors for asthma, lung and airway inflammation, respiratory, interstitial, pulmonary and fibrotic disease treatment |
ES2667729T3 (en) | 2007-09-26 | 2018-05-14 | Ucb Biopharma Sprl | Fusions of antibodies with double specificity |
SG178809A1 (en) * | 2007-10-05 | 2012-03-29 | Genentech Inc | Use of anti-amyloid beta antibody in ocular diseases |
SI2238166T1 (en) | 2007-10-05 | 2014-03-31 | Genentech, Inc. | Use of anti-amyloid beta antibody in ocular diseases |
EP2050764A1 (en) | 2007-10-15 | 2009-04-22 | sanofi-aventis | Novel polyvalent bispecific antibody format and uses thereof |
JO3076B1 (en) | 2007-10-17 | 2017-03-15 | Janssen Alzheimer Immunotherap | Immunotherapy regimes dependent on apoe status |
ES2557352T3 (en) | 2007-11-05 | 2016-01-25 | Medimmune, Llc | Methods of treatment of scleroderma |
CA2703519C (en) | 2007-11-09 | 2017-04-18 | The Salk Institute For Biological Studies | Use of tam receptor inhibitors as immunoenhancers and tam activators as immunosuppressors |
EP2586797A3 (en) | 2007-11-27 | 2013-07-24 | Medtronic, Inc. | Humanized anti-amyloid beta antibodies |
JP5490714B2 (en) | 2007-11-28 | 2014-05-14 | メディミューン,エルエルシー | Protein preparation |
KR101603109B1 (en) | 2007-12-07 | 2016-03-25 | 지모제넥틱스, 인코포레이티드 | Humanized antibody molecules specific for il-31 |
CA3102704A1 (en) | 2007-12-14 | 2009-06-25 | Novo Nordisk A/S | Antibodies against human nkg2d and uses thereof |
CA2710680C (en) | 2007-12-26 | 2018-10-16 | Vaccinex, Inc. | Anti-c35 antibody combination therapies and methods |
HUE024291T2 (en) | 2007-12-26 | 2016-01-28 | Biotest Ag | Immunoconjugates targeting cd138 and uses thereof |
RU2537265C2 (en) | 2007-12-26 | 2014-12-27 | Биотест Аг | Cd138-targeted cell agents and using them |
US9011864B2 (en) | 2007-12-26 | 2015-04-21 | Biotest Ag | Method of decreasing cytotoxic side-effects and improving efficacy of immunoconjugates |
ES2543201T3 (en) | 2007-12-26 | 2015-08-17 | Biotest Ag | Methods and agents that improve the direction to tumor cells expressing CD138 |
GB0800277D0 (en) | 2008-01-08 | 2008-02-13 | Imagination Tech Ltd | Video motion compensation |
CA2711771C (en) * | 2008-01-11 | 2017-01-24 | Gene Techno Science Co., Ltd. | Humanized anti-.alpha.9 integrin antibodies and the uses thereof |
CN104188911A (en) | 2008-01-15 | 2014-12-10 | Abbvie德国有限责任两合公司 | Powdered protein compositions and methods of making same |
WO2009092011A1 (en) | 2008-01-18 | 2009-07-23 | Medimmune, Llc | Cysteine engineered antibodies for site-specific conjugation |
EP2247619A1 (en) | 2008-01-24 | 2010-11-10 | Novo Nordisk A/S | Humanized anti-human nkg2a monoclonal antibody |
ES2848323T3 (en) | 2008-01-31 | 2021-08-06 | Inst Nat Sante Rech Med | Antibodies against human CD39 and their use to inhibit the activity of regulatory T cells |
KR101666229B1 (en) | 2008-02-08 | 2016-10-14 | 메디뮨 엘엘씨 | Anti-ifnar1 antibodies with reduced fc ligand affinity |
US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
ES2569217T3 (en) | 2008-03-13 | 2016-05-09 | Biotest Ag | Agent to treat diseases |
KR20100135808A (en) | 2008-03-13 | 2010-12-27 | 바이오테스트 아게 | Agent for treating disease |
MX2010010028A (en) | 2008-03-13 | 2011-08-17 | Biotest Ag | Agent for treating disease. |
EP2260102A1 (en) | 2008-03-25 | 2010-12-15 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Treating cancer by down-regulating frizzled-4 and/or frizzled-1 |
JPWO2009119794A1 (en) | 2008-03-27 | 2011-07-28 | タカラバイオ株式会社 | Infectious disease prevention and treatment |
CA2720013C (en) | 2008-04-03 | 2016-02-16 | Bart De Strooper | Single domain antibodies capable of modulating bace activity |
US9908943B2 (en) | 2008-04-03 | 2018-03-06 | Vib Vzw | Single domain antibodies capable of modulating BACE activity |
EP2260058A2 (en) | 2008-04-07 | 2010-12-15 | Ablynx N.V. | Single variable domains against the notch pathways |
WO2009126944A1 (en) | 2008-04-11 | 2009-10-15 | Trubion Pharmaceuticals, Inc. | Cd37 immunotherapeutic and combination with bifunctional chemotherapeutic thereof |
GB0807413D0 (en) | 2008-04-23 | 2008-05-28 | Ucb Pharma Sa | Biological products |
WO2009131256A1 (en) | 2008-04-24 | 2009-10-29 | Gene Techno Science Co., Ltd. | Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof |
EP2282769A4 (en) | 2008-04-29 | 2012-04-25 | Abbott Lab | Dual variable domain immunoglobulins and uses thereof |
CA2723197C (en) | 2008-05-02 | 2017-09-19 | Seattle Genetics, Inc. | Methods and compositions for making antibodies and antibody derivatives with reduced core fucosylation |
WO2009136382A2 (en) | 2008-05-09 | 2009-11-12 | Abbott Gmbh & Co. Kg | Antibodies to receptor of advanced glycation end products (rage) and uses thereof |
CA2724208C (en) | 2008-05-16 | 2018-02-06 | Ablynx Nv | Amino acid sequences directed against cxcr4 and other gpcrs and compounds comprising the same |
WO2009148896A2 (en) | 2008-05-29 | 2009-12-10 | Nuclea Biotechnologies, LLC | Anti-phospho-akt antibodies |
CA2726131C (en) | 2008-05-29 | 2018-03-13 | Baoming Jiang | Expression and assembly of human group c rotavirus-like particles and uses thereof |
JP2011523853A (en) | 2008-06-03 | 2011-08-25 | アボット・ラボラトリーズ | Dual variable domain immunoglobulins and uses thereof |
KR20110016959A (en) | 2008-06-03 | 2011-02-18 | 아보트 러보러터리즈 | Dual variable domain immunoglobulins and uses thereof |
ES2595362T3 (en) | 2008-06-16 | 2016-12-29 | Patrys Limited | LM antibodies, functional fragments, LM-1 target antigen and methods to prepare and use them |
PL2307458T3 (en) | 2008-06-25 | 2018-08-31 | Esbatech, An Alcon Biomedical Research Unit Llc | Humanization of rabbit antibodies using a universal antibody framework |
RU2567100C2 (en) * | 2008-06-25 | 2015-10-27 | ИЭсБиЭйТЕК, ЭН АЛЬКОН БАЙОМЕДИКАЛ РИСЕРЧ ЮНИТ ЭлЭлСи | STABLE AND SOLUBLE ANTIBODIES INHIBITING TNFα |
HUE032894T2 (en) | 2008-06-25 | 2017-11-28 | Esbatech Alcon Biomed Res Unit | Stable and soluble antibodies inhibiting vegf |
RU2559525C2 (en) | 2008-07-08 | 2015-08-10 | Эббви Инк | Proteins binding prostaglandin e2 and using them |
SG192489A1 (en) | 2008-07-08 | 2013-08-30 | Abbott Lab | Prostaglandin e2 dual variable domain immunoglobulins and uses thereof |
NZ590605A (en) | 2008-07-09 | 2012-11-30 | Biogen Idec Inc | Compositions comprising antibodies to lingo or fragments thereof |
JP5692746B2 (en) | 2008-08-07 | 2015-04-01 | 国立大学法人 長崎大学 | Treatment or prevention of systemic pain syndrome |
BRPI0823049A2 (en) | 2008-09-07 | 2015-06-16 | Glyconex Inc | Anti-extended type 1 glycosphingolipid antibodies, derivatives thereof and use. |
US8937046B2 (en) | 2008-09-22 | 2015-01-20 | The Regents Of The University Of Colorado, A Body Corporate | Modulating the alternative complement pathway |
US10981998B2 (en) | 2008-10-01 | 2021-04-20 | Amgen Research (Munich) Gmbh | Cross-species-specific single domain bispecific single chain antibody |
CA2738565C (en) | 2008-10-01 | 2023-10-10 | Micromet Ag | Cross-species-specific psmaxcd3 bispecific single chain antibody |
EP2355847A1 (en) | 2008-10-07 | 2011-08-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neutralizing antibodies and fragments thereof directed against platelet factor-4 variant 1 (pf4v1) |
AU2009308422B2 (en) | 2008-10-24 | 2017-01-05 | The Government of the United States of America as represented by The Secretary, Department of Health and Human Services, Center for Disease Control and Prevention | Human Ebola virus species and compositions and methods thereof |
US9067981B1 (en) | 2008-10-30 | 2015-06-30 | Janssen Sciences Ireland Uc | Hybrid amyloid-beta antibodies |
US8415291B2 (en) | 2008-10-31 | 2013-04-09 | Centocor Ortho Biotech Inc. | Anti-TNF alpha fibronectin type III domain based scaffold compositions, methods and uses |
US8298533B2 (en) | 2008-11-07 | 2012-10-30 | Medimmune Limited | Antibodies to IL-1R1 |
WO2010052288A1 (en) | 2008-11-07 | 2010-05-14 | Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research | Teneurin and cancer |
US8337847B2 (en) | 2008-11-25 | 2012-12-25 | Alderbio Holdings Llc | Methods of treating anemia using anti-IL-6 antibodies |
US8992920B2 (en) | 2008-11-25 | 2015-03-31 | Alderbio Holdings Llc | Anti-IL-6 antibodies for the treatment of arthritis |
US8420089B2 (en) | 2008-11-25 | 2013-04-16 | Alderbio Holdings Llc | Antagonists of IL-6 to raise albumin and/or lower CRP |
US9452227B2 (en) | 2008-11-25 | 2016-09-27 | Alderbio Holdings Llc | Methods of treating or diagnosing conditions associated with elevated IL-6 using anti-IL-6 antibodies or fragments |
US9212223B2 (en) | 2008-11-25 | 2015-12-15 | Alderbio Holdings Llc | Antagonists of IL-6 to prevent or treat thrombosis |
US8323649B2 (en) | 2008-11-25 | 2012-12-04 | Alderbio Holdings Llc | Antibodies to IL-6 and use thereof |
EP2191841A1 (en) | 2008-11-28 | 2010-06-02 | Sanofi-Aventis | Antitumor combinations containing antibodies recognizing specifically CD38 and vincristine |
EP2191842A1 (en) | 2008-11-28 | 2010-06-02 | Sanofi-Aventis | Antitumor combinations containing antibodies recognizing specifically CD38 and cytarabine |
EP2191843A1 (en) | 2008-11-28 | 2010-06-02 | Sanofi-Aventis | Antitumor combinations containing antibodies recognizing specifically CD38 and cyclophosphamide |
EP2191840A1 (en) | 2008-11-28 | 2010-06-02 | Sanofi-Aventis | Antitumor combinations containing antibodies recognizing specifically CD38 and melphalan |
EP2198884A1 (en) | 2008-12-18 | 2010-06-23 | Centre National de la Recherche Scientifique (CNRS) | Monoclonal antibodies directed against LG4-5 domain of alpha3 chain of human laminin-5 |
JP5734201B2 (en) | 2008-12-19 | 2015-06-17 | マクロジェニクス,インコーポレーテッド | Covalently bonded diabody and use thereof |
WO2010078526A1 (en) | 2008-12-31 | 2010-07-08 | Biogen Idec Ma Inc. | Anti-lymphotoxin antibodies |
GB0900425D0 (en) | 2009-01-12 | 2009-02-11 | Ucb Pharma Sa | Biological products |
WO2010082134A1 (en) | 2009-01-14 | 2010-07-22 | Iq Therapeutics Bv | Combination antibodies for the treatment and prevention of disease caused by bacillus anthracis and related bacteria and their toxins |
US20130122052A1 (en) | 2009-01-20 | 2013-05-16 | Homayoun H. Zadeh | Antibody mediated osseous regeneration |
RU2011135768A (en) | 2009-01-29 | 2013-03-10 | Эбботт Лэборетриз | PROTEINS BINDING IL-1 |
WO2010087927A2 (en) | 2009-02-02 | 2010-08-05 | Medimmune, Llc | Antibodies against and methods for producing vaccines for respiratory syncytial virus |
US20110014190A1 (en) | 2009-02-12 | 2011-01-20 | Human Genome Sciences, Inc. | Use of b lymphocyte stimulator protein antagonists to promote transplantation tolerance |
CA2752510C (en) | 2009-02-17 | 2024-01-23 | Neil Bander | Methods and kits for diagnosis of cancer and prediction of therapeutic value |
LT2398498T (en) | 2009-02-17 | 2019-01-10 | Ucb Biopharma Sprl | Antibody molecules having specificity for human ox40 |
GB0902916D0 (en) | 2009-02-20 | 2009-04-08 | Fusion Antibodies Ltd | Antibody therapy |
US8030026B2 (en) | 2009-02-24 | 2011-10-04 | Abbott Laboratories | Antibodies to troponin I and methods of use thereof |
PE20121094A1 (en) | 2009-03-05 | 2012-09-13 | Abbvie Inc | IL-17 BINDING PROTEINS |
US20110311521A1 (en) | 2009-03-06 | 2011-12-22 | Pico Caroni | Novel therapy for anxiety |
EP2406285B1 (en) | 2009-03-10 | 2016-03-09 | Gene Techno Science Co., Ltd. | Generation, expression and characterization of the humanized k33n monoclonal antibody |
GB0904214D0 (en) | 2009-03-11 | 2009-04-22 | Ucb Pharma Sa | Biological products |
UA108349C2 (en) * | 2009-03-16 | 2015-04-27 | Сефалон Острейліа Пті Лтд | Humanized antibody with antitumor activity |
EP3002296B1 (en) | 2009-03-17 | 2020-04-29 | Université d'Aix-Marseille | Btla antibodies and uses thereof |
RU2542394C2 (en) | 2009-03-24 | 2015-02-20 | ТЕВА БИОФАРМАСЬЮТИКАЛЗ ЮЭсЭй, ИНК. | Humanised anti-light antibodies and using them |
JPWO2010110346A1 (en) | 2009-03-24 | 2012-10-04 | 独立行政法人理化学研究所 | Leukemia stem cell marker |
JP5647222B2 (en) | 2009-04-10 | 2014-12-24 | アブリンクス エン.ヴェー. | Improved amino acid sequence directed against IL-6R for the treatment of IL-6R related diseases and disorders and polypeptides comprising the same |
WO2010117057A1 (en) | 2009-04-10 | 2010-10-14 | 協和発酵キリン株式会社 | Method for treatment of blood tumor using anti-tim-3 antibody |
EP2241323A1 (en) | 2009-04-14 | 2010-10-20 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Tenascin-W and brain cancers |
US8722860B2 (en) | 2009-04-16 | 2014-05-13 | Abbvie Biotherapeutics Inc. | Anti-TNF-α antibodies and their uses |
KR101732201B1 (en) | 2009-04-27 | 2017-05-02 | 교와 핫꼬 기린 가부시키가이샤 | Anti-il-3r antibody for use in treatment of blood tumor |
CA2761310C (en) | 2009-05-07 | 2017-02-28 | Charles S. Craik | Antibodies and methods of use thereof |
FR2945538B1 (en) | 2009-05-12 | 2014-12-26 | Sanofi Aventis | HUMANIZED ANTIBODIES SPECIFIC TO THE PROTOFIBRILLARY FORM OF THE BETA-AMYLOID PEPTIDE. |
US8945567B2 (en) | 2009-06-05 | 2015-02-03 | Ablynx N.V. | Monovalent, bivalent and trivalent anti human respiratory syncytial virus (HRSV) nanobody constructs for the prevention and/or treatment of respiratory tract infections |
WO2010142603A1 (en) | 2009-06-08 | 2010-12-16 | Vib Vzw | Screening for compounds that modulate gpr3-mediated beta-arrestin signaling and amyloid beta peptide generation |
US8609097B2 (en) * | 2009-06-10 | 2013-12-17 | Hoffmann-La Roche Inc. | Use of an anti-Tau pS422 antibody for the treatment of brain diseases |
DK2443149T3 (en) | 2009-06-15 | 2016-12-12 | Vib Vzw | BACE1 inhibitory ANTIBODIES |
EP2443150B1 (en) | 2009-06-17 | 2015-01-21 | AbbVie Biotherapeutics Inc. | Anti-vegf antibodies and their uses |
US20120213705A1 (en) | 2009-06-22 | 2012-08-23 | Medimmune, Llc | ENGINEERED Fc REGIONS FOR SITE-SPECIFIC CONJUGATION |
WO2011003098A1 (en) | 2009-07-02 | 2011-01-06 | Musc Foundation For Research Development | Methods of stimulating liver regeneration |
JP5946766B2 (en) | 2009-07-03 | 2016-07-06 | ビオノール イミュノ エーエスBionor Immuno As | Combinations or fusions of HIV-related peptides for use in HIV vaccine compositions or as diagnostic tools |
JP5762408B2 (en) | 2009-08-13 | 2015-08-12 | クルセル ホランド ベー ヴェー | Antibodies against human respiratory syncytial virus (RSV) and methods of use |
JP5883384B2 (en) | 2009-08-13 | 2016-03-15 | ザ ジョンズ ホプキンス ユニバーシティー | How to regulate immune function |
EP2292266A1 (en) | 2009-08-27 | 2011-03-09 | Novartis Forschungsstiftung, Zweigniederlassung | Treating cancer by modulating copine III |
CN102002104A (en) | 2009-08-28 | 2011-04-06 | 江苏先声药物研究有限公司 | Anti-VEGF monoclonal antibody and medicinal composition containing same |
EP2470568A2 (en) | 2009-08-29 | 2012-07-04 | Abbott Laboratories | Therapeutic dll4 binding proteins |
CA2771335A1 (en) | 2009-08-31 | 2011-03-03 | Abbott Biotherapeutics Corp. | Use of an immunoregulatory nk cell population for monitoring the efficacy of anti-il-2r antibodies in multiple sclerosis patients |
SG178602A1 (en) | 2009-09-01 | 2012-04-27 | Abbott Lab | Dual variable domain immunoglobulins and uses thereof |
EP2480573A1 (en) | 2009-09-22 | 2012-08-01 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Treating cancer by modulating mex-3 |
GB201005063D0 (en) | 2010-03-25 | 2010-05-12 | Ucb Pharma Sa | Biological products |
UY32914A (en) | 2009-10-02 | 2011-04-29 | Sanofi Aventis | ANTIBODIES SPECIFICALLY USED TO THE EPHA2 RECEIVER |
US8568726B2 (en) | 2009-10-06 | 2013-10-29 | Medimmune Limited | RSV specific binding molecule |
JP5898082B2 (en) | 2009-10-07 | 2016-04-06 | マクロジェニクス,インコーポレーテッド | Fc region-containing polypeptide exhibiting improved effector function by changing the degree of fucosylation and use thereof |
BR112012008833A2 (en) | 2009-10-15 | 2015-09-08 | Abbott Lab | double variable domain immunoglobulins and uses thereof |
WO2011045352A2 (en) | 2009-10-15 | 2011-04-21 | Novartis Forschungsstiftung | Spleen tyrosine kinase and brain cancers |
EA201791876A1 (en) | 2009-10-16 | 2018-01-31 | Ле Лаборатуар Сервье | MONOCLONAL PROTECTIVE ANTIBODIES AND THEIR APPLICATION |
US9234037B2 (en) | 2009-10-27 | 2016-01-12 | Ucb Biopharma Sprl | Method to generate antibodies to ion channels |
EP2493926B1 (en) | 2009-10-27 | 2020-03-11 | UCB Biopharma SRL | Function modifying nav 1.7 antibodies |
GB0922434D0 (en) | 2009-12-22 | 2010-02-03 | Ucb Pharma Sa | antibodies and fragments thereof |
GB0922435D0 (en) | 2009-12-22 | 2010-02-03 | Ucb Pharma Sa | Method |
CA2777825A1 (en) | 2009-10-28 | 2011-05-19 | Abbott Biotherapeutics Corp. | Anti-egfr antibodies and their uses |
UY32979A (en) | 2009-10-28 | 2011-02-28 | Abbott Lab | IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME |
US9181527B2 (en) | 2009-10-29 | 2015-11-10 | The Trustees Of Dartmouth College | T cell receptor-deficient T cell compositions |
US9273283B2 (en) | 2009-10-29 | 2016-03-01 | The Trustees Of Dartmouth College | Method of producing T cell receptor-deficient T cells expressing a chimeric receptor |
US20120213801A1 (en) | 2009-10-30 | 2012-08-23 | Ekaterina Gresko | Phosphorylated Twist1 and cancer |
WO2011053777A1 (en) | 2009-10-30 | 2011-05-05 | Abbott Biotherapeutics Corp. | Use of immunoregulatory nk cell populations for predicting the efficacy of anti-il-2r antibodies in multiple sclerosis patients |
WO2011053707A1 (en) | 2009-10-31 | 2011-05-05 | Abbott Laboratories | Antibodies to receptor for advanced glycation end products (rage) and uses thereof |
JP5822841B2 (en) * | 2009-11-05 | 2015-11-24 | テバ・ファーマシューティカルズ・オーストラリア・ピーティワイ・リミテッド | Treatment of cancer containing mutant KRAS or BRAF gene |
EP2496604B1 (en) | 2009-11-06 | 2017-08-23 | IDEXX Laboratories, Inc. | Canine anti-cd20 antibodies |
US20120294852A1 (en) | 2009-11-24 | 2012-11-22 | Smith Jeffrey T L | Antagonists of il-6 to raise albumin and/or lower crp |
US9775921B2 (en) | 2009-11-24 | 2017-10-03 | Alderbio Holdings Llc | Subcutaneously administrable composition containing anti-IL-6 antibody |
GB0920944D0 (en) | 2009-11-30 | 2010-01-13 | Biotest Ag | Agents for treating disease |
CA2782459A1 (en) | 2009-12-04 | 2011-06-09 | Katholieke Universiteit Leuven, K.U.Leuven R&D | Arf6 as a new target for treating alzheimer's disease |
CA2780069C (en) | 2009-12-08 | 2018-07-17 | Abbott Gmbh & Co. Kg | Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration |
US8937159B2 (en) | 2009-12-16 | 2015-01-20 | Abbvie Biotherapeutics Inc. | Anti-HER2 antibodies and their uses |
KR20120105543A (en) | 2009-12-23 | 2012-09-25 | 4-안티바디 아게 | Binding members for human cytomegalovirus |
US8900588B2 (en) | 2010-01-08 | 2014-12-02 | Les Laboratories Servier | Methods for treating breast cancer |
US8900817B2 (en) | 2010-01-08 | 2014-12-02 | Les Laboratories Servier | Progastrin and liver pathologies |
US9217032B2 (en) | 2010-01-08 | 2015-12-22 | Les Laboratoires Servier | Methods for treating colorectal cancer |
GB201001791D0 (en) | 2010-02-03 | 2010-03-24 | Ucb Pharma Sa | Process for obtaining antibodies |
SG10201501562VA (en) | 2010-03-02 | 2015-04-29 | Abbvie Inc | Therapeutic dll4 binding proteins |
US9434716B2 (en) | 2011-03-01 | 2016-09-06 | Glaxo Group Limited | Antigen binding proteins |
EP2542578A1 (en) | 2010-03-05 | 2013-01-09 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Smoc1, tenascin-c and brain cancers |
WO2011110604A1 (en) | 2010-03-11 | 2011-09-15 | Ucb Pharma, S.A. | Pd-1 antibody |
TW201134488A (en) | 2010-03-11 | 2011-10-16 | Ucb Pharma Sa | PD-1 antibodies |
NZ602992A (en) | 2010-03-24 | 2014-11-28 | Servier Lab | Prophylaxis of colorectal and gastrointestinal cancer |
GB201005064D0 (en) | 2010-03-25 | 2010-05-12 | Ucb Pharma Sa | Biological products |
EP2550297B1 (en) | 2010-03-25 | 2019-01-23 | UCB Biopharma SPRL | Disulfide stabilized dvd-lg molecules |
TWI653333B (en) | 2010-04-01 | 2019-03-11 | 安進研究(慕尼黑)有限責任公司 | Cross-species specific PSMAxCD3 bispecific single chain antibody |
WO2011127580A1 (en) | 2010-04-14 | 2011-10-20 | National Research Council Of Canada | Compositions and methods for brain delivery of analgesic peptides |
US8987419B2 (en) | 2010-04-15 | 2015-03-24 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
CN103038257A (en) | 2010-04-16 | 2013-04-10 | 比奥根艾迪克Ma公司 | Anti-VLA-4 antibodies |
EP2561076A1 (en) | 2010-04-19 | 2013-02-27 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Modulating xrn1 |
UY33386A (en) | 2010-05-14 | 2011-12-30 | Abbott Laboratoires | IL-1 UNION PROTEINS |
WO2011149461A1 (en) | 2010-05-27 | 2011-12-01 | Medtronic, Inc. | Anti-amyloid beta antibodies conjugated to sialic acid-containing molecules |
EP2580239A1 (en) | 2010-06-10 | 2013-04-17 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Treating cancer by modulating mammalian sterile 20-like kinase 3 |
EP2582722A4 (en) * | 2010-06-19 | 2013-12-18 | Sloan Kettering Inst Cancer | Anti-gd2 antibodies |
AU2011268780A1 (en) | 2010-06-25 | 2013-02-07 | Aston University | Glycoproteins having lipid mobilizing properties and therapeutic uses thereof |
US20120009196A1 (en) | 2010-07-08 | 2012-01-12 | Abbott Laboratories | Monoclonal antibodies against hepatitis c virus core protein |
UY33492A (en) | 2010-07-09 | 2012-01-31 | Abbott Lab | IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME |
CN103097412B (en) | 2010-07-09 | 2016-08-10 | 克鲁塞尔荷兰公司 | Anti-human respiratory syncytial virus (RSV) antibody and using method |
WO2012010696A1 (en) | 2010-07-23 | 2012-01-26 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for cancer management targeting co-029 |
ES2871092T3 (en) | 2010-07-26 | 2021-10-28 | Progastrine Et Cancers S A R L | Methods and compositions for the therapy of liver cancer |
GB201012599D0 (en) | 2010-07-27 | 2010-09-08 | Ucb Pharma Sa | Process for purifying proteins |
MY164579A (en) | 2010-07-30 | 2018-01-15 | Ac Immune Sa | Safe and functional humanized antibodies |
CN103154025B (en) | 2010-08-02 | 2015-07-01 | 宏观基因有限公司 | Covalent diabodies and uses thereof |
MX341579B (en) | 2010-08-03 | 2016-08-25 | Abbvie Inc * | Dual variable domain immunoglobulins and uses thereof. |
CN103298833B (en) | 2010-08-14 | 2015-12-16 | Abbvie公司 | Amyloid beta associated proteins |
PL3333188T3 (en) | 2010-08-19 | 2022-05-09 | Zoetis Belgium S.A. | Anti-ngf antibodies and their use |
GB201014033D0 (en) | 2010-08-20 | 2010-10-06 | Ucb Pharma Sa | Biological products |
AU2011293253B2 (en) | 2010-08-26 | 2014-12-11 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
EP2614080A1 (en) | 2010-09-10 | 2013-07-17 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Research | Phosphorylated twist1 and metastasis |
ES2664989T3 (en) | 2010-10-01 | 2018-04-24 | National Research Council Of Canada | ANTI-CEACAM6 antibodies and their uses |
AR083495A1 (en) | 2010-10-22 | 2013-02-27 | Esbatech Alcon Biomed Res Unit | STABLE AND SOLUBLE ANTIBODIES |
CA2815888C (en) | 2010-10-25 | 2020-06-30 | National Research Council Of Canada | Clostridium difficile-specific antibodies and uses thereof |
DK2634194T3 (en) | 2010-10-29 | 2018-10-01 | Perseus Proteomics Inc | ANTI-CDH3 ANTIBODY WITH HIGH INTERNALIZATION CAPACITY |
US20140093506A1 (en) | 2010-11-15 | 2014-04-03 | Marc Buehler | Anti-fungal-agents |
EP2640750A1 (en) | 2010-11-16 | 2013-09-25 | Boehringer Ingelheim International GmbH | Agents and methods for treating diseases that correlate with bcma expression |
PE20140633A1 (en) | 2010-11-19 | 2014-05-30 | Eisai Randd Man Co Ltd | NEUTRALIZING ANTIBODIES ANTI-CCL20 |
US8992908B2 (en) | 2010-11-23 | 2015-03-31 | Alderbio Holdings Llc | Anti-IL-6 antibodies for the treatment of oral mucositis |
US9249217B2 (en) | 2010-12-03 | 2016-02-02 | Secretary, DHHS | Bispecific EGFRvIII x CD3 antibody engaging molecules |
UA112170C2 (en) | 2010-12-10 | 2016-08-10 | Санофі | ANTI-TUMOR COMBINATION CONTAINING AN ANTIBODY SPECIFICALLY RECOGNIZING CD38 AND BORTESOMB |
WO2012080769A1 (en) | 2010-12-15 | 2012-06-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-cd277 antibodies and uses thereof |
JP2014508511A (en) | 2010-12-20 | 2014-04-10 | メドイミューン・リミテッド | Anti-IL-18 antibodies and their use |
TW201307388A (en) | 2010-12-21 | 2013-02-16 | Abbott Lab | IL-1 binding proteins |
WO2012121775A2 (en) | 2010-12-21 | 2012-09-13 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
KR101941514B1 (en) | 2010-12-22 | 2019-01-23 | 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 | Modified antibody with improved half-life |
EP2654789B1 (en) | 2010-12-22 | 2018-05-30 | Orega Biotech | Antibodies against human cd39 and use thereof |
US20120171195A1 (en) | 2011-01-03 | 2012-07-05 | Ravindranath Mepur H | Anti-hla-e antibodies, therapeutic immunomodulatory antibodies to human hla-e heavy chain, useful as ivig mimetics and methods of their use |
CN103384682B (en) | 2011-01-14 | 2017-04-12 | Ucb医药有限公司 | Antibody molecules which bind IL-17A and IL-17F |
WO2012101125A1 (en) | 2011-01-24 | 2012-08-02 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Specific antibodies against human cxcl4 and uses thereof |
WO2012103165A2 (en) | 2011-01-26 | 2012-08-02 | Kolltan Pharmaceuticals, Inc. | Anti-kit antibodies and uses thereof |
WO2012110500A1 (en) | 2011-02-15 | 2012-08-23 | Vib Vzw | Means and methods for improvement of synaptic dysfunction disorders |
AR085302A1 (en) | 2011-02-24 | 2013-09-18 | Sanofi Sa | METHOD OF PRODUCTION OF STIRATED ANTIBODIES |
KR101969526B1 (en) | 2011-02-28 | 2019-04-17 | 고쿠리츠켄큐카이하츠호진 고쿠리츠쥰칸키뵤 겐큐센터 | Medicinal agent for inhibiting metastasis of malignant tumor |
WO2012119989A2 (en) | 2011-03-04 | 2012-09-13 | Oryzon Genomics, S.A. | Methods and antibodies for the diagnosis and treatment of cancer |
JP2014515598A (en) | 2011-03-10 | 2014-07-03 | エイチシーオー アンティボディ, インク. | Bispecific three-chain antibody-like molecule |
US8722044B2 (en) | 2011-03-15 | 2014-05-13 | Janssen Biotech, Inc. | Human tissue factor antibody and uses thereof |
US20130344074A1 (en) | 2011-03-16 | 2013-12-26 | Sanofi | Uses of a dual v region antibody-like protein |
ES2612914T3 (en) | 2011-03-31 | 2017-05-19 | Inserm - Institut National De La Santé Et De La Recherche Médicale | Antibodies directed against Icos and their uses |
RU2625034C2 (en) | 2011-04-20 | 2017-07-11 | МЕДИММЬЮН, ЭлЭлСи | Antibodies and other molecules binding b7-h1 and pd-1 |
SG194510A1 (en) | 2011-04-22 | 2013-12-30 | Emergent Product Dev Seattle | Prostate-specific membrane antigen binding proteins and related compositionsand methods |
EP2702077A2 (en) | 2011-04-27 | 2014-03-05 | AbbVie Inc. | Methods for controlling the galactosylation profile of recombinantly-expressed proteins |
UA116189C2 (en) | 2011-05-02 | 2018-02-26 | Мілленніум Фармасьютікалз, Інк. | FORMULATION FOR ANTI-α4β7 ANTIBODY |
CN108969469A (en) | 2011-05-02 | 2018-12-11 | 米伦纽姆医药公司 | The preparation of 4 β of anti alpha, 7 antibody |
WO2012156532A1 (en) | 2011-05-19 | 2012-11-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-human-her3 antibodies and uses thereof |
MX347818B (en) | 2011-05-21 | 2017-05-15 | Macrogenics Inc | Deimmunized serum-binding domains and their use for extending serum half-life. |
AR086543A1 (en) | 2011-05-25 | 2014-01-08 | Bg Medicine Inc | GALECTIN-3 INHIBITORS AND METHODS OF USE OF THE SAME, PHARMACEUTICAL COMPOSITION |
CN103732625A (en) | 2011-05-27 | 2014-04-16 | 埃博灵克斯股份有限公司 | Inhibition of bone resorption with RANKL binding peptides |
WO2012166555A1 (en) | 2011-05-27 | 2012-12-06 | Nektar Therapeutics | Water - soluble polymer - linked binding moiety and drug compounds |
EP2717911A1 (en) | 2011-06-06 | 2014-04-16 | Novartis Forschungsstiftung, Zweigniederlassung | Protein tyrosine phosphatase, non-receptor type 11 (ptpn11) and triple-negative breast cancer |
US9244074B2 (en) | 2011-06-07 | 2016-01-26 | University Of Hawaii | Biomarker of asbestos exposure and mesothelioma |
US9561274B2 (en) | 2011-06-07 | 2017-02-07 | University Of Hawaii | Treatment and prevention of cancer with HMGB1 antagonists |
MX349886B (en) | 2011-06-10 | 2017-08-17 | Medimmune Llc | Anti-pseudomonas psl binding molecules and uses thereof. |
CA2837357C (en) | 2011-06-10 | 2020-07-07 | Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of National Defence | Anti-ricin antibodies and uses thereof |
EP2723376B1 (en) | 2011-06-22 | 2018-12-05 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-axl antibodies and uses thereof |
BR112013032899A2 (en) | 2011-06-22 | 2017-01-24 | Inserm Inst Nat De La Santé Et De La Rech Médicale | anti-axl antibodies and uses thereof |
EP2543678A1 (en) | 2011-07-08 | 2013-01-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies for the treatment and prevention of thrombosis |
EP2543677A1 (en) | 2011-07-08 | 2013-01-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies for the treatment and prevention of thrombosis |
EP2543679A1 (en) | 2011-07-08 | 2013-01-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies for the treatment and prevention of thrombosis |
KR20140061403A (en) | 2011-07-13 | 2014-05-21 | 애브비 인코포레이티드 | Methods and compositions for treating asthma using anti-il-13 antibodies |
AU2012296613B2 (en) | 2011-08-15 | 2016-05-12 | Amplimmune, Inc. | Anti-B7-H4 antibodies and their uses |
WO2013033626A2 (en) | 2011-08-31 | 2013-03-07 | Trustees Of Dartmouth College | Nkp30 receptor targeted therapeutics |
CA2847245A1 (en) | 2011-09-09 | 2013-03-14 | Amgen Inc. | Use of c-met protein for predicting the efficacy of anti-hepatocyte growth factor ("hgf") antibodies in esophageal and gastric cancer patients |
US20130108641A1 (en) | 2011-09-14 | 2013-05-02 | Sanofi | Anti-gitr antibodies |
PE20141547A1 (en) | 2011-09-16 | 2014-10-25 | Ucb Pharma Sa | NEUTRALIZING ANTIBODIES AGAINST THE MAIN EXOTOXINS TCDA AND TCDB OF CLOSTRIDIUM DIFFICILE |
CN103827145A (en) | 2011-09-21 | 2014-05-28 | 富士瑞必欧株式会社 | Antibody against affinity complex |
WO2013043071A1 (en) | 2011-09-23 | 2013-03-28 | Technophage, Investigação E Desenvolvimento Em Biotecnologia, Sa | Modified albumin-binding domains and uses thereof to improve pharmacokinetics |
CN103906767A (en) | 2011-10-10 | 2014-07-02 | 米迪缪尼有限公司 | Treatment for rheumatoid arthritis |
WO2013063095A1 (en) | 2011-10-24 | 2013-05-02 | Abbvie Inc. | Immunobinders directed against sclerostin |
US9272002B2 (en) | 2011-10-28 | 2016-03-01 | The Trustees Of The University Of Pennsylvania | Fully human, anti-mesothelin specific chimeric immune receptor for redirected mesothelin-expressing cell targeting |
AU2012332593B2 (en) | 2011-11-01 | 2016-11-17 | Bionomics, Inc. | Anti-GPR49 antibodies |
CN104053671A (en) | 2011-11-01 | 2014-09-17 | 生态学有限公司 | Antibodies and methods of treating cancer |
US9220774B2 (en) | 2011-11-01 | 2015-12-29 | Bionomics Inc. | Methods of treating cancer by administering anti-GPR49 antibodies |
WO2013067055A1 (en) | 2011-11-01 | 2013-05-10 | Bionomics, Inc. | Methods of blocking cancer stem cell growth |
EP2773651B1 (en) | 2011-11-03 | 2020-12-23 | The Trustees of the University of Pennsylvania | Isolated b7-h4 specific compositions and methods of use thereof |
US20140314787A1 (en) | 2011-11-08 | 2014-10-23 | Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute | Treatment for neurodegenerative diseases |
US20140294732A1 (en) | 2011-11-08 | 2014-10-02 | Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute | Early diagnostic of neurodegenerative diseases |
WO2013070468A1 (en) | 2011-11-08 | 2013-05-16 | The Trustees Of The University Of Pennsylvania | Glypican-3-specific antibody and uses thereof |
US20140323549A1 (en) | 2011-11-08 | 2014-10-30 | Quark Pharmaceuticals, Inc. | Methods and compositions for treating diseases, disorders or injury of the nervous system |
UA112203C2 (en) | 2011-11-11 | 2016-08-10 | Юсб Фарма С.А. | Fusion protein of a biospecific antibody that binds to human OX40 and serum human albumin |
WO2013068571A1 (en) | 2011-11-11 | 2013-05-16 | Ucb Pharma S.A. | Albumin binding antibodies and binding fragments thereof |
EP2599496A1 (en) | 2011-11-30 | 2013-06-05 | Kenta Biotech AG | Novel targets of Acinetobacter baumannii |
AU2012347972B2 (en) | 2011-12-05 | 2018-05-10 | X-Body, Inc. | PDGF receptor beta binding polypeptides |
US10117932B2 (en) | 2011-12-08 | 2018-11-06 | Biotest Ag | Uses of immunoconjugates targeting CD138 |
WO2013092998A1 (en) | 2011-12-23 | 2013-06-27 | Innate Pharma | Enzymatic conjugation of antibodies |
WO2013093122A2 (en) | 2011-12-23 | 2013-06-27 | Phenoquest Ag | Antibodies for the treatment and diagnosis of affective and anxiety disorders |
US11147852B2 (en) | 2011-12-23 | 2021-10-19 | Pfizer Inc. | Engineered antibody constant regions for site-specific conjugation and methods and uses therefor |
CA2861610A1 (en) | 2011-12-30 | 2013-07-04 | Abbvie Inc. | Dual specific binding proteins directed against il-13 and/or il-17 |
US20140363448A1 (en) | 2012-01-02 | 2014-12-11 | Novartis Ag | Cdcp1 and breast cancer |
US20130177574A1 (en) | 2012-01-11 | 2013-07-11 | Paul I. Terasaki Foundation Laboratory | ANTI-HLA CLASS-Ib ANTIBODIES MIMIC IMMUNOREACTIVITY AND IMMUNOMODULATORY FUNCTIONS OF INTRAVENOUS IMMUNOGLOBULIN (IVIg) USEFUL AS THERAPEUTIC IVIg MIMETICS AND METHODS OF THEIR USE |
US10800847B2 (en) | 2012-01-11 | 2020-10-13 | Dr. Mepur Ravindranath | Anti-HLA class-IB antibodies mimic immunoreactivity and immunomodulatory functions of intravenous immunoglobulin (IVIG) useful as therapeutic IVIG mimetics and methods of their use |
AU2013209492B2 (en) | 2012-01-20 | 2018-02-08 | Genzyme Corporation | Anti-CXCR3 antibodies |
GB201201332D0 (en) | 2012-01-26 | 2012-03-14 | Imp Innovations Ltd | Method |
NZ625403A (en) | 2012-01-27 | 2016-03-31 | Abbvie Inc | Composition and method for diagnosis and treatment of diseases associated with neurite degeneration |
ES2725569T3 (en) | 2012-02-10 | 2019-09-24 | Seattle Genetics Inc | Diagnosis and treatment of cancers that express CD30 |
EP3196214B1 (en) | 2012-02-15 | 2019-07-31 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (trem-1) |
US9550830B2 (en) | 2012-02-15 | 2017-01-24 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
SI2814842T1 (en) | 2012-02-15 | 2018-10-30 | Novo Nordisk A/S | Antibodies that bind peptidoglycan recognition protein 1 |
GB201203051D0 (en) | 2012-02-22 | 2012-04-04 | Ucb Pharma Sa | Biological products |
GB201203071D0 (en) | 2012-02-22 | 2012-04-04 | Ucb Pharma Sa | Biological products |
FR2987627B1 (en) | 2012-03-05 | 2016-03-18 | Splicos | USE OF RBM39 AS A BIOMARKER |
US9592289B2 (en) | 2012-03-26 | 2017-03-14 | Sanofi | Stable IgG4 based binding agent formulations |
TWI605060B (en) | 2012-03-28 | 2017-11-11 | 賽諾菲公司 | Antibodies to bradykinin b1 receptor ligands |
US20150266961A1 (en) | 2012-03-29 | 2015-09-24 | Novartis Forschungsstiftung, Zweigniederlassung, Fridrich Miescher Institute | Inhibition of interleukin-8 and/or its receptor cxcr1 in the treatment of her2/her3-overexpressing breast cancer |
WO2013151649A1 (en) | 2012-04-04 | 2013-10-10 | Sialix Inc | Glycan-interacting compounds |
US9067990B2 (en) | 2013-03-14 | 2015-06-30 | Abbvie, Inc. | Protein purification using displacement chromatography |
WO2013158279A1 (en) | 2012-04-20 | 2013-10-24 | Abbvie Inc. | Protein purification methods to reduce acidic species |
WO2013158273A1 (en) | 2012-04-20 | 2013-10-24 | Abbvie Inc. | Methods to modulate c-terminal lysine variant distribution |
WO2013166043A1 (en) | 2012-05-02 | 2013-11-07 | Children's Hospital Medical Center | Rejuvenation of precursor cells |
WO2013166290A1 (en) | 2012-05-04 | 2013-11-07 | Abbvie Biotherapeutics Inc. | P21 biomarker assay |
US9790278B2 (en) | 2012-05-07 | 2017-10-17 | The Trustees Of Dartmouth College | Anti-B7-H6 antibody, fusion proteins, and methods of using the same |
GB201208370D0 (en) | 2012-05-14 | 2012-06-27 | Ucb Pharma Sa | Antibodies |
WO2013173364A2 (en) | 2012-05-14 | 2013-11-21 | Biogen Idec Ma Inc. | Lingo-2 antagonists for treatment of conditions involving motor neurons |
BR112014028306A2 (en) | 2012-05-15 | 2018-04-17 | Morphotek, Inc. | methods for treating gastric cancer. |
WO2013175276A1 (en) | 2012-05-23 | 2013-11-28 | Argen-X B.V | Il-6 binding molecules |
WO2013176754A1 (en) | 2012-05-24 | 2013-11-28 | Abbvie Inc. | Novel purification of antibodies using hydrophobic interaction chromatography |
WO2013177386A1 (en) | 2012-05-24 | 2013-11-28 | Abbvie Biotherapeutics Inc. | Biomarkers for predicting response to tweak receptor (tweakr) agonist therapy |
JP6629069B2 (en) | 2012-06-06 | 2020-01-15 | ゾエティス・エルエルシー | Canine anti-NGF antibody and method thereof |
US10335482B2 (en) | 2012-06-06 | 2019-07-02 | Bionor Immuno As | Method of inducing an anti-HIV-1 immune response comprising administering a C5/TM-GP41 peptide dimer |
US9676847B2 (en) | 2012-06-25 | 2017-06-13 | Orega Biotech | IL-17 antagonist antibodies |
EP2867674B1 (en) | 2012-06-28 | 2018-10-10 | UCB Biopharma SPRL | A method for identifying compounds of therapeutic interest |
US20150218238A1 (en) | 2012-06-29 | 2015-08-06 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Resear | Treating diseases by modulating a specific isoform of mkl1 |
US10656156B2 (en) | 2012-07-05 | 2020-05-19 | Mepur Ravindranath | Diagnostic and therapeutic potential of HLA-E monospecific monoclonal IgG antibodies directed against tumor cell surface and soluble HLA-E |
US20150184154A1 (en) | 2012-07-05 | 2015-07-02 | Novartis Forschungsstiftung, Zweigniederlassung Friedrich Miescher Institute For Biomedical Resear | New treatment for neurodegenerative diseases |
EP2869818A1 (en) | 2012-07-06 | 2015-05-13 | Novartis AG | Combination of a phosphoinositide 3-kinase inhibitor and an inhibitor of the il-8/cxcr interaction |
UY34905A (en) | 2012-07-12 | 2014-01-31 | Abbvie Inc | IL-1 UNION PROTEINS |
US10132799B2 (en) | 2012-07-13 | 2018-11-20 | Innate Pharma | Screening of conjugated antibodies |
WO2014011988A2 (en) | 2012-07-13 | 2014-01-16 | The Trustees Of The University Of Pennsylvania | Enhancing activity of car t cells by co-introducing a bispecific antibody |
EP4063391A1 (en) | 2012-07-25 | 2022-09-28 | Celldex Therapeutics, Inc. | Anti-kit antibodies and uses thereof |
AU2013309506A1 (en) | 2012-09-02 | 2015-03-12 | Abbvie Inc. | Methods to control protein heterogeneity |
US9512214B2 (en) | 2012-09-02 | 2016-12-06 | Abbvie, Inc. | Methods to control protein heterogeneity |
US9695247B2 (en) | 2012-09-03 | 2017-07-04 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Antibodies directed against ICOS for treating graft-versus-host disease |
NO2760138T3 (en) | 2012-10-01 | 2018-08-04 | ||
US9365641B2 (en) | 2012-10-01 | 2016-06-14 | The Trustees Of The University Of Pennsylvania | Compositions and methods for targeting stromal cells for the treatment of cancer |
WO2014055771A1 (en) | 2012-10-05 | 2014-04-10 | The Trustees Of The University Of Pennsylvania | Human alpha-folate receptor chimeric antigen receptor |
EP2906597B1 (en) | 2012-10-15 | 2020-04-08 | Medimmune Limited | Antibodies to amyloid beta |
JP2015535224A (en) | 2012-10-24 | 2015-12-10 | ナショナル リサーチ カウンシル オブ カナダ | Anti-Campylobacter jejuni antibody and use thereof |
TW202210507A (en) | 2012-11-01 | 2022-03-16 | 美商艾伯維有限公司 | Anti-vegf/dll4 dual variable domain immunoglobulins and uses thereof |
WO2014072482A1 (en) | 2012-11-09 | 2014-05-15 | Innate Pharma | Recognition tags for tgase-mediated conjugation |
EP2916835A4 (en) | 2012-11-12 | 2016-07-27 | Redwood Bioscience Inc | Compounds and methods for producing a conjugate |
EP2733153A1 (en) | 2012-11-15 | 2014-05-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for the preparation of immunoconjugates and uses thereof |
US9310374B2 (en) | 2012-11-16 | 2016-04-12 | Redwood Bioscience, Inc. | Hydrazinyl-indole compounds and methods for producing a conjugate |
KR20150085064A (en) | 2012-11-16 | 2015-07-22 | 더 리젠트스 오브 더 유니이버시티 오브 캘리포니아 | Pictet-spengler ligation for protein chemical modification |
TWI664192B (en) | 2012-11-20 | 2019-07-01 | 法商賽諾菲公司 | Anti-ceacam5 antibodies and uses thereof |
EP2925779A1 (en) | 2012-11-30 | 2015-10-07 | Institut Pasteur | Use of anti-fcyri and/or anti-fcyriia antibodies for treating arthritis, inflammation, thrombocytopenia and allergic shock |
US20140154255A1 (en) | 2012-11-30 | 2014-06-05 | Abbvie Biotherapeutics Inc. | Anti-vegf antibodies and their uses |
US10342869B2 (en) | 2012-12-07 | 2019-07-09 | The Regents Of The University Of California | Compositions comprising anti-CD38 antibodies and lenalidomide |
UA118255C2 (en) | 2012-12-07 | 2018-12-26 | Санофі | Compositions comprising anti-cd38 antibodies and lenalidomide |
WO2014100439A2 (en) | 2012-12-19 | 2014-06-26 | Amplimmune, Inc. | B7-h4 specific antibodies, and compositions and methods of use thereof |
WO2014100542A1 (en) | 2012-12-21 | 2014-06-26 | Abbvie, Inc. | High-throughput antibody humanization |
BR112015014621A2 (en) | 2012-12-21 | 2017-10-03 | Amplimmune Inc | ANTI-H7CR ANTIBODIES |
GB201223276D0 (en) | 2012-12-21 | 2013-02-06 | Ucb Pharma Sa | Antibodies and methods of producing same |
EA201690004A1 (en) | 2012-12-27 | 2016-07-29 | Санофи | ANTIBODIES AGAINST LAMP1 AND CONJUGATES ANTIBODIES AND MEDICINES AND THEIR APPLICATION |
JP6247646B2 (en) | 2013-01-28 | 2017-12-13 | 株式会社イーベック | Humanized anti-HMGB1 antibody or antigen-binding fragment thereof |
US9834610B2 (en) | 2013-01-31 | 2017-12-05 | Thomas Jefferson University | Fusion proteins for modulating regulatory and effector T cells |
ES2760023T3 (en) | 2013-02-20 | 2020-05-12 | Univ Pennsylvania | Cancer treatment using humanized anti-EGFRvIII chimeric antigen receptor |
TW201446794A (en) | 2013-02-20 | 2014-12-16 | Novartis Ag | Effective targeting of primary human leukemia using anti-CD123 chimeric antigen receptor engineered T cells |
SG11201507230PA (en) | 2013-03-12 | 2015-10-29 | Abbvie Inc | Human antibodies that bind human tnf-alpha and methods of preparing the same |
RU2723937C2 (en) | 2013-03-13 | 2020-06-18 | Санофи | Compositions comprising cd38 antibodies and carfilzomib |
WO2014151878A2 (en) | 2013-03-14 | 2014-09-25 | Abbvie Inc. | Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosacharides |
BR112015023239A8 (en) | 2013-03-14 | 2018-04-17 | Abbott Lab | hcv antibody-antigen combination assay and methods and compositions for use thereof |
US9017687B1 (en) | 2013-10-18 | 2015-04-28 | Abbvie, Inc. | Low acidic species compositions and methods for producing and using the same using displacement chromatography |
CA2906417C (en) | 2013-03-14 | 2022-06-21 | Robert Ziemann | Hcv core lipid binding domain monoclonal antibodies |
WO2014159579A1 (en) | 2013-03-14 | 2014-10-02 | Abbvie Inc. | MUTATED ANTI-TNFα ANTIBODIES AND METHODS OF THEIR USE |
WO2014143342A1 (en) | 2013-03-14 | 2014-09-18 | Abbott Laboratories | Hcv ns3 recombinant antigens and mutants thereof for improved antibody detection |
US9062108B2 (en) | 2013-03-15 | 2015-06-23 | Abbvie Inc. | Dual specific binding proteins directed against IL-1 and/or IL-17 |
US9446105B2 (en) | 2013-03-15 | 2016-09-20 | The Trustees Of The University Of Pennsylvania | Chimeric antigen receptor specific for folate receptor β |
CA2903576C (en) | 2013-03-15 | 2021-06-08 | Nai-Kong V. Cheung | High affinity anti-gd2 antibodies |
CA2904527A1 (en) | 2013-03-15 | 2014-09-18 | Abbvie Biotechnology Ltd. | Anti-cd25 antibodies and their uses |
ES2699599T3 (en) | 2013-03-15 | 2019-02-11 | Abbvie Biotherapeutics Inc | Fc variants |
WO2014140300A1 (en) | 2013-03-15 | 2014-09-18 | Innate Pharma | Solid phase tgase-mediated conjugation of antibodies |
RU2015144026A (en) | 2013-03-15 | 2017-04-20 | Эббви Байотекнолоджи Лтд. | ANTIBODIES AGAINST CD25 AND THEIR APPLICATION |
WO2014145252A2 (en) | 2013-03-15 | 2014-09-18 | Milone Michael C | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
TWI654206B (en) | 2013-03-16 | 2019-03-21 | 諾華公司 | Treatment of cancer with a humanized anti-CD19 chimeric antigen receptor |
TWI679019B (en) | 2013-04-29 | 2019-12-11 | 法商賽諾菲公司 | Anti-il-4/anti-il-13 bispecific antibody formulations |
PL2981822T3 (en) | 2013-05-06 | 2021-07-12 | Scholar Rock, Inc. | Compositions and methods for growth factor modulation |
WO2014183885A1 (en) | 2013-05-17 | 2014-11-20 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antagonist of the btla/hvem interaction for use in therapy |
WO2014190356A2 (en) | 2013-05-24 | 2014-11-27 | Amplimmune, Inc. | Anti-b7-h5 antibodies and their uses |
AU2014274660B2 (en) | 2013-06-06 | 2019-05-16 | Pierre Fabre Médicament | Anti-C10orf54 antibodies and uses thereof |
US9499628B2 (en) | 2013-06-14 | 2016-11-22 | Children's Hospital Medical Center | Method of boosting the immune response in neonates |
EP3010547B1 (en) | 2013-06-20 | 2021-04-21 | Innate Pharma | Enzymatic conjugation of polypeptides |
WO2014202775A1 (en) | 2013-06-21 | 2014-12-24 | Innate Pharma | Enzymatic conjugation of polypeptides |
WO2015007337A1 (en) | 2013-07-19 | 2015-01-22 | Bionor Immuno As | Method for the vaccination against hiv |
ES2683268T3 (en) | 2013-07-25 | 2018-09-25 | Cytomx Therapeutics, Inc. | Multispecific antibodies, multispecific activatable antibodies and methods for using them |
US20160178610A1 (en) | 2013-08-07 | 2016-06-23 | Friedrich Miescher Institute For Biomedical Research | New screening method for the treatment Friedreich's ataxia |
CN112142845A (en) | 2013-08-13 | 2020-12-29 | 赛诺菲 | Antibodies to plasminogen activator inhibitor-1 (PAI-1) and uses thereof |
TWI592426B (en) | 2013-08-13 | 2017-07-21 | 賽諾菲公司 | Antibodies to plasminogen activator inhibitor-1 (pai-1) and uses thereof |
GB201315487D0 (en) | 2013-08-30 | 2013-10-16 | Ucb Pharma Sa | Antibodies |
WO2015035044A2 (en) | 2013-09-04 | 2015-03-12 | Abbvie Biotherapeutics Inc. | Fc VARIANTS WITH IMPROVED ANTIBODY-DEPENDENT CELL-MEDIATED CYTOTOXICITY |
EP3042667A4 (en) | 2013-09-04 | 2017-04-05 | Osaka University | Dpp-4-targeting vaccine for treating diabetes |
CN104418947A (en) | 2013-09-11 | 2015-03-18 | 香港大学 | Anti-her2 and anti-igf-ir bi-specific antibodies and uses thereof |
CN105636982B (en) * | 2013-09-16 | 2020-06-23 | 健康与环境慕尼黑德国研究中心赫姆霍茨中心(有限责任公司) | Bi-or multispecific polypeptides that bind immune effector cell surface antigens and HBV antigens for the treatment of HBV infections and related conditions |
EP3052640A2 (en) | 2013-10-04 | 2016-08-10 | AbbVie Inc. | Use of metal ions for modulation of protein glycosylation profiles of recombinant proteins |
US9181337B2 (en) | 2013-10-18 | 2015-11-10 | Abbvie, Inc. | Modulated lysine variant species compositions and methods for producing and using the same |
US8946395B1 (en) | 2013-10-18 | 2015-02-03 | Abbvie Inc. | Purification of proteins using hydrophobic interaction chromatography |
US9085618B2 (en) | 2013-10-18 | 2015-07-21 | Abbvie, Inc. | Low acidic species compositions and methods for producing and using the same |
CA3183645A1 (en) | 2013-10-25 | 2015-04-30 | Psioxus Therapeutics Limited | Oncolytic adenoviruses armed with heterologous genes |
EP3063317B1 (en) | 2013-10-28 | 2020-06-03 | DOTS Technology Corp. | Allergen detection |
BR112016009403A2 (en) | 2013-10-31 | 2017-09-19 | Sanofi Sa | SPECIFIC ANTI-CD38 ANTIBODIES FOR TREATMENT OF HUMAN CANCER |
US9580504B1 (en) | 2013-11-07 | 2017-02-28 | Curetech Ltd. | Pidilizumab monoclonal antibody therapy following stem cell transplantation |
JP6449876B2 (en) | 2013-11-07 | 2019-01-09 | アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル | Anti-human HER3 antibody that is non-competitive and allosteric for neuregulin and uses thereof |
GB201320066D0 (en) | 2013-11-13 | 2013-12-25 | Ucb Pharma Sa | Biological products |
WO2015073884A2 (en) | 2013-11-15 | 2015-05-21 | Abbvie, Inc. | Glycoengineered binding protein compositions |
CA2927806C (en) | 2013-11-27 | 2023-01-10 | Redwood Bioscience, Inc. | Hydrazinyl-pyrrolo compounds and methods for producing a conjugate |
US9944694B2 (en) | 2013-12-13 | 2018-04-17 | Rijksuniversiteit Groningen | Antibodies against Staphylococcus aureus and uses therof |
EP3083946A4 (en) | 2013-12-16 | 2017-08-16 | The University of North Carolina at Chapel Hill | Depletion of plasmacytoid dendritic cells |
US8992927B1 (en) | 2014-07-15 | 2015-03-31 | Kymab Limited | Targeting human NAV1.7 variants for treatment of pain |
US9914769B2 (en) | 2014-07-15 | 2018-03-13 | Kymab Limited | Precision medicine for cholesterol treatment |
US9067998B1 (en) | 2014-07-15 | 2015-06-30 | Kymab Limited | Targeting PD-1 variants for treatment of cancer |
US9045545B1 (en) | 2014-07-15 | 2015-06-02 | Kymab Limited | Precision medicine by targeting PD-L1 variants for treatment of cancer |
US8986694B1 (en) | 2014-07-15 | 2015-03-24 | Kymab Limited | Targeting human nav1.7 variants for treatment of pain |
EP3083680B1 (en) | 2013-12-20 | 2020-01-15 | F. Hoffmann-La Roche AG | Humanized anti-tau(ps422) antibodies and methods of use |
EP3087101A4 (en) | 2013-12-20 | 2017-12-06 | Novartis AG | Regulatable chimeric antigen receptor |
JP6164593B2 (en) | 2013-12-27 | 2017-07-19 | 国立大学法人大阪大学 | Vaccine targeting IL-17A |
EP2893939A1 (en) | 2014-01-10 | 2015-07-15 | Netris Pharma | Anti-netrin-1 antibody |
ES2963718T3 (en) | 2014-01-21 | 2024-04-01 | Novartis Ag | Antigen-presenting capacity of CAR-T cells enhanced by co-introduction of co-stimulatory molecules |
US9139649B2 (en) | 2014-02-25 | 2015-09-22 | Immunomedics, Inc. | Humanized anti-CD22 antibody |
GB201403775D0 (en) | 2014-03-04 | 2014-04-16 | Kymab Ltd | Antibodies, uses & methods |
AU2014385801B2 (en) | 2014-03-06 | 2020-11-12 | National Research Council Of Canada | Insulin-like growth factor 1 receptor -specific antibodies and uses thereof |
KR102355308B1 (en) | 2014-03-06 | 2022-01-24 | 내셔날 리서치 카운실 오브 캐나다 | Insulin-like growth factor 1 receptor-specific antibodies and uses thereof |
UA121028C2 (en) | 2014-03-06 | 2020-03-25 | Нешнл Рісеч Каунсіл Оф Канада | Insulin-like growth factor 1 receptor -specific antibodies and uses thereof |
US9738702B2 (en) | 2014-03-14 | 2017-08-22 | Janssen Biotech, Inc. | Antibodies with improved half-life in ferrets |
ES2939760T3 (en) | 2014-03-15 | 2023-04-26 | Novartis Ag | Cancer treatment using a chimeric receptor for antigens |
EP3811970A1 (en) | 2014-03-15 | 2021-04-28 | Novartis AG | Regulatable chimeric antigen receptor |
ES2800674T3 (en) | 2014-03-21 | 2021-01-04 | X Body Inc | Bispecific antigen-binding polypeptides |
KR102352573B1 (en) | 2014-04-04 | 2022-01-18 | 바이오노믹스 인코포레이티드 | Humanized antibodies that bind lgr5 |
KR102487608B1 (en) | 2014-04-07 | 2023-01-12 | 노파르티스 아게 | Treatment of cancer using anti-cd19 chimeric antigen receptor |
GB201406608D0 (en) | 2014-04-12 | 2014-05-28 | Psioxus Therapeutics Ltd | Virus |
US10544231B2 (en) | 2014-04-16 | 2020-01-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies for the prevention or the treatment of bleeding episodes |
EP3804745A1 (en) | 2014-04-25 | 2021-04-14 | The Brigham and Women's Hospital, Inc. | Methods to manipulate alpha-fetoprotein (afp) |
RS61516B1 (en) | 2014-04-30 | 2021-03-31 | Pfizer | Anti-ptk7 antibody-drug conjugates |
WO2015175874A2 (en) | 2014-05-16 | 2015-11-19 | Medimmune, Llc | Molecules with altered neonate fc receptor binding having enhanced therapeutic and diagnostic properties |
MA47849A (en) | 2014-05-28 | 2020-01-29 | Agenus Inc | ANTI-GITR ANTIBODIES AND THEIR METHODS OF USE |
GB201409558D0 (en) | 2014-05-29 | 2014-07-16 | Ucb Biopharma Sprl | Method |
EP3151830A4 (en) | 2014-06-06 | 2018-02-07 | Redwood Bioscience, Inc. | Anti-her2 antibody-maytansine conjugates and methods of use thereof |
EP3154579A1 (en) | 2014-06-13 | 2017-04-19 | Friedrich Miescher Institute for Biomedical Research | New treatment against influenza virus |
NL2013661B1 (en) | 2014-10-21 | 2016-10-05 | Ablynx Nv | KV1.3 Binding immunoglobulins. |
WO2015198202A1 (en) | 2014-06-23 | 2015-12-30 | Friedrich Miescher Institute For Biomedical Research | Methods for triggering de novo formation of heterochromatin and or epigenetic silencing with small rnas |
GB201411320D0 (en) | 2014-06-25 | 2014-08-06 | Ucb Biopharma Sprl | Antibody construct |
AR100978A1 (en) | 2014-06-26 | 2016-11-16 | Hoffmann La Roche | ANTI-Tau HUMANIZED ANTIBODY BRAIN LAUNCHERS (pS422) AND USES OF THE SAME |
EP3164129A1 (en) | 2014-07-01 | 2017-05-10 | Friedrich Miescher Institute for Biomedical Research | Combination of a brafv600e inhibitor and mertk inhibitor to treat melanoma |
US9139648B1 (en) | 2014-07-15 | 2015-09-22 | Kymab Limited | Precision medicine by targeting human NAV1.9 variants for treatment of pain |
GB201412658D0 (en) | 2014-07-16 | 2014-08-27 | Ucb Biopharma Sprl | Molecules |
GB201412659D0 (en) | 2014-07-16 | 2014-08-27 | Ucb Biopharma Sprl | Molecules |
JP6738316B2 (en) | 2014-07-17 | 2020-08-12 | ノヴォ ノルディスク アクティーゼルスカブ | Site-directed mutagenesis of TREM-1 antibody to reduce viscosity |
JP2017528433A (en) | 2014-07-21 | 2017-09-28 | ノバルティス アーゲー | Low immunoenhancing dose of mTOR inhibitor and CAR combination |
CA2955386A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Treatment of cancer using humanized anti-bcma chimeric antigen receptor |
WO2016014553A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Sortase synthesized chimeric antigen receptors |
TWI719942B (en) | 2014-07-21 | 2021-03-01 | 瑞士商諾華公司 | Treatment of cancer using a cd33 chimeric antigen receptor |
US10669337B2 (en) | 2014-07-25 | 2020-06-02 | Cytomx Therapeutics, Inc. | Bispecific anti-CD3 antibodies, bispecific activatable anti-CD3 antibodies, and methods of using the same |
EP3453406B1 (en) | 2014-07-29 | 2021-04-14 | Cellectis | Ror1 (ntrkr1) specific chimeric antigen receptors for cancer immunotherapy |
EP3660042B1 (en) | 2014-07-31 | 2023-01-11 | Novartis AG | Subset-optimized chimeric antigen receptor-containing t-cells |
US10544201B2 (en) | 2014-07-31 | 2020-01-28 | Cellectis | ROR1 specific multi-chain chimeric antigen receptor |
WO2016025880A1 (en) | 2014-08-14 | 2016-02-18 | Novartis Ag | Treatment of cancer using gfr alpha-4 chimeric antigen receptor |
CN112410363A (en) | 2014-08-19 | 2021-02-26 | 诺华股份有限公司 | anti-CD 123 Chimeric Antigen Receptor (CAR) for cancer therapy |
RU2741470C9 (en) | 2014-09-02 | 2021-04-27 | Иммьюноджен, Инк. | Methods for preparing antibody-drug conjugate compositions |
ES2777305T3 (en) | 2014-09-04 | 2020-08-04 | Cellectis | Trophoblastic glycoprotein-specific chimeric antigen receptors (5T4, TPBG) for cancer immunotherapy |
PT3189081T (en) | 2014-09-05 | 2020-05-25 | Janssen Pharmaceutica Nv | Cd123 binding agents and uses thereof |
WO2016043577A1 (en) | 2014-09-16 | 2016-03-24 | Academisch Medisch Centrum | Ig-like molecules binding to bmp4 |
ES2891332T3 (en) | 2014-09-17 | 2022-01-27 | Novartis Ag | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
WO2016044588A1 (en) | 2014-09-19 | 2016-03-24 | The Regents Of The University Of Michigan | Staphylococcus aureus materials and methods |
EP3197557A1 (en) | 2014-09-24 | 2017-08-02 | Friedrich Miescher Institute for Biomedical Research | Lats and breast cancer |
WO2016054354A1 (en) | 2014-10-02 | 2016-04-07 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for treating malignancies |
CA3001724A1 (en) | 2014-10-10 | 2016-04-14 | National Research Council Of Canada | Anti-tau antibody and uses thereof |
CA2959821A1 (en) | 2014-10-24 | 2016-04-28 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions and methods for inducing phagocytosis of mhc class i positive cells and countering anti-cd47/sirpa resistance |
EP3212668B1 (en) | 2014-10-31 | 2020-10-14 | AbbVie Biotherapeutics Inc. | Anti-cs1 antibodies and antibody drug conjugates |
ES2910227T3 (en) | 2014-10-31 | 2022-05-12 | Univ Pennsylvania | Composition and methods for the stimulation and expansion of T cells |
EP4219725A3 (en) | 2014-10-31 | 2023-08-30 | The Trustees of the University of Pennsylvania | Altering gene expression in modified t cells and uses thereof |
US20170306046A1 (en) | 2014-11-12 | 2017-10-26 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
US9879087B2 (en) | 2014-11-12 | 2018-01-30 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
CA2967222C (en) | 2014-11-12 | 2023-10-31 | Rinat Neuroscience Corp. | Inhibitory chimeric antigen receptors |
WO2016087514A1 (en) | 2014-12-02 | 2016-06-09 | Cemm - Forschungszentrum Für Molekulare Medizin Gmbh | Anti-mutant calreticulin antibodies and their use in the diagnosis and therapy of myeloid malignancies |
WO2016090034A2 (en) | 2014-12-03 | 2016-06-09 | Novartis Ag | Methods for b cell preconditioning in car therapy |
ES2717308T3 (en) | 2014-12-06 | 2019-06-20 | Gemoab Monoclonals Gmbh | Pluri- or multi-potent genetically modified stem cells and their uses |
CN107249643A (en) | 2014-12-09 | 2017-10-13 | 艾伯维公司 | The antibody drug conjugate of BCL XL inhibitor with cell permeability |
CA2970155A1 (en) | 2014-12-09 | 2016-06-16 | Abbvie Inc. | Bcl-xl inhibitory compounds having low cell permeability and antibody drug conjugates including the same |
US10093733B2 (en) | 2014-12-11 | 2018-10-09 | Abbvie Inc. | LRP-8 binding dual variable domain immunoglobulin proteins |
KR20170087500A (en) | 2014-12-11 | 2017-07-28 | 피에르 파브르 메디카먼트 | Anti-C10ORF54 antibodies and uses thereof |
WO2016092524A1 (en) | 2014-12-11 | 2016-06-16 | Inbiomotion S.L. | Binding members for human c-maf |
BR112017012910A2 (en) | 2014-12-19 | 2018-02-06 | Biotecnol Limited | fusion protein comprising three 5t4 and cd3 binding domains |
ES2870983T3 (en) | 2014-12-19 | 2021-10-28 | Univ Nantes | Anti-IL-34 antibodies |
JP7211703B2 (en) | 2014-12-22 | 2023-01-24 | ザ ロックフェラー ユニバーシティー | Anti-MERTK agonist antibody and use thereof |
JP2018504400A (en) | 2015-01-08 | 2018-02-15 | バイオジェン・エムエイ・インコーポレイテッドBiogen MA Inc. | LINGO-1 antagonist and use for treatment of demyelinating disorders |
CN107530423B (en) | 2015-01-14 | 2022-04-05 | 布里格姆及妇女医院股份有限公司 | Treatment of cancer with anti-LAP monoclonal antibodies |
CN114230667A (en) | 2015-01-23 | 2022-03-25 | 赛诺菲 | anti-CD 3 antibodies, anti-CD 123 antibodies, and bispecific antibodies that specifically bind to CD3 and/or CD123 |
ES2842212T3 (en) | 2015-01-26 | 2021-07-13 | Cellectis | Anti-CLL1 Specific Single Chain Chimeric Antigen Receptors (scCAR) for Cancer Immunotherapy |
JP7170394B2 (en) | 2015-01-31 | 2022-11-14 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | Compositions and methods for T cell delivery of therapeutic molecules |
WO2016126608A1 (en) | 2015-02-02 | 2016-08-11 | Novartis Ag | Car-expressing cells against multiple tumor antigens and uses thereof |
EP3271388A1 (en) | 2015-02-09 | 2018-01-24 | INSERM - Institut National de la Santé et de la Recherche Médicale | Antibodies specific to glycoprotein (gp) of ebola virus and uses for the treatment and diagnosis of ebola virus infection |
FI3265123T3 (en) | 2015-03-03 | 2023-01-31 | Antibodies, uses & methods | |
EP3265483B1 (en) | 2015-03-06 | 2019-12-11 | CSL Behring Lengnau AG | Modified von willebrand factor having improved half-life |
WO2016149096A1 (en) | 2015-03-13 | 2016-09-22 | President And Fellows Of Harvard College | Determination of cells using amplification |
CN107667120B (en) | 2015-03-17 | 2022-03-08 | 纪念斯隆-凯特林癌症中心 | anti-MUC 16 antibodies and uses thereof |
EP3270937A4 (en) | 2015-03-26 | 2018-09-12 | The Trustees Of Dartmouth College | Anti-mica antigen binding fragments, fusion molecules, cells which express and methods of using |
WO2016162368A1 (en) | 2015-04-07 | 2016-10-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Non-invasive imaging of tumor pd-l1 expression |
HUE059218T2 (en) | 2015-04-08 | 2022-11-28 | Novartis Ag | Cd20 therapies, cd22 therapies, and combination therapies with a cd19 chimeric antigen receptor (car) - expressing cell |
GB201506870D0 (en) | 2015-04-22 | 2015-06-03 | Ucb Biopharma Sprl | Method |
GB201506869D0 (en) | 2015-04-22 | 2015-06-03 | Ucb Biopharma Sprl | Method |
US20180298068A1 (en) | 2015-04-23 | 2018-10-18 | Novartis Ag | Treatment of cancer using chimeric antigen receptor and protein kinase a blocker |
SI3290441T1 (en) | 2015-04-28 | 2020-03-31 | Mitsubishi Tanabe Pharma Corporation | Rgma binding protein and use thereof |
KR20170138570A (en) | 2015-04-30 | 2017-12-15 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Anti-aP2 antibodies and antigen binding substances for the treatment of metabolic disorders |
WO2016177833A1 (en) | 2015-05-04 | 2016-11-10 | Bionor Immuno As | Dosage regimen for hiv vaccine |
WO2016179518A2 (en) | 2015-05-06 | 2016-11-10 | Janssen Biotech, Inc. | Prostate specific membrane antigen (psma) bispecific binding agents and uses thereof |
US10259882B2 (en) | 2015-05-07 | 2019-04-16 | Agenus Inc. | Anti-OX40 antibodies |
GB201508180D0 (en) | 2015-05-13 | 2015-06-24 | Ucb Biopharma Sprl | Antibodies |
WO2016187068A1 (en) | 2015-05-15 | 2016-11-24 | The General Hospital Corporation | Antagonistic anti-tumor necrosis factor receptor superfamily antibodies |
CA2986254A1 (en) | 2015-05-18 | 2016-11-24 | TCR2 Therapeutics Inc. | Compositions and methods for tcr reprogramming using fusion proteins |
TW201706300A (en) | 2015-05-20 | 2017-02-16 | 瑟勒提斯公司 | Anti-GD3 specific chimeric antigen receptors for cancer immunotherapy |
KR101997241B1 (en) | 2015-05-21 | 2019-07-09 | 하푼 테라퓨틱스, 인크. | Trispecific binding proteins and methods of use |
CN113940996A (en) | 2015-05-27 | 2022-01-18 | Ucb生物制药私人有限公司 | Methods for treating neurological diseases |
PL3303394T3 (en) | 2015-05-29 | 2020-11-16 | Agenus Inc. | Anti-ctla-4 antibodies and methods of use thereof |
EP3303395B1 (en) | 2015-05-29 | 2019-12-11 | AbbVie Inc. | Anti-cd40 antibodies and uses thereof |
TW201710286A (en) | 2015-06-15 | 2017-03-16 | 艾伯維有限公司 | Binding proteins against VEGF, PDGF, and/or their receptors |
GB201510758D0 (en) | 2015-06-18 | 2015-08-05 | Ucb Biopharma Sprl | Novel TNFa structure for use in therapy |
US9862763B2 (en) | 2015-06-24 | 2018-01-09 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibodies and methods of use |
MX2017015817A (en) | 2015-07-06 | 2018-04-10 | Ucb Biopharma Sprl | Tau-binding antibodies. |
AU2016289753C1 (en) | 2015-07-06 | 2021-08-05 | UCB Biopharma SRL | Tau-binding antibodies |
US20180201687A1 (en) | 2015-07-07 | 2018-07-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to myosin 18a and uses thereof |
GB201601077D0 (en) | 2016-01-20 | 2016-03-02 | Ucb Biopharma Sprl | Antibody molecule |
GB201601073D0 (en) | 2016-01-20 | 2016-03-02 | Ucb Biopharma Sprl | Antibodies |
GB201601075D0 (en) | 2016-01-20 | 2016-03-02 | Ucb Biopharma Sprl | Antibodies molecules |
US11667691B2 (en) | 2015-08-07 | 2023-06-06 | Novartis Ag | Treatment of cancer using chimeric CD3 receptor proteins |
US10509035B2 (en) | 2015-08-07 | 2019-12-17 | Gamamabs Pharma Sa | Antibodies, antibody drug conjugates and methods of use |
RU2018107754A (en) | 2015-08-11 | 2019-09-12 | Селлектис | CELLS FOR IMMUNOTHERAPY CREATED FOR TARGETING OF CD38 ANTIGEN AND FOR INACTIVATION OF CD38 GENE |
US11649435B2 (en) | 2015-08-28 | 2023-05-16 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
EP3340995A4 (en) | 2015-08-28 | 2019-04-03 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
BR112018003186A2 (en) | 2015-09-01 | 2018-09-25 | Agenus Inc. | anti-pd-1 antibodies and their methods of use |
JP7002446B2 (en) | 2015-09-21 | 2022-03-04 | アプティーボ リサーチ アンド デベロップメント エルエルシー | CD3 binding polypeptide |
WO2017060397A1 (en) | 2015-10-09 | 2017-04-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for predicting the survival time of subjects suffering from melanoma metastases |
US10149887B2 (en) | 2015-10-23 | 2018-12-11 | Canbas Co., Ltd. | Peptides and peptidomimetics in combination with t cell activating and/or checkpoint inhibiting agents for cancer treatment |
RU2754683C2 (en) | 2015-10-27 | 2021-09-06 | Юсб Биофарма Срл | Methods for treatment using anti-il-17a antibodies |
CA3003252A1 (en) | 2015-10-28 | 2017-05-04 | Yale University | Humanized anti-dkk2 antibody and uses thereof |
WO2017072669A1 (en) | 2015-10-28 | 2017-05-04 | Friedrich Miescher Institute For Biomedical Research | Tenascin-w and biliary tract cancers |
AR106543A1 (en) | 2015-11-02 | 2018-01-24 | Netris Pharma | NTN1 NEUTRALIZING AGENT COMBINATION THERAPY WITH DRUGS THAT INHIBIT EPIGENTICAL CONTROL |
US11235063B2 (en) | 2015-11-03 | 2022-02-01 | Merck Patent Gmbh | Bi-specific antibodies for enhanced tumor selectivity and inhibition and uses thereof |
WO2017079419A1 (en) | 2015-11-05 | 2017-05-11 | The Regents Of The University Of California | Cells labelled with lipid conjugates and methods of use thereof |
CN116217729A (en) | 2015-11-12 | 2023-06-06 | 思进公司 | Glycan interaction compounds and methods of use |
US20170189548A1 (en) | 2015-11-25 | 2017-07-06 | Immunogen, Inc. | Pharmaceutical formulations and methods of use thereof |
EP3383910A1 (en) | 2015-11-30 | 2018-10-10 | AbbVie Inc. | ANTI-huLRRC15 ANTIBODY DRUG CONJUGATES AND METHODS FOR THEIR USE |
JP2019500327A (en) | 2015-11-30 | 2019-01-10 | アッヴィ・インコーポレイテッド | Anti-huLRRC15 antibody drug conjugate and method of use thereof |
KR20180100122A (en) | 2015-12-02 | 2018-09-07 | 주식회사 에스티사이언스 | Antibodies specific for glycated BTLA (B- and T-lymphocyte weakening factor) |
ES2861449T3 (en) | 2015-12-02 | 2021-10-06 | Stcube & Co Inc | Antibodies and Molecules that Immunospecifically Bind to BTN1A1 and Their Therapeutic Uses |
GB201521389D0 (en) | 2015-12-03 | 2016-01-20 | Ucb Biopharma Sprl | Method |
GB201521391D0 (en) | 2015-12-03 | 2016-01-20 | Ucb Biopharma Sprl | Antibodies |
GB201521393D0 (en) | 2015-12-03 | 2016-01-20 | Ucb Biopharma Sprl | Antibodies |
GB201521382D0 (en) | 2015-12-03 | 2016-01-20 | Ucb Biopharma Sprl | Antibodies |
GB201521383D0 (en) | 2015-12-03 | 2016-01-20 | Ucb Biopharma Sprl And Ucb Celltech | Method |
US20180271998A1 (en) | 2015-12-04 | 2018-09-27 | Merrimack Pharmaceuticals, Inc. | Disulfide-stabilized fabs |
US11052111B2 (en) | 2015-12-08 | 2021-07-06 | Chimera Bioengineering, Inc. | Smart CAR devices and DE CAR polypeptides for treating disease and methods for enhancing immune responses |
BR112018012113A2 (en) | 2015-12-15 | 2018-12-04 | Oncoimmune Inc | chimeric and humanized anti-human ctla4 monoclonal antibodies and uses thereof |
GB201522394D0 (en) | 2015-12-18 | 2016-02-03 | Ucb Biopharma Sprl | Antibodies |
EP3184544A1 (en) | 2015-12-23 | 2017-06-28 | Julius-Maximilians-Universität Würzburg | Glycoprotein v inhibitors for use as coagulants |
AU2017204683B2 (en) | 2015-12-31 | 2023-03-16 | Syncerus S.À R.L. | Compositions and methods for assessing the risk of cancer occurrence |
EP3851457A1 (en) | 2016-01-21 | 2021-07-21 | Novartis AG | Multispecific molecules targeting cll-1 |
US10465003B2 (en) | 2016-02-05 | 2019-11-05 | Janssen Biotech, Inc. | Anti-TNF antibodies, compositions, methods and use for the treatment or prevention of type 1 diabetes |
GB201602413D0 (en) | 2016-02-10 | 2016-03-23 | Nascient Ltd | Method |
MX2018010295A (en) | 2016-02-26 | 2019-06-06 | Inst Nat Sante Rech Med | Antibodies having specificity for btla and uses thereof. |
KR102424496B1 (en) | 2016-03-02 | 2022-07-25 | 아이덱스 래보러토리즈, 인코포레이티드 | Methods and compositions for the detection and diagnosis of renal disease and periodontal disease |
SG11201807489PA (en) | 2016-03-04 | 2018-09-27 | Novartis Ag | Cells expressing multiple chimeric antigen receptor (car) molecules and uses therefore |
EP3429620A1 (en) | 2016-03-15 | 2019-01-23 | AstraZeneca AB | Combination of a bace inhibitor and an antibody or antigen-binding fragment for the treatment of a disorder associated with the accumulation of amyloid beta |
EP3430044A1 (en) | 2016-03-17 | 2019-01-23 | Numab Innovation AG | Anti-tnf alpha -antibodies and functional fragments thereof |
LT3219727T (en) | 2016-03-17 | 2021-02-10 | Tillotts Pharma Ag | Anti-tnf alpha-antibodies and functional fragments thereof |
PT3219726T (en) | 2016-03-17 | 2020-12-15 | Tillotts Pharma Ag | Anti-tnf alpha-antibodies and functional fragments thereof |
EA039201B1 (en) | 2016-03-17 | 2021-12-16 | Нумаб Инновейшн Аг | Anti-tnf-antibodies and functional fragments thereof |
JP7049311B2 (en) | 2016-03-17 | 2022-04-06 | ヌマブ イノヴェイション アーゲー | Anti-TNFα antibodies and their functional fragments |
CN108697799A (en) | 2016-03-22 | 2018-10-23 | 生态学有限公司 | The application of anti-LGR5 monoclonal antibodies |
EP3432924A1 (en) | 2016-03-23 | 2019-01-30 | Novartis AG | Cell secreted minibodies and uses thereof |
AU2017244108B2 (en) | 2016-03-29 | 2021-03-18 | University Of Southern California | Chimeric antigen receptors targeting cancer |
WO2017181119A2 (en) | 2016-04-15 | 2017-10-19 | Novartis Ag | Compositions and methods for selective protein expression |
IL297519B1 (en) | 2016-04-27 | 2024-02-01 | Abbvie Inc | Methods of treatment of diseases in which il-13 activity is detrimental using anti-il-13 antibodies |
US11466076B2 (en) | 2016-05-01 | 2022-10-11 | UCB Biopharma SRL | Binding domain or antibody specific to a human serum albumin (HSA) |
TW201808336A (en) | 2016-05-11 | 2018-03-16 | 賽諾菲公司 | Treatment regimen using anti-MUC1 maytansinoid immunoconjugate antibody for the treatment of tumors |
DK3458102T3 (en) | 2016-05-17 | 2020-07-27 | Abbvie Biotherapeutics Inc | ANTI-CMET ANTIBODY DRUG CONJUGATES AND PROCEDURES FOR USE |
US11623958B2 (en) | 2016-05-20 | 2023-04-11 | Harpoon Therapeutics, Inc. | Single chain variable fragment CD3 binding proteins |
BR112018073739A2 (en) | 2016-05-20 | 2019-02-26 | Harpoon Therapeutics, Inc. | single domain serum albumin binding protein |
CN109415441B (en) | 2016-05-24 | 2023-04-07 | 英斯梅德股份有限公司 | Antibodies and methods of making same |
WO2017205745A1 (en) | 2016-05-27 | 2017-11-30 | Abbvie Biotherapeutics Inc. | Anti-4-1bb antibodies and their uses |
CA3024508A1 (en) | 2016-05-27 | 2017-11-30 | Agenus Inc. | Anti-tim-3 antibodies and methods of use thereof |
UA123111C2 (en) | 2016-05-27 | 2021-02-17 | Еббві Байотерапьютікс Інк. | Anti-cd40 antibodies and their uses |
US20210177896A1 (en) | 2016-06-02 | 2021-06-17 | Novartis Ag | Therapeutic regimens for chimeric antigen receptor (car)- expressing cells |
JP2019526529A (en) | 2016-06-08 | 2019-09-19 | アッヴィ・インコーポレイテッド | Anti-B7-H3 antibody and antibody drug conjugate |
PE20190177A1 (en) | 2016-06-08 | 2019-02-01 | Abbvie Inc | ANTI-B7-H3 ANTIBODIES AND ANTIBODY AND DRUG CONJUGATES |
CN109641962A (en) | 2016-06-08 | 2019-04-16 | 艾伯维公司 | Anti- B7-H3 antibody and antibody drug conjugates |
GB201610198D0 (en) | 2016-06-10 | 2016-07-27 | Ucb Biopharma Sprl | Anti-ige antibodies |
CN113773387A (en) | 2016-06-13 | 2021-12-10 | 天境生物科技(上海)有限公司 | PD-L1 antibodies and uses thereof |
WO2017220989A1 (en) | 2016-06-20 | 2017-12-28 | Kymab Limited | Anti-pd-l1 and il-2 cytokines |
CN109641049B (en) | 2016-06-21 | 2023-07-07 | 特尼奥生物股份有限公司 | CD3 binding antibodies |
KR20190039937A (en) | 2016-07-08 | 2019-04-16 | 스태튼 바이오테크놀로지 비.브이. | Anti-ApoC3 antibodies and methods of use thereof |
EP3484516A4 (en) | 2016-07-14 | 2020-03-18 | Fred Hutchinson Cancer Research Center | Multiple bi-specific binding domain constructs with different epitope binding to treat cancer |
CA3030837A1 (en) | 2016-07-15 | 2018-01-18 | Novartis Ag | Treatment and prevention of cytokine release syndrome using a chimeric antigen receptor in combination with a kinase inhibitor |
TWI790206B (en) | 2016-07-18 | 2023-01-21 | 法商賽諾菲公司 | Bispecific antibody-like binding proteins specifically binding to cd3 and cd123 |
EP3485017A4 (en) | 2016-07-18 | 2020-03-04 | Helix Biopharma Corp. | Car immune cells directed to carcinoembryonic antigen related cell adhesion molecule 6 to treat cancer |
SG11201900677SA (en) | 2016-07-28 | 2019-02-27 | Novartis Ag | Combination therapies of chimeric antigen receptors adn pd-1 inhibitors |
US11186634B2 (en) | 2016-07-29 | 2021-11-30 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies targeting tumor associated macrophages and uses thereof |
US20190161542A1 (en) | 2016-08-01 | 2019-05-30 | Novartis Ag | Treatment of cancer using a chimeric antigen receptor in combination with an inhibitor of a pro-m2 macrophage molecule |
JP7109789B2 (en) | 2016-08-02 | 2022-08-01 | ティーシーアール2 セラピューティクス インク. | Compositions and methods for TCR reprogramming using fusion proteins |
WO2018038684A1 (en) | 2016-08-26 | 2018-03-01 | Agency For Science, Technology And Research | Macrophage stimulating protein receptor (or ron - recepteur d' origine nantais) antibodies and uses thereof |
BR112019003866A2 (en) | 2016-08-29 | 2019-07-16 | Psioxus Therapeutics Ltd | bispecific mab fragment-stimulated adenovirus with t-cell redirection (bite) |
PL3512547T3 (en) | 2016-09-14 | 2021-03-08 | Abbvie Biotherapeutics Inc. | Anti-pd-1 antibodies |
BR112019004873A2 (en) | 2016-09-14 | 2019-06-11 | Teneobio Inc | cd3 binding antibodies |
EP3512880A1 (en) | 2016-09-15 | 2019-07-24 | Ablynx NV | Immunoglobulin single variable domains directed against macrophage migration inhibitory factor |
WO2018050111A1 (en) | 2016-09-19 | 2018-03-22 | I-Mab | Anti-gm-csf antibodies and uses thereof |
KR20240035625A (en) | 2016-09-21 | 2024-03-15 | 넥스트큐어 인코포레이티드 | Antibodies for siglec-15 and methods of use thereof |
GB201616596D0 (en) | 2016-09-29 | 2016-11-16 | Nascient Limited | Epitope and antibodies |
EP3523331A1 (en) | 2016-10-07 | 2019-08-14 | Novartis AG | Chimeric antigen receptors for the treatment of cancer |
MX2019003899A (en) | 2016-10-07 | 2019-08-14 | Tcr2 Therapeutics Inc | Compositions and methods for t-cell receptors reprogramming using fusion proteins. |
MA46529A (en) | 2016-10-11 | 2019-08-21 | Agenus Inc | ANTI-LAG-3 ANTIBODIES AND PROCESSES FOR USE |
US11007254B2 (en) | 2016-10-17 | 2021-05-18 | Musc Foundation For Research Development | Compositions and methods for treating central nervous system injury |
CA3041843A1 (en) | 2016-11-02 | 2018-05-11 | Immunogen, Inc. | Combination treatment with antibody-drug conjugates and parp inhibitors |
WO2018083257A1 (en) | 2016-11-03 | 2018-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding transgenes |
WO2018083258A1 (en) | 2016-11-03 | 2018-05-11 | Psioxus Therapeutics Limited | Oncolytic adenovirus encoding at least three transgenes |
US11779604B2 (en) | 2016-11-03 | 2023-10-10 | Kymab Limited | Antibodies, combinations comprising antibodies, biomarkers, uses and methods |
CA3042989A1 (en) | 2016-11-07 | 2018-05-11 | Junho Chung | Anti-family with sequence similarity 19, member a5 antibodies and method of use thereof |
EP3541847A4 (en) | 2016-11-17 | 2020-07-08 | Seattle Genetics, Inc. | Glycan-interacting compounds and methods of use |
WO2018091720A1 (en) | 2016-11-21 | 2018-05-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the prophylactic treatment of metastases |
CN110177803A (en) | 2016-11-22 | 2019-08-27 | T细胞受体治疗公司 | For using fusion protein to carry out the composition and method that TCR is reprogramed |
EP3544628A4 (en) | 2016-11-23 | 2020-11-18 | Immunoah Therapeutics, Inc. | 4-1bb binding proteins and uses thereof |
KR102275008B1 (en) | 2016-11-23 | 2021-07-13 | 하푼 테라퓨틱스, 인크. | prostate specific membrane antigen binding protein |
MX2019006045A (en) | 2016-11-23 | 2019-11-11 | Harpoon Therapeutics Inc | Psma targeting trispecific proteins and methods of use. |
CA3046082A1 (en) | 2016-12-07 | 2018-06-14 | Agenus Inc. | Antibodies and methods of use thereof |
JP6992068B2 (en) | 2016-12-07 | 2022-02-03 | アジェナス インコーポレイテッド | Anti-CTLA-4 antibodies and how to use them |
BR112019012328A2 (en) | 2016-12-15 | 2019-11-19 | Abbvie Biotherapeutics Inc | anti-ox40 antibodies and their uses |
GB201621635D0 (en) | 2016-12-19 | 2017-02-01 | Ucb Biopharma Sprl | Crystal structure |
AU2017382251A1 (en) | 2016-12-21 | 2019-07-11 | Teneobio, Inc. | Anti-BCMA heavy chain-only antibodies |
WO2018119288A1 (en) | 2016-12-22 | 2018-06-28 | Sanofi | Anti-human cxcr3 antibodies for treatment of vitiligo |
US20180214542A1 (en) | 2016-12-22 | 2018-08-02 | Sanofi | Humanized cxcr3 antibodies with depleting activity and methods of use thereof |
US20190315852A1 (en) | 2017-01-05 | 2019-10-17 | Netris Pharma | Combined treatment with netrin-1 interfering drug and immune checkpoint inhibitors drugs |
KR102646046B1 (en) | 2017-01-06 | 2024-03-08 | 바이오션, 인코포레이티드 | ERBB2 antibody and uses thereof |
MX2019007848A (en) | 2017-01-20 | 2019-09-09 | Tayu Huaxia Biotech Medical Group Co Ltd | Anti-pd-1 antibodies and uses thereof. |
LT3383916T (en) | 2017-01-24 | 2022-06-10 | I-Mab Biopharma Us Limited | Anti-cd73 antibodies and uses thereof |
ES2912408T3 (en) | 2017-01-26 | 2022-05-25 | Novartis Ag | CD28 compositions and methods for therapy with chimeric receptors for antigens |
JP2020506916A (en) | 2017-01-30 | 2020-03-05 | ヤンセン バイオテツク,インコーポレーテツド | Anti-TNF antibodies, compositions and methods for the treatment of active psoriatic arthritis |
US20190375815A1 (en) | 2017-01-31 | 2019-12-12 | Novartis Ag | Treatment of cancer using chimeric t cell receptor proteins having multiple specificities |
EP3354278A1 (en) | 2017-01-31 | 2018-08-01 | Sanofi | Neuronal cell protective effect of antibodies specific for the protofibrillar form of the beta-amyloid peptide |
KR20190115042A (en) | 2017-02-07 | 2019-10-10 | 얀센 바이오테크 인코포레이티드 | Anti-TNF Antibodies, Compositions, and Methods for the Treatment of Active Ankylosing Spondylitis |
WO2018151841A1 (en) | 2017-02-17 | 2018-08-23 | Sanofi | Multispecific binding molecules having specificity to dystroglycan and laminin-2 |
CA3053774A1 (en) | 2017-02-17 | 2018-08-23 | Sanofi | Multispecific binding molecules having specificity to dystroglycan and laminin-2 |
EP3589662A4 (en) | 2017-02-28 | 2020-12-30 | Harpoon Therapeutics, Inc. | Inducible monovalent antigen binding protein |
CN110392697A (en) | 2017-03-02 | 2019-10-29 | 国家医疗保健研究所 | There is the antibody and application thereof of specificity to NECTIN-4 |
EP3589319A4 (en) | 2017-03-03 | 2021-07-14 | Seagen Inc. | Glycan-interacting compounds and methods of use |
JP7308150B2 (en) | 2017-03-16 | 2023-07-13 | イナート・ファルマ・ソシエテ・アノニム | Compositions and methods for treating cancer |
TWI808963B (en) | 2017-03-22 | 2023-07-21 | 法商賽諾菲公司 | Treatment of lupus using humanized anti-cxcr5 antibodies |
WO2018183182A1 (en) | 2017-03-27 | 2018-10-04 | Celgene Corporation | Methods and compositions for reduction of immunogenicity |
WO2018183366A1 (en) | 2017-03-28 | 2018-10-04 | Syndax Pharmaceuticals, Inc. | Combination therapies of csf-1r or csf-1 antibodies and a t-cell engaging therapy |
KR102629972B1 (en) | 2017-04-13 | 2024-01-29 | 아게누스 인코포레이티드 | Anti-CD137 antibody and methods of using the same |
US20230227566A1 (en) | 2017-04-14 | 2023-07-20 | Gamamabs Pharma | Amhrii-binding compounds for preventing or treating lung cancers |
MX2019012137A (en) | 2017-04-14 | 2020-07-20 | Gamamabs Pharma | Amhrii-binding compounds for preventing or treating cancers. |
CN110506056A (en) | 2017-04-21 | 2019-11-26 | 斯塔滕生物技术有限公司 | Anti- APOC3 antibody and its application method |
WO2018196782A1 (en) | 2017-04-27 | 2018-11-01 | The University Of Hong Kong | Use of hcn inhibitors for treatment of cancer |
US20200055948A1 (en) | 2017-04-28 | 2020-02-20 | Novartis Ag | Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor |
PL3618863T3 (en) | 2017-05-01 | 2023-11-06 | Agenus Inc. | Anti-tigit antibodies and methods of use thereof |
JP2020519285A (en) * | 2017-05-10 | 2020-07-02 | ザ ウィスター インスティテュート オブ アナトミー アンド バイオロジー | Optimized nucleic acid antibody construct |
US10543271B2 (en) | 2017-05-12 | 2020-01-28 | Harpoon Therapeutics, Inc. | Mesothelin binding proteins |
EP3621648A4 (en) | 2017-05-12 | 2021-01-20 | Harpoon Therapeutics, Inc. | Msln targeting trispecific proteins and methods of use |
JOP20190256A1 (en) | 2017-05-12 | 2019-10-28 | Icahn School Med Mount Sinai | Newcastle disease viruses and uses thereof |
CN110662760A (en) | 2017-05-12 | 2020-01-07 | 奥古斯塔大学研究所公司 | Human alpha-fetoprotein specific T cell receptor and uses thereof |
US20200171150A1 (en) | 2017-05-19 | 2020-06-04 | Syndax Pharmaceuticals, Inc. | Combination therapies |
US20200148768A1 (en) | 2017-05-31 | 2020-05-14 | Stcube & Co., Inc. | Antibodies and molecules that immunospecifically bind to btn1a1 and the therapeutic uses thereof |
EP3409688A1 (en) | 2017-05-31 | 2018-12-05 | Tillotts Pharma Ag | Topical treatment of inflammatory bowel disease using anti-tnf-alpha antibodies and fragments thereof |
WO2018222685A1 (en) | 2017-05-31 | 2018-12-06 | Stcube & Co., Inc. | Methods of treating cancer using antibodies and molecules that immunospecifically bind to btn1a1 |
SI3630143T1 (en) | 2017-06-01 | 2023-11-30 | Akamis Bio Limited | Oncolytic virus and method |
TWI811220B (en) | 2017-06-02 | 2023-08-11 | 比利時商艾伯林克斯公司 | Aggrecan binding immunoglobulins |
KR20200026209A (en) | 2017-06-06 | 2020-03-10 | 주식회사 에스티큐브앤컴퍼니 | How to treat cancer using antibodies and molecules that bind BTN1A1 or BTN1A1-ligand |
EP3638295A1 (en) | 2017-06-13 | 2020-04-22 | TCR2 Therapeutics Inc. | Compositions and methods for tcr reprogramming using fusion proteins |
CN117567624A (en) | 2017-06-20 | 2024-02-20 | 特纳奥尼股份有限公司 | Heavy chain-only anti-BCMA antibodies |
WO2018237148A1 (en) | 2017-06-21 | 2018-12-27 | Gilead Sciences, Inc. | Multispecific antibodies that target hiv gp120 and cd3 |
JP2020526584A (en) | 2017-06-28 | 2020-08-31 | ザ ロックフェラー ユニバーシティー | Anti-MERTK Agonist Antibodies-Drug Conjugates and Their Use |
WO2019018647A1 (en) | 2017-07-20 | 2019-01-24 | Pfizer Inc. | Anti-gd3 antibodies and antibody-drug conjugates |
WO2019020480A1 (en) | 2017-07-24 | 2019-01-31 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies and peptides to treat hcmv related diseases |
EP3658178A1 (en) | 2017-07-27 | 2020-06-03 | Nomocan Pharmaceuticals LLC | Antibodies to m(h)dm2/4 and their use in diagnosing and treating cancer |
EP3625254B1 (en) * | 2017-07-31 | 2023-12-13 | F. Hoffmann-La Roche AG | Three-dimensional structure-based humanization method |
WO2019046338A1 (en) | 2017-08-28 | 2019-03-07 | Angiex, Inc. | Anti-tm4sf1 antibodies and methods of using same |
CN111133005A (en) | 2017-09-07 | 2020-05-08 | 奥古斯塔大学研究所公司 | Programmed cell death protein 1 antibodies |
EP3456739A1 (en) | 2017-09-19 | 2019-03-20 | Tillotts Pharma Ag | Use of anti-tnfalpha antibodies for treating wounds |
ES2938608T3 (en) | 2017-09-20 | 2023-04-13 | Tillotts Pharma Ag | Method for preparing a solid dosage form comprising antibodies by wet granulation, extrusion and spheronization |
ES2938609T3 (en) | 2017-09-20 | 2023-04-13 | Tillotts Pharma Ag | Preparation of Solid Dosage Forms Comprising Antibodies by Solution/Suspension Layering |
EP3459529A1 (en) | 2017-09-20 | 2019-03-27 | Tillotts Pharma Ag | Preparation of sustained release solid dosage forms comprising antibodies by spray drying |
CA3074933A1 (en) | 2017-09-21 | 2019-03-28 | Imcheck Therapeutics Sas | Antibodies having specificity for btn2 and uses thereof |
WO2019070161A2 (en) | 2017-10-04 | 2019-04-11 | Opko Pharmaceuticals, Llc | Articles and methods directed to personalized therapy of cancer |
WO2019075090A1 (en) | 2017-10-10 | 2019-04-18 | Tilos Therapeutics, Inc. | Anti-lap antibodies and uses thereof |
WO2019074124A1 (en) | 2017-10-12 | 2019-04-18 | Keio University | Anti aqp3 monoclonal antibody specifically binding to extracellular domain of aquaporin 3 (aqp3) and use thereof |
US11136403B2 (en) | 2017-10-13 | 2021-10-05 | Harpoon Therapeutics, Inc. | Trispecific proteins and methods of use |
EP3694871A4 (en) | 2017-10-13 | 2021-11-10 | Harpoon Therapeutics, Inc. | B cell maturation antigen binding proteins |
TW201922294A (en) | 2017-10-31 | 2019-06-16 | 美商伊繆諾金公司 | Combination treatment with antibody-drug conjugates and cytarabine |
SG11202003980PA (en) | 2017-10-31 | 2020-05-28 | Staten Biotechnology B V | Anti-apoc3 antibodies and methods of use thereof |
AU2018364630A1 (en) | 2017-11-09 | 2020-05-21 | Pinteon Therapeutics Inc. | Methods and compositions for the generation and use of humanized conformation-specific phosphorylated tau antibodies |
CA3082410A1 (en) | 2017-11-14 | 2019-05-23 | Arcellx, Inc. | Multifunctional immune cell therapies |
AU2018371271A1 (en) | 2017-11-27 | 2020-06-11 | Purdue Pharma L.P. | Humanized antibodies targeting human tissue factor |
KR20200104364A (en) | 2017-12-27 | 2020-09-03 | 테네오바이오, 인코포레이티드 | CD3-delta/epsilon heterodimer specific antibody |
GB201802486D0 (en) | 2018-02-15 | 2018-04-04 | Ucb Biopharma Sprl | Methods |
AU2019225393A1 (en) | 2018-02-23 | 2020-08-20 | Cartherics Pty. Ltd. | T cell disease treatment targeting TAG-72 |
US20210002373A1 (en) | 2018-03-01 | 2021-01-07 | Nextcure, Inc. | KLRG1 Binding Compositions and Methods of Use Thereof |
EP3765499A1 (en) | 2018-03-12 | 2021-01-20 | Zoetis Services LLC | Anti-ngf antibodies and methods thereof |
GB201804701D0 (en) | 2018-03-23 | 2018-05-09 | Gammadelta Therapeutics Ltd | Lymphocytes expressing heterologous targeting constructs |
US11155618B2 (en) | 2018-04-02 | 2021-10-26 | Bristol-Myers Squibb Company | Anti-TREM-1 antibodies and uses thereof |
CN112004558A (en) | 2018-04-12 | 2020-11-27 | 米迪亚制药有限责任公司 | LGALS3BP antibody-drug-conjugate and its use for the treatment of cancer |
EP3784274A1 (en) | 2018-04-27 | 2021-03-03 | Fondazione Ebri Rita Levi-Montalcini | Antibody directed against a tau-derived neurotoxic peptide and uses thereof |
WO2019210153A1 (en) | 2018-04-27 | 2019-10-31 | Novartis Ag | Car t cell therapies with enhanced efficacy |
EP3788369A1 (en) | 2018-05-01 | 2021-03-10 | Novartis Ag | Biomarkers for evaluating car-t cells to predict clinical outcome |
WO2019222130A1 (en) | 2018-05-15 | 2019-11-21 | Immunogen, Inc. | Combination treatment with antibody-drug conjugates and flt3 inhibitors |
EP3802609A2 (en) | 2018-05-24 | 2021-04-14 | Janssen Biotech, Inc. | Psma binding agents and uses thereof |
EP3801769A1 (en) | 2018-05-25 | 2021-04-14 | Novartis AG | Combination therapy with chimeric antigen receptor (car) therapies |
PE20210320A1 (en) | 2018-06-01 | 2021-02-16 | Novartis Ag | BINDING MOLECULES AGAINST BCMA AND THE USES OF THEM |
CA3099893A1 (en) | 2018-06-18 | 2019-12-26 | Innate Pharma | Compositions and methods for treating cancer |
EP3806898A1 (en) | 2018-06-18 | 2021-04-21 | UCB Biopharma SRL | Gremlin-1 antagonist for the prevention and treatment of cancer |
TW202016144A (en) | 2018-06-21 | 2020-05-01 | 日商第一三共股份有限公司 | Compositions including cd3 antigen binding fragments and uses thereof |
AU2019288677A1 (en) | 2018-06-21 | 2021-01-14 | Yumanity Therapeutics, Inc. | Compositions and methods for the treatment and prevention of neurological disorders |
EP3814369A1 (en) | 2018-06-29 | 2021-05-05 | Stichting Het Nederlands Kanker Instituut- Antoni van Leeuwenhoek Ziekenhuis | Tweak-receptor agonists for use in combination with immunotherapy of a cancer |
WO2020003210A1 (en) | 2018-06-29 | 2020-01-02 | Kangwon National University University-Industry Cooperation Foundation | Anti-l1cam antibodies and uses thereof |
CA3106074A1 (en) | 2018-07-10 | 2020-01-16 | Mitsubishi Tanabe Pharma Corporation | Prevention or treatment method for peripheral neuropathy or pain accompanying disease in which peripheral neuropathy or astrocyte disorder is recognized |
EP3824287A1 (en) | 2018-07-20 | 2021-05-26 | Pierre Fabre Médicament | Receptor for vista |
CN113039209A (en) | 2018-08-30 | 2021-06-25 | T细胞受体治疗公司 | Compositions and methods for TCR reprogramming using fusion proteins |
WO2020056170A1 (en) | 2018-09-12 | 2020-03-19 | Fred Hutchinson Cancer Research Center | Reducing cd33 expression to selectively protect therapeutic cells |
KR20210089143A (en) | 2018-09-18 | 2021-07-15 | 메리맥 파마슈티컬즈, 인크. | Anti-TNFR2 antibodies and uses thereof |
JP7425049B2 (en) | 2018-09-25 | 2024-01-30 | ハープーン セラピューティクス,インク. | DLL3 binding protein and method of use |
EP3856779A1 (en) | 2018-09-28 | 2021-08-04 | Novartis AG | Cd22 chimeric antigen receptor (car) therapies |
WO2020065594A1 (en) | 2018-09-28 | 2020-04-02 | Kyowa Kirin Co., Ltd. | Il-36 antibodies and uses thereof |
US20210347851A1 (en) | 2018-09-28 | 2021-11-11 | Novartis Ag | Cd19 chimeric antigen receptor (car) and cd22 car combination therapies |
CN112969503A (en) | 2018-10-03 | 2021-06-15 | 斯塔滕生物技术有限公司 | Antibodies specific for human and cynomolgus macaques APOC3 and methods of use thereof |
CN113164780A (en) | 2018-10-10 | 2021-07-23 | 泰洛斯治疗公司 | anti-LAP antibody variants and uses thereof |
AR117653A1 (en) | 2018-10-16 | 2021-08-25 | UCB Biopharma SRL | METHOD FOR TREATMENT OF MYASTENIA GRAVE |
GB201817309D0 (en) | 2018-10-24 | 2018-12-05 | Ucb Biopharma Sprl | Antibodies |
GB201817311D0 (en) | 2018-10-24 | 2018-12-05 | Ucb Biopharma Sprl | Antibodies |
WO2020092455A2 (en) | 2018-10-29 | 2020-05-07 | The Broad Institute, Inc. | Car t cell transcriptional atlas |
JP2022512860A (en) | 2018-11-06 | 2022-02-07 | アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル | Methods and Pharmaceutical Compositions for the Treatment of Acute Myeloid Leukemia by Eradication of Leukemia Stem Cells |
US20220026445A1 (en) | 2018-12-07 | 2022-01-27 | Georgia Tech Research Corporation | Antibodies that bind to natively folded myocilin |
WO2020114616A1 (en) | 2018-12-07 | 2020-06-11 | Tillotts Pharma Ag | Topical treatment of immune checkpoint inhibitor induced diarrhoea, colitis or enterocolitis using antibodies and fragments thereof |
CN113660944A (en) | 2018-12-11 | 2021-11-16 | Q32生物公司 | Fusion protein constructs for complement-associated diseases |
WO2020120786A1 (en) | 2018-12-14 | 2020-06-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Isolated mhc-derived human peptides and uses thereof for stimulating and activating the suppressive function of cd8+cd45rclow tregs |
TW202031684A (en) | 2018-12-20 | 2020-09-01 | 日商協和麒麟股份有限公司 | Fn14 antibodies and uses thereof |
GB201900732D0 (en) | 2019-01-18 | 2019-03-06 | Ucb Biopharma Sprl | Antibodies |
EP3917968A1 (en) | 2019-01-30 | 2021-12-08 | Nomocan Pharmaceuticals LLC | Antibodies to m(h)dm2/4 and their use in diagnosing and treating cancer |
EP3917954A1 (en) | 2019-01-31 | 2021-12-08 | Numab Therapeutics AG | Multispecific antibodies having specificity for tnfa and il-17a, antibodies targeting il-17a, and methods of use thereof |
US20220290128A1 (en) | 2019-02-04 | 2022-09-15 | National University Corporation Ehime University | CAR LIBRARY AND scFv MANUFACTURING METHOD |
WO2020169472A2 (en) | 2019-02-18 | 2020-08-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of inducing phenotypic changes in macrophages |
CN112703013B (en) | 2019-02-22 | 2022-09-30 | 武汉友芝友生物制药股份有限公司 | CD3 antigen binding fragment and application thereof |
CN112142847B (en) | 2019-02-22 | 2023-05-05 | 武汉友芝友生物制药股份有限公司 | Engineered Fc fragments, antibodies comprising same and uses thereof |
US20220088075A1 (en) | 2019-02-22 | 2022-03-24 | The Trustees Of The University Of Pennsylvania | Combination therapies of egfrviii chimeric antigen receptors and pd-1 inhibitors |
US11242407B2 (en) | 2019-02-26 | 2022-02-08 | Inspirna, Inc. | High-affinity anti-MERTK antibodies and uses thereof |
EP3930846A1 (en) | 2019-03-01 | 2022-01-05 | Merrimack Pharmaceuticals, Inc. | Anti-tnfr2 antibodies and uses thereof |
SG11202109932WA (en) | 2019-03-20 | 2021-10-28 | Imcheck Therapeutics Sas | Antibodies having specificity for btn2 and uses thereof |
US20220177558A1 (en) | 2019-03-25 | 2022-06-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Treatment of taupathy disorders by targeting new tau species |
JP2022528324A (en) | 2019-03-26 | 2022-06-10 | アスラン ファーマシューティカルズ ピーティーイー リミテッド | Treatment with anti-IL13R antibody or binding fragment thereof |
JP2022524215A (en) | 2019-03-28 | 2022-04-28 | ダニスコ・ユーエス・インク | Modified antibody |
WO2020213084A1 (en) | 2019-04-17 | 2020-10-22 | Keio University | Anti aqp3 monoclonal antibody specifically binding to extracellular domain of aquaporin 3 (aqp3) and use thereof |
WO2020236792A1 (en) | 2019-05-21 | 2020-11-26 | Novartis Ag | Cd19 binding molecules and uses thereof |
US20230071196A1 (en) | 2019-05-21 | 2023-03-09 | Novartis Ag | Variant cd58 domains and uses thereof |
EP3972690A4 (en) | 2019-05-23 | 2023-07-05 | Janssen Biotech, Inc. | Method of treating inflammatory bowel disease with a combination therapy of antibodies to il-23 and tnf alpha |
CN114206927A (en) | 2019-06-14 | 2022-03-18 | 特尼奥生物股份有限公司 | Multispecific heavy chain antibodies that bind to CD22 and CD3 |
JP2022539248A (en) | 2019-07-02 | 2022-09-07 | フレッド ハッチンソン キャンサー リサーチ センター | Recombinant AD35 vectors and related gene therapy improvements |
CN113968910A (en) | 2019-07-11 | 2022-01-25 | 武汉友芝友生物制药有限公司 | Tetravalent symmetric bispecific antibodies |
CN114341186A (en) | 2019-07-30 | 2022-04-12 | 魁尔斯弗生物治疗股份有限公司 | Bispecific anti-LRRC 15 and CD3 epsilon antibodies |
JP2022543259A (en) | 2019-08-02 | 2022-10-11 | オレガ・バイオテック | Novel IL-17B antibody |
AU2020329217A1 (en) | 2019-08-12 | 2022-07-28 | Aptevo Research And Development Llc | 4-1BB and OX40 binding proteins and related compositions and methods, antibodies against 4-1BB, antibodies against OX40 |
WO2021035170A1 (en) | 2019-08-21 | 2021-02-25 | Precision Biosciences, Inc. | Compositions and methods for tcr reprogramming using fusion proteins |
CR20220076A (en) | 2019-08-30 | 2022-06-24 | Agenus Inc | Anti-cd96 antibodies and methods of use thereof |
WO2021043206A1 (en) | 2019-09-03 | 2021-03-11 | 百奥泰生物制药股份有限公司 | Anti-tigit immunosuppressant and application thereof |
EP4041767A1 (en) | 2019-09-26 | 2022-08-17 | StCube & Co. | Antibodies specific to glycosylated ctla-4 and methods of use thereof |
CN114450304B (en) | 2019-09-27 | 2023-12-12 | 国家医疗保健研究所 | anti-Mullera tube inhibiting substance antibodies and uses thereof |
WO2021058729A1 (en) | 2019-09-27 | 2021-04-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Anti-müllerian inhibiting substance type i receptor antibodies and uses thereof |
JP2022552282A (en) | 2019-10-09 | 2022-12-15 | エスティーキューブ アンド カンパニー | Antibodies specific for glycosylated LAG3 and methods of use thereof |
EP3812008A1 (en) | 2019-10-23 | 2021-04-28 | Gamamabs Pharma | Amh-competitive antagonist antibody |
EP3825330A1 (en) | 2019-11-19 | 2021-05-26 | International-Drug-Development-Biotech | Anti-cd117 antibodies and methods of use thereof |
WO2021099600A1 (en) | 2019-11-22 | 2021-05-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Inhibitors of adrenomedullin for the treatment of acute myeloid leukemia by eradicating leukemic stem cells |
GB201917480D0 (en) | 2019-11-29 | 2020-01-15 | Univ Oxford Innovation Ltd | Antibodies |
US11897950B2 (en) | 2019-12-06 | 2024-02-13 | Augusta University Research Institute, Inc. | Osteopontin monoclonal antibodies |
WO2021116119A1 (en) | 2019-12-09 | 2021-06-17 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Antibodies having specificity to her4 and uses thereof |
US20230227559A1 (en) | 2019-12-10 | 2023-07-20 | Institut Pasteur | New antibody blocking human fcgriiia and fcgriiib |
GB201919058D0 (en) | 2019-12-20 | 2020-02-05 | Ucb Biopharma Sprl | Multi-specific antibodies |
GB201919062D0 (en) | 2019-12-20 | 2020-02-05 | Ucb Biopharma Sprl | Antibody |
GB201919061D0 (en) | 2019-12-20 | 2020-02-05 | Ucb Biopharma Sprl | Multi-specific antibody |
AR120898A1 (en) | 2019-12-26 | 2022-03-30 | Univ Osaka | AGENT TO TREAT OR PREVENT ACUTE NEUROMYELITIS OPTICA |
TW202138388A (en) | 2019-12-30 | 2021-10-16 | 美商西根公司 | Methods of treating cancer with nonfucosylated anti-cd70 antibodies |
AU2021205893A1 (en) | 2020-01-08 | 2022-06-23 | Synthis Therapeutics, Inc. | ALK5 inhibitor conjugates and uses thereof |
WO2021145432A1 (en) | 2020-01-15 | 2021-07-22 | 国立大学法人大阪大学 | Agent for prevention or treatment of diabetic autonomic neuropathy |
AR121065A1 (en) | 2020-01-15 | 2022-04-13 | Univ Osaka | AGENT TO TREAT OR PREVENT DEMENTIA |
GB202001447D0 (en) | 2020-02-03 | 2020-03-18 | Ucb Biopharma Sprl | Antibodies |
EP4100435A1 (en) | 2020-02-05 | 2022-12-14 | Larimar Therapeutics, Inc. | Tat peptide binding proteins and uses thereof |
WO2021160269A1 (en) | 2020-02-13 | 2021-08-19 | UCB Biopharma SRL | Anti cd44-ctla4 bispecific antibodies |
US20230096030A1 (en) | 2020-02-13 | 2023-03-30 | UCB Biopharma SRL | Bispecific antibodies against cd9 and cd7 |
EP4103608A1 (en) | 2020-02-13 | 2022-12-21 | UCB Biopharma SRL | Bispecific antibodies against cd9 and cd137 |
EP4103612A1 (en) | 2020-02-13 | 2022-12-21 | UCB Biopharma SRL | Bispecific antibodies against cd9 |
WO2021160266A1 (en) | 2020-02-13 | 2021-08-19 | UCB Biopharma SRL | Bispecific antibodies binding hvem and cd9 |
EP4106806A1 (en) | 2020-02-21 | 2022-12-28 | Harpoon Therapeutics, Inc. | Flt3 binding proteins and methods of use |
JP2023516952A (en) | 2020-02-28 | 2023-04-21 | ジェンザイム・コーポレーション | Modified binding polypeptides for optimized drug conjugation |
WO2021175954A1 (en) | 2020-03-04 | 2021-09-10 | Imcheck Therapeutics Sas | Antibodies having specificity for btnl8 and uses thereof |
CA3174103A1 (en) | 2020-03-06 | 2021-09-10 | Go Therapeutics, Inc. | Anti-glyco-cd44 antibodies and their uses |
CN115485295A (en) | 2020-03-10 | 2022-12-16 | 麻省理工学院 | Compositions and methods for immunotherapy of NPM1 c-positive cancers |
US20230203191A1 (en) | 2020-03-30 | 2023-06-29 | Danisco Us Inc | Engineered antibodies |
WO2021197340A1 (en) | 2020-03-31 | 2021-10-07 | 百奥泰生物制药股份有限公司 | Antibody and fusion protein for treating coronaviruses and use thereof |
WO2021207449A1 (en) | 2020-04-09 | 2021-10-14 | Merck Sharp & Dohme Corp. | Affinity matured anti-lap antibodies and uses thereof |
MX2022013402A (en) | 2020-04-24 | 2022-11-14 | Sanofi Sa | Antitumor combinations containing anti-ceacam5 antibody conjugates and folfiri. |
BR112022020592A2 (en) | 2020-04-24 | 2022-11-29 | Sanofi Sa | ANTITUMOR COMBINATIONS CONTAINING ANTI-CEACAM5 ANTIBODY CONJUGATES, TRIFLURIDIN AND TIPIRACILL |
KR20230005176A (en) | 2020-04-24 | 2023-01-09 | 사노피 | Anti-tumor combination containing an anti-CEACAM5 antibody conjugate and cetuximab |
BR112022020497A2 (en) | 2020-04-24 | 2022-12-06 | Sanofi Sa | ANTITUMOR COMBINATIONS CONTAINING ANTI-CEACAM5 ANTIBODY AND FOLFOX CONJUGATES |
CN113637082A (en) | 2020-04-27 | 2021-11-12 | 启愈生物技术(上海)有限公司 | Bispecific antibody targeting human claudin and human PDL1 protein and application thereof |
JP2023526774A (en) | 2020-04-29 | 2023-06-23 | テネオバイオ, インコーポレイテッド | Multispecific heavy chain antibodies with modified heavy chain constant regions |
JP2023525053A (en) | 2020-05-12 | 2023-06-14 | インサーム(インスティテュ ナシオナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシェ メディカル) | A new method to treat cutaneous T-cell lymphoma and TFH-derived lymphoma |
EP3915641A1 (en) | 2020-05-27 | 2021-12-01 | International-Drug-Development-Biotech | Anti-cd5 antibodies and methods of use thereof |
IL298473A (en) | 2020-06-11 | 2023-01-01 | Novartis Ag | Zbtb32 inhibitors and uses thereof |
EP4183416A1 (en) | 2020-07-17 | 2023-05-24 | Mitsubishi Tanabe Pharma Corporation | Agent for preventing or treating muscular disease |
US20230287126A1 (en) | 2020-08-07 | 2023-09-14 | Bio-Thera Solutions, Ltd. | Anti-pd-l1 antibody and use thereof |
MX2023002330A (en) | 2020-09-04 | 2023-03-21 | Merck Patent Gmbh | Anti-ceacam5 antibodies and conjugates and uses thereof. |
CA3198362A1 (en) | 2020-10-07 | 2022-04-14 | Zoetis Services Llc | Anti-ngf antibodies and methods of use thereof |
EP3981789A1 (en) | 2020-10-12 | 2022-04-13 | Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives | Anti-lilrb antibodies and uses thereof |
EP4229081A1 (en) | 2020-10-15 | 2023-08-23 | The United States of America, as represented by The Secretary, Department of Health and Human Services | Antibody specific for sars-cov-2 receptor binding domain and therapeutic methods |
EP4229086A1 (en) | 2020-10-15 | 2023-08-23 | UCB Biopharma SRL | Binding molecules that multimerise cd45 |
CN116670169A (en) | 2020-10-16 | 2023-08-29 | 魁尔斯弗生物治疗股份有限公司 | Multispecific binding compounds that bind to PD-L1 |
WO2022087274A1 (en) | 2020-10-21 | 2022-04-28 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Antibodies that neutralize type-i interferon (ifn) activity |
CA3197465A1 (en) | 2020-11-02 | 2022-05-05 | UCB Biopharma SRL | Use of anti-trem1 neutralizing antibodies for the treatment of motor neuron neurodegenerative disorders |
IL302412A (en) | 2020-11-06 | 2023-06-01 | Novartis Ag | Anti-cd19 agent and b cell targeting agent combination therapy for treating b cell malignancies |
EP4242232A1 (en) | 2020-11-06 | 2023-09-13 | Bio-Thera Solutions, Ltd. | Bispecific antibody and use thereof |
WO2022097060A1 (en) | 2020-11-06 | 2022-05-12 | Novartis Ag | Cd19 binding molecules and uses thereof |
MX2023005609A (en) | 2020-11-13 | 2023-05-29 | Novartis Ag | Combination therapies with chimeric antigen receptor (car)-expressing cells. |
MX2023006426A (en) | 2020-12-01 | 2023-07-17 | Aptevo Res And Development Llc | Heterodimeric psma and cd3-binding bispecific antibodies. |
IL303295A (en) | 2020-12-07 | 2023-07-01 | UCB Biopharma SRL | Multi-specific antibodies and antibody combinations |
KR20230118128A (en) | 2020-12-07 | 2023-08-10 | 유씨비 바이오파마 에스알엘 | Antibodies to Interleukin-22 |
TW202237638A (en) | 2020-12-09 | 2022-10-01 | 日商武田藥品工業股份有限公司 | Compositions of guanylyl cyclase c (gcc) antigen binding agents and methods of use thereof |
TW202237639A (en) | 2020-12-09 | 2022-10-01 | 日商武田藥品工業股份有限公司 | Compositions of guanylyl cyclase c (gcc) antigen binding agents and methods of use thereof |
US20240092892A1 (en) | 2020-12-30 | 2024-03-21 | Bio-Thera Solutions, Ltd. | Anti-cldn18.2 antibody, and preparation method therefor and use thereof |
WO2022148736A1 (en) | 2021-01-05 | 2022-07-14 | Transgene | Vectorization of muc1 t cell engager |
WO2022153195A1 (en) | 2021-01-13 | 2022-07-21 | Memorial Sloan Kettering Cancer Center | Anti-dll3 antibody-drug conjugate |
EP4277664A1 (en) | 2021-01-13 | 2023-11-22 | Memorial Sloan Kettering Cancer Center | Antibody-pyrrolobenzodiazepine derivative conjugate |
AR124681A1 (en) | 2021-01-20 | 2023-04-26 | Abbvie Inc | ANTI-EGFR ANTIBODY-DRUG CONJUGATES |
WO2022159575A1 (en) | 2021-01-20 | 2022-07-28 | Bioentre Llc | Ctla4-binding proteins and methods of treating cancer |
CA3209479A1 (en) | 2021-02-03 | 2022-08-11 | Mozart Therapeutics, Inc. | Binding agents and methods of using the same |
WO2022186773A1 (en) | 2021-03-01 | 2022-09-09 | Aslan Pharmaceuticals Pte Ltd | TREATMENT OF ATOPIC DERMATITIS EMPLOYING ANTI-IL-13Rα1 ANTIBODY OR BINDING FRAGMENT THEREOF IN AN ALLERGIC POPULATION |
WO2022186772A1 (en) | 2021-03-01 | 2022-09-09 | Aslan Pharmaceuticals Pte Ltd | TREATMENT OF ATOPIC DERMATITIS EMPLOYING ANTI-IL-13Rα1 ANTIBODY OR BINDING FRAGMENT THEREOF |
WO2022184910A1 (en) | 2021-03-04 | 2022-09-09 | Centre National De La Recherche Scientifique (Cnrs) | Use of a periostin antibody for treating inflammation, fibrosis and lung diseases |
EP4301782A1 (en) | 2021-03-05 | 2024-01-10 | Go Therapeutics, Inc. | Anti-glyco-cd44 antibodies and their uses |
WO2022197782A1 (en) | 2021-03-17 | 2022-09-22 | Receptos Llc | Methods of treating atopic dermatitis with anti il-13 antibodies |
WO2022201122A1 (en) | 2021-03-26 | 2022-09-29 | Janssen Biotech, Inc. | Humanized antibodies against paired helical filament tau and uses thereof |
EP4067381A1 (en) | 2021-04-01 | 2022-10-05 | Julius-Maximilians-Universität Würzburg | Novel tnfr2 binding molecules |
WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
CA3218933A1 (en) | 2021-05-03 | 2022-11-10 | UCB Biopharma SRL | Antibodies |
WO2022235628A1 (en) | 2021-05-04 | 2022-11-10 | Regeneron Pharmaceuticals, Inc. | Multispecific fgf21 receptor agonists and their uses |
WO2022235940A1 (en) | 2021-05-06 | 2022-11-10 | Dana-Farber Cancer Institute, Inc. | Antibodies against alk and methods of use thereof |
AU2022293999A1 (en) | 2021-06-14 | 2023-11-30 | argenx BV | Anti-il-9 antibodies and methods of use thereof |
TW202317625A (en) | 2021-06-17 | 2023-05-01 | 德商百靈佳殷格翰國際股份有限公司 | Novel tri-specific binding molecules |
WO2022269473A1 (en) | 2021-06-23 | 2022-12-29 | Janssen Biotech, Inc. | Materials and methods for hinge regions in functional exogenous receptors |
KR20240025597A (en) | 2021-06-29 | 2024-02-27 | 씨젠 인크. | Methods of treating cancer with a combination of afucosylated anti-CD70 antibody and CD47 antagonist |
IL310437A (en) | 2021-07-29 | 2024-03-01 | Inst Nat Sante Rech Med | Humanized anti-human βig-h3 protein and uses thereof |
AU2022318416A1 (en) | 2021-07-29 | 2024-01-25 | Takeda Pharmaceutical Company Limited | Engineered immune cell that specifically targets mesothelin and uses thereof |
AU2022324456A1 (en) | 2021-08-05 | 2024-02-15 | Go Therapeutics, Inc. | Anti-glyco-muc4 antibodies and their uses |
WO2023012343A1 (en) | 2021-08-06 | 2023-02-09 | Institut Du Cancer De Montpellier | Methods for the treatment of cancer |
WO2023019200A1 (en) | 2021-08-11 | 2023-02-16 | Viela Bio, Inc. | Inebilizumab and methods of using the same in the treatment or prevention of igg4-related disease |
GB202111905D0 (en) | 2021-08-19 | 2021-10-06 | UCB Biopharma SRL | Antibodies |
WO2023034571A1 (en) | 2021-09-03 | 2023-03-09 | Go Therapeutics, Inc. | Anti-glyco-lamp1 antibodies and their uses |
AU2022339667A1 (en) | 2021-09-03 | 2024-04-11 | Go Therapeutics, Inc. | Anti-glyco-cmet antibodies and their uses |
WO2023048651A1 (en) | 2021-09-27 | 2023-03-30 | Aslan Pharmaceuticals Pte Ltd | Method for treatment of moderate to severe atoptic dematitis |
WO2023048650A1 (en) | 2021-09-27 | 2023-03-30 | Aslan Pharmaceuticals Pte Ltd | TREATMENT OF PRURITIS EMPLOYING ANTI-IL13Rα1 ANTIBODY OR BINDING FRAGMENT THEREOF |
WO2023056069A1 (en) | 2021-09-30 | 2023-04-06 | Angiex, Inc. | Degrader-antibody conjugates and methods of using same |
GB202115122D0 (en) | 2021-10-21 | 2021-12-08 | Dualyx Nv | Binding molecules targeting IL-2 receptor |
WO2023076876A1 (en) | 2021-10-26 | 2023-05-04 | Mozart Therapeutics, Inc. | Modulation of immune responses to viral vectors |
WO2023075702A1 (en) | 2021-10-29 | 2023-05-04 | Aslan Pharmaceuticals Pte Ltd | Anti-il-13r antibody formulation |
WO2023079057A1 (en) | 2021-11-05 | 2023-05-11 | Sanofi | Antitumor combinations containing anti-ceacam5 antibody-drug conjugates and anti-vegfr-2 antibodies |
WO2023097024A1 (en) | 2021-11-24 | 2023-06-01 | Dana-Farber Cancer Institute, Inc. | Antibodies against ctla-4 and methods of use thereof |
WO2023114544A1 (en) | 2021-12-17 | 2023-06-22 | Dana-Farber Cancer Institute, Inc. | Antibodies and uses thereof |
WO2023114543A2 (en) | 2021-12-17 | 2023-06-22 | Dana-Farber Cancer Institute, Inc. | Platform for antibody discovery |
US20230227545A1 (en) | 2022-01-07 | 2023-07-20 | Johnson & Johnson Enterprise Innovation Inc. | Materials and methods of il-1beta binding proteins |
WO2023140780A1 (en) | 2022-01-24 | 2023-07-27 | Aslan Pharmaceuticals Pte Ltd. | Method of treating inflammatory disease |
TW202337905A (en) | 2022-02-23 | 2023-10-01 | 新加坡商亞獅康私人有限公司 | Glycosylated form of anti-il13r antibody |
WO2023170239A1 (en) | 2022-03-09 | 2023-09-14 | Merck Patent Gmbh | Methods and tools for conjugation to antibodies |
WO2023172968A1 (en) | 2022-03-09 | 2023-09-14 | Merck Patent Gmbh | Anti-gd2 antibodies, immunoconjugates and therapeutic uses thereof |
TW202345899A (en) | 2022-03-11 | 2023-12-01 | 比利時商健生藥品公司 | Multispecific antibodies and uses thereof |
TW202346355A (en) | 2022-03-11 | 2023-12-01 | 比利時商健生藥品公司 | Multispecific antibodies and uses thereof |
TW202400636A (en) | 2022-03-11 | 2024-01-01 | 比利時商健生藥品公司 | Multispecific antibodies and uses thereof |
EP4245772A1 (en) | 2022-03-18 | 2023-09-20 | Netris Pharma | Anti-netrin-1 antibody to treat liver inflammation |
EP4249509A1 (en) | 2022-03-22 | 2023-09-27 | Netris Pharma | Anti-netrin-1 antibody against arthritis-associated pain |
WO2023186968A1 (en) | 2022-03-29 | 2023-10-05 | Netris Pharma | Novel mcl-1 inhibitor and combination of mcl-1 and a bh3 mimetic, such as a bcl-2 inhibitor |
GB202205203D0 (en) | 2022-04-08 | 2022-05-25 | UCB Biopharma SRL | Combination with inhibitor |
GB202205200D0 (en) | 2022-04-08 | 2022-05-25 | Ucb Biopharma Sprl | Combination with chemotherapy |
WO2023215498A2 (en) | 2022-05-05 | 2023-11-09 | Modernatx, Inc. | Compositions and methods for cd28 antagonism |
WO2023239803A1 (en) | 2022-06-08 | 2023-12-14 | Angiex, Inc. | Anti-tm4sf1 antibody-drug conjugates comprising cleavable linkers and methods of using same |
WO2023240287A1 (en) | 2022-06-10 | 2023-12-14 | Bioentre Llc | Combinations of ctla4 binding proteins and methods of treating cancer |
WO2024015953A1 (en) | 2022-07-15 | 2024-01-18 | Danisco Us Inc. | Methods for producing monoclonal antibodies |
WO2024013727A1 (en) | 2022-07-15 | 2024-01-18 | Janssen Biotech, Inc. | Material and methods for improved bioengineered pairing of antigen-binding variable regions |
GB202210680D0 (en) | 2022-07-21 | 2022-09-07 | Dualyx Nv | Binding molecules targeting il-35r |
GB202210679D0 (en) | 2022-07-21 | 2022-09-07 | Dualyx Nv | Binding molecules targeting il-12rb2 |
WO2024018426A1 (en) | 2022-07-22 | 2024-01-25 | Janssen Biotech, Inc. | Enhanced transfer of genetic instructions to effector immune cells |
WO2024039670A1 (en) | 2022-08-15 | 2024-02-22 | Dana-Farber Cancer Institute, Inc. | Antibodies against cldn4 and methods of use thereof |
WO2024039672A2 (en) | 2022-08-15 | 2024-02-22 | Dana-Farber Cancer Institute, Inc. | Antibodies against msln and methods of use thereof |
WO2024043837A1 (en) | 2022-08-26 | 2024-02-29 | Aslan Pharmaceuticals Pte Ltd | High concentration anti-il13r antibody formulation |
WO2024050354A1 (en) | 2022-08-31 | 2024-03-07 | Washington University | Alphavirus antigen binding antibodies and uses thereof |
WO2024050524A1 (en) | 2022-09-01 | 2024-03-07 | University Of Georgia Research Foundation, Inc. | Compositions and methods for directing apolipoprotein l1 to induce mammalian cell death |
WO2024054157A1 (en) | 2022-09-06 | 2024-03-14 | Aslan Pharmaceuticals Pte Ltd | Treatment for sleep loss or sleep disturbance in patients with dermatitis |
WO2024056668A1 (en) | 2022-09-12 | 2024-03-21 | Institut National de la Santé et de la Recherche Médicale | New anti-itgb8 antibodies and its uses thereof |
WO2024056862A1 (en) | 2022-09-15 | 2024-03-21 | Avidicure Ip B.V. | Multispecific antigen binding proteins for tumor-targeting of nk cells and use thereof |
WO2024062072A2 (en) | 2022-09-21 | 2024-03-28 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
WO2024062076A1 (en) | 2022-09-21 | 2024-03-28 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
WO2024062082A1 (en) | 2022-09-21 | 2024-03-28 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
GB202214132D0 (en) | 2022-09-27 | 2022-11-09 | Coding Bio Ltd | CLL1 binding molecules |
WO2024068996A1 (en) | 2022-09-30 | 2024-04-04 | Centre Hospitalier Universitaire Vaudois (C.H.U.V.) | Anti-sars-cov-2 antibodies and use thereof in the treatment of sars-cov-2 infection |
EP4353253A1 (en) | 2022-10-10 | 2024-04-17 | Charité - Universitätsmedizin Berlin | Purification of tcr-modified t cells using tcr-specific car-nk cells |
Family Cites Families (23)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4348376A (en) * | 1980-03-03 | 1982-09-07 | Goldenberg Milton David | Tumor localization and therapy with labeled anti-CEA antibody |
GB8308235D0 (en) | 1983-03-25 | 1983-05-05 | Celltech Ltd | Polypeptides |
US4816567A (en) * | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
US4695459A (en) * | 1984-12-26 | 1987-09-22 | The Board Of Trustees Of Leland Stanford Junior University | Method of treating autoimmune diseases that are mediated by Leu3/CD4 phenotype T cells |
US5618920A (en) * | 1985-11-01 | 1997-04-08 | Xoma Corporation | Modular assembly of antibody genes, antibodies prepared thereby and use |
GB8607679D0 (en) * | 1986-03-27 | 1986-04-30 | Winter G P | Recombinant dna product |
AU625613B2 (en) * | 1988-01-05 | 1992-07-16 | Novartis Ag | Novel chimeric antibodies |
CA1339198C (en) * | 1988-02-12 | 1997-08-05 | Gregory Paul Winter | Antibodies to the antigen campath-1 |
EP0365209A3 (en) * | 1988-10-17 | 1990-07-25 | Becton, Dickinson and Company | Anti-leu 3a amino acid sequence |
US5530101A (en) * | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
IL162181A (en) | 1988-12-28 | 2006-04-10 | Pdl Biopharma Inc | A method of producing humanized immunoglubulin, and polynucleotides encoding the same |
CA2018248A1 (en) * | 1989-06-07 | 1990-12-07 | Clyde W. Shearman | Monoclonal antibodies against the human alpha/beta t-cell receptor, their production and use |
US5062934A (en) * | 1989-12-18 | 1991-11-05 | Oronzio Denora S.A. | Method and apparatus for cathodic protection |
US5859205A (en) * | 1989-12-21 | 1999-01-12 | Celltech Limited | Humanised antibodies |
GB8928874D0 (en) * | 1989-12-21 | 1990-02-28 | Celltech Ltd | Humanised antibodies |
GB9014932D0 (en) * | 1990-07-05 | 1990-08-22 | Celltech Ltd | Recombinant dna product and method |
GB9019812D0 (en) * | 1990-09-11 | 1990-10-24 | Scotgen Ltd | Novel antibodies for treatment and prevention of infection in animals and man |
GB9021679D0 (en) * | 1990-10-05 | 1990-11-21 | Gorman Scott David | Antibody preparation |
EP1362868A3 (en) * | 1991-03-06 | 2004-02-11 | MERCK PATENT GmbH | Humanized and chimeric monoclonal antibodies that bind epidermal growth factor receptor (EGF-R) |
EP1857554A1 (en) * | 1991-03-18 | 2007-11-21 | New York University | Monoclonal and chimeric antibodies specific for human tumor necrosis factor |
JPH06202412A (en) * | 1992-12-26 | 1994-07-22 | Canon Inc | Image forming device |
US6180377B1 (en) * | 1993-06-16 | 2001-01-30 | Celltech Therapeutics Limited | Humanized antibodies |
US5535089A (en) * | 1994-10-17 | 1996-07-09 | Jing Mei Industrial Holdings, Ltd. | Ionizer |
-
1989
- 1989-12-21 GB GB898928874A patent/GB8928874D0/en active Pending
-
1990
- 1990-12-21 JP JP3501864A patent/JPH04505398A/en active Pending
- 1990-12-21 AU AU70486/91A patent/AU631481B2/en not_active Expired
- 1990-12-21 DK DK91901559.4T patent/DK0460171T3/en active
- 1990-12-21 EP EP94202090A patent/EP0626390B1/en not_active Revoked
- 1990-12-21 DK DK91901433.2T patent/DK0460167T3/en active
- 1990-12-21 WO PCT/GB1990/002015 patent/WO1991009966A1/en active IP Right Grant
- 1990-12-21 HU HU734/91A patent/HU215383B/en unknown
- 1990-12-21 DE DE69020544T patent/DE69020544T2/en not_active Expired - Lifetime
- 1990-12-21 RU SU5001870A patent/RU2112037C1/en active
- 1990-12-21 KR KR1019910700949A patent/KR100197956B1/en not_active IP Right Cessation
- 1990-12-21 RO RO148281A patent/RO114232B1/en unknown
- 1990-12-21 ES ES91901559T patent/ES2074701T3/en not_active Expired - Lifetime
- 1990-12-21 RO RO148282A patent/RO114298B1/en unknown
- 1990-12-21 KR KR1019910700944A patent/KR100191152B1/en not_active IP Right Cessation
- 1990-12-21 WO PCT/GB1990/002018 patent/WO1991009968A1/en active IP Right Grant
- 1990-12-21 DK DK91901835.8T patent/DK0460178T3/en active
- 1990-12-21 DE DE69022982T patent/DE69022982T2/en not_active Revoked
- 1990-12-21 JP JP50210791A patent/JP3452062B2/en not_active Expired - Lifetime
- 1990-12-21 DK DK94202090T patent/DK0626390T3/en active
- 1990-12-21 DE DE69033857T patent/DE69033857T2/en not_active Revoked
- 1990-12-21 ES ES94202090T patent/ES2165864T3/en not_active Expired - Lifetime
- 1990-12-21 AT AT91901433T patent/ATE129017T1/en not_active IP Right Cessation
- 1990-12-21 HU HU752/91A patent/HU217693B/en unknown
- 1990-12-21 BR BR909007197A patent/BR9007197A/en unknown
- 1990-12-21 CA CA002050479A patent/CA2050479C/en not_active Expired - Lifetime
- 1990-12-21 WO PCT/GB1990/002017 patent/WO1991009967A1/en not_active Application Discontinuation
- 1990-12-21 AU AU69740/91A patent/AU646009B2/en not_active Expired
- 1990-12-21 EP EP91901559A patent/EP0460171B1/en not_active Expired - Lifetime
- 1990-12-21 DE DE69031591T patent/DE69031591T2/en not_active Expired - Lifetime
- 1990-12-21 AT AT91901559T patent/ATE124459T1/en not_active IP Right Cessation
- 1990-12-21 AU AU70330/91A patent/AU649645B2/en not_active Expired
- 1990-12-21 EP EP94104042A patent/EP0620276A1/en not_active Withdrawn
- 1990-12-21 EP EP91901835A patent/EP0460178B1/en not_active Expired - Lifetime
- 1990-12-21 ES ES91901433T patent/ES2079638T3/en not_active Expired - Lifetime
- 1990-12-21 AT AT94202090T patent/ATE208794T1/en not_active IP Right Cessation
- 1990-12-21 AT AT91901835T patent/ATE159299T1/en not_active IP Right Cessation
- 1990-12-21 HU HU912734A patent/HUT58372A/en unknown
- 1990-12-21 ES ES91901835T patent/ES2112270T3/en not_active Expired - Lifetime
- 1990-12-21 RO RO148283A patent/RO114980B1/en unknown
- 1990-12-21 EP EP91901433A patent/EP0460167B1/en not_active Revoked
- 1990-12-21 HU HU912751A patent/HUT60786A/en unknown
- 1990-12-21 JP JP50186591A patent/JP3242913B2/en not_active Expired - Lifetime
- 1990-12-21 CA CA002046904A patent/CA2046904C/en not_active Expired - Lifetime
-
1991
- 1991-03-06 CA CA002037607A patent/CA2037607C/en not_active Expired - Lifetime
- 1991-08-15 GB GB9117611A patent/GB2246781B/en not_active Revoked
- 1991-08-15 GB GB9117612A patent/GB2246570B/en not_active Expired - Lifetime
- 1991-08-19 NO NO19913228A patent/NO316076B1/en not_active IP Right Cessation
- 1991-08-19 NO NO91913229A patent/NO913229L/en not_active Application Discontinuation
- 1991-08-20 FI FI913927A patent/FI108776B/en active
- 1991-08-20 FI FI913926A patent/FI108777B/en active
- 1991-08-20 NO NO19913271A patent/NO310560B1/en not_active IP Right Cessation
- 1991-08-20 FI FI913932A patent/FI108917B/en active
- 1991-08-20 KR KR1019910700950A patent/KR100198478B1/en not_active IP Right Cessation
- 1991-08-20 BG BG95018A patent/BG60462B1/en unknown
- 1991-12-23 ZA ZA9110129A patent/ZA9110129B/en unknown
-
1993
- 1993-09-03 US US08/116,247 patent/US5929212A/en not_active Expired - Lifetime
- 1993-09-13 GB GB9318911A patent/GB2268744B/en not_active Expired - Lifetime
-
1994
- 1994-06-08 AU AU64612/94A patent/AU664801B2/en not_active Expired
-
1995
- 1995-10-12 GR GR950402787T patent/GR3017734T3/en unknown
-
1997
- 1997-12-22 JP JP9353861A patent/JPH11243955A/en active Pending
- 1997-12-24 GR GR970403432T patent/GR3025781T3/en unknown
-
1998
- 1998-11-23 NO NO19985468A patent/NO316074B1/en not_active IP Right Cessation
- 1998-11-23 NO NO985467A patent/NO985467D0/en not_active Application Discontinuation
-
1999
- 1999-04-19 FI FI990875A patent/FI109768B/en active
-
2003
- 2003-11-07 US US10/704,071 patent/US7244615B2/en not_active Expired - Fee Related
- 2003-11-07 US US10/703,963 patent/US7244832B2/en not_active Expired - Fee Related
- 2003-11-07 US US10/704,352 patent/US7241877B2/en not_active Expired - Fee Related
- 2003-11-07 US US10/703,344 patent/US7262050B2/en not_active Expired - Fee Related
-
2004
- 2004-09-10 US US10/937,971 patent/US20050123534A1/en not_active Abandoned
- 2004-09-10 US US10/938,117 patent/US20060029593A1/en not_active Abandoned
- 2004-09-10 US US10/937,949 patent/US20050136054A1/en not_active Abandoned
-
2005
- 2005-11-21 US US11/284,261 patent/US20060073137A1/en not_active Abandoned
- 2005-11-21 US US11/284,260 patent/US20060073136A1/en not_active Abandoned
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2046904C (en) | Cd4 specific recombinant antibody | |
RU2139934C1 (en) | Humanized antibodies and their utilization | |
US20020099179A1 (en) | Cdr-grafted antibodies | |
US7147851B1 (en) | Humanized immunoglobulin reactive with α4β7 integrin | |
US5834597A (en) | Mutated nonactivating IgG2 domains and anti CD3 antibodies incorporating the same | |
US6407214B1 (en) | Antibodies against E-selectin | |
Adair et al. | Humanization of the murine anti-human CD3 monoclonal antibody OKT3 | |
KR20050111748A (en) | Humanized anti-cd4 antibody with immunosuppressive properties | |
JP2002514421A (en) | Antibodies to CD23, their derivatives, and their therapeutic use | |
AU2002226086B2 (en) | Silensed anti-CD28 antibodies and use thereof | |
AU2005201265B2 (en) | Humanized immunoglobulin reactive with alpha4beta7 integrin | |
Harris | Humanising Monoclonal Antibodies |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
MKEX | Expiry |